Next Article in Journal
New Records of Sharpshooters (Hemiptera, Cicadellidae, Cicadellinae) in Citrus Orchards in Amazonas State, Brazil
Previous Article in Journal
Sublethal Effects of Pyridaben on the Predatory Function of Neoseiulus womersleyi
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 9
10.3390/insects15090648
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evolutionary Relationships of Omani Macrotermes subhyalinus, Macrotermitinae

by
Hilal S. AlShamakhi
1,
Abdullah M. Al-Sadi
2,3,* and
Lyn G. Cook
4
1
Royal Court Affairs, Royal Estates Affairs, Muscat 113, Oman
2
Department of Plant Sciences, College of Agricultural and Marine Sciences, Sultan Qaboos University, Al Khoud 123, Oman
3
College of Agriculture, University of Al Dhaid, Sharjah P.O. Box 27272, United Arab Emirates
4
School of Biological Sciences, The University of Queensland, Brisbane, QLD 4072, Australia
*
Author to whom correspondence should be addressed.
Insects 2024, 15(9), 648; https://doi.org/10.3390/insects15090648
Submission received: 27 March 2024 / Revised: 7 August 2024 / Accepted: 13 August 2024 / Published: 29 August 2024
(This article belongs to the Section Insect Systematics, Phylogeny and Evolution)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

In our recent investigation, we delved into the evolutionary relationships of Macrotermes subhyalinus populations in Oman. Our study employed genetic markers: the mitochondrial COI gene and the nuclear large-subunit ribosomal RNA (LSU rRNA S28). Our analyses revealed that M. subhyalinus in Oman belongs to an East African clade, distinct from its West African counterparts. This geographic divergence hints at separate evolutionary trajectories. Notably, we detected base composition bias among taxa in the COI gene. Our results support the idea that Macrotermes species might have dispersed out of Africa. Additionally, we report pseudogene copies of 28S in M. subhyalinus, adding a novel dimension to termite genomics.

Abstract

A study was conducted to investigate the evolutionary relationships of Macrotermes subhyalinus from Oman, in the southeastern part of the Arabian Peninsula. Sequences of the mitochondrial COI and the nuclear large-subunit ribosomal RNA (LSU rRNA, 28S) genes were used to investigate the populations of M. subhyalinus across their distribution in Oman to determine their relationships with other Macrotermes species. Our findings indicate that M. subhyalinus in Oman is a member of an East African clade, distinct from those in West Africa. Analyses of the COI showed that there is base composition bias among the taxa (non-stationarity) that has not been considered in earlier studies. We provide the first report of pseudogene copies of 28S in M. subhyalinus that are differentially amplified.

1. Introduction

Fungus-gardening termites (Termitidae: Macrotermitinae) have obligate symbioses with the fungus Termitomyces (Basidiomycete: Agaricales: Lyophyllaceae), and no free-living state of either partner has been recorded [1]. The fungus is gardened inside the nest in constant environmental conditions and provides the major food source for the host termite [2].
There appears to have been a single evolution of the fungus-gardening habit in the common ancestor of Macrotermitinae [3], which has been estimated to date between 19 and 19 and 49 million years ago (Ma) [4] or 30–108 Ma [5]. It has been argued that the fungus-gardening habit evolved in a forest biome, based on ancestral state reconstructions [6], the warm moist conditions needed by the fungus, and the molecular dating placing the crown of Macrotermitinae before the origins of savannah.
Morphological and molecular analyses indicate that Macrotermitinae are monophyletic [7,8,9,10]. They are distributed across the Palaeotropics and have the highest diversity of genera in Africa [9,11], leading to the common assumption that the subfamily is of African origin [11,12,13]. Overall, the fossil record and biogeographic patterns indicate that diversification during the Cenozoic and dispersal explain the current distributions [14]. Three genera are widely distributed in the Afrotropical and Oriental regions: Macrotermes, Odontotermes, and Microtermes [11]. The subfamily does not appear to disperse across significant water gaps and has not been reported in oceanic islands [11]. Unlike the Afrotropical genera Odontotermes and Microtermes, Macrotermes is more widely distributed across Oriental and Afrotropical regions [9].
There are well-known taxonomic problems within the genus Macrotermes [5,15,16,17], partly because there are few characteristics that differentiate between the currently recognized species [15], and there are problems in assigning newly collected material to described species [18]. One of the major problems is the non-monophyly of the African species Macrotermes subhyalinus [5,19,20], which replaced M. bellicosus after the split of Macrotermes natalensis [21] into M. bellicosus and M. natalensis [15]. The identification and differentiation of M. subhyalinus from other closely related termites have traditionally been based on the morphological features of all castes [15]. However, it is not always possible to differentiate and identify M. subhyalinus from other termites based on the available morphological descriptions because there are no synapomorphies for the species. For instance, M. falciger is commonly misidentified as M. subhyalinus due to morphological variations in both species across areas in which they both occur in Africa (e.g., Kenya and Tanzania) [22] (Table 1).
DNA sequence data, in particular, the mitochondrial (mt) gene cytochrome oxidase subunit 1 (COI), have begun to be used to identify and differentiate between species of Macrotermes [19]. Using overlapping datasets of mostly the same COI sequence data [5,19], found that populations of M. subhyalinus from West and East Africa did not form a monophyletic group: The West African samples clustered with M. herus and the East African samples clustered with M. jeanneli. Differences between Western and Eastern African lineages are also evident biologically, with East African colonies (e.g., in Kenya) having many open ventilation chimneys [19,23], whereas mounds in West Africa (e.g., Ivory Coast) have only a single open ventilation chimney [5,23]. The appearance of West African mounds of M. subhyalinus is very similar to the mounds of M. herus [24], in line with the sister relationship recovered from the analysis of COI [5]. The similarity in the mound structure and COI data casts doubt on the separate species status of M. herus and the West African populations of M. subhyalinus [5,19].
Here, we sampled populations of M. subhyalinus from across its distribution in Oman, on the Arabian Peninsula, to determine their relationships with other Macrotermes. We used COI data from the sampled populations and all other available Macrotermes COI sequences to assess the idea that Macrotermes have dispersed to the Arabian Peninsula out of Africa.

2. Materials and Methods

2.1. Specimen Sampling

Individuals of M. subhyalinus were collected from 76 colonies across Dhofar, southern Oman, during June and July 2015 (Figure 1). The initial processing of samples was performed within 12 h. Major soldiers, minor soldiers, major workers, minor workers, and imagoes were separated from fungal combs and surface-sterilized in 70% ethanol and then preserved in 99% ethanol until the extraction of genomic DNA.

2.2. DNA Extraction

2.2.1. COI

One major soldier was selected from each colony. Genomic DNA was extracted from the head and thorax to reduce contamination from food sources and symbiotic microbes in the gut and abdomen. The samples were ground manually in 600 µL of 2X CTAB buffer and 10 µL of proteinase K (>600 mAU/mL). The mixture was then incubated on a hot plate for 2 h at 55 °C. The proteinase K was then denatured at 95 °C for 10 min. For RNA digestion, 0.5 µL of 100 mg/µL RNAse A was added to the mixture and incubated on the hot plate for 10 min at 37 °C. The subsequent steps were carried out as described previously [15].

2.2.2. 28S

For the autosomal large-subunit ribosomal RNA gene (28S), we amplified two regions, the expansion regions D3–D5 and D2–D3 of the rRNA. The former region was amplified with an annealing temperature of 50 °C using primers (Hux and Win) [25]. The D2–D3 region was amplified with an annealing temperature of 55 °C using the primers S3660 [26] and A335 [27]. The PCR consisted of an initial denaturing step for 2 min at 94 °C, then 40 cycles of denaturing at 94 °C (60 s), and annealing (60 s) and extension at 72 °C (120 s), followed by 10 min of additional extension at 72 °C.

2.3. Amplification and Sequencing Protocol

We amplified part of the mitochondrial gene cytochrome oxidase subunit 1 (COI) and the D3–D5 expansion regions of the nuclear large-subunit ribosomal RNA gene (LSU rRNA, 28S) About 710 bp of COI was amplified with the Vrijenhoek [28] primers LCO-1490 (GGTCAACAAATCATAAAGATATTGG) and HCO-2198 (TAAACTTCAGGGTGACCAAAAAATCA) and a PCR consisting of an initial denaturing step for 2 min at 95 °C, and then 5 cycles of denaturing at 94 °C (40 s), annealing at 45 °C (40 s), and extension at 72 °C (70 s), followed by 40 cycles of denaturing at 94 °C (40 s), annealing at 51 °C (40 s), extension at 72 °C (70 s), and 5 min of additional extension at 72 °C. The D3–D5 region of 28S was amplified with the primers Hux (ACACGGACCAAGGAGTCTAAC) and Win (GTCCTGCTGTCTTAAGCAACC) [25] at an annealing temperature of 50 °C. A subset of specimens was later sequenced for the D2–D3 region of 28S using the primers S3660 (GAGAGTTMAASAGTACGTGAAAC) [26] and A335 (TCGGARGGAACCAGCTACTA) [29] at an annealing temperature of 55 °C. The PCR products were sequenced at Macrogen Inc. (Seoul, Korea) using BigDye 3.1 (Applied Biosystems, Foster city, CA, USA) and the Sanger method using the same primers used for the initial amplification.

2.4. Phylogenetic Analysis

COI
The samples were sequenced in both the forward and reverse directions and then edited and aligned using multiple-sequence alignment based on fast Fourier transform (MAFFT v7.017) [30] under the L-INS-I option (iterative refinement method incorporating local pairwise alignments), with a gap opening penalty = 1.5, 200 PAM/K = 2 scoring matrix, and offset value = 0.123, implemented in GENEIOUS R9 [31]. The same program was also used to estimate the COI divergence among regions using the max divergence option.
For the analysis of COI, 91 terminals (branches that represent sequences or hypothetical sequences at various points in evolutionary history) of the fungus-gardening species subfamily Macrotermitinae, representing 34 species and 7 genera, were included from GenBank (Table S2) along with 28 terminals representing 21 non-fungus-gardening species of Termitidae outside the subfamily Macrotermitinae to use as outgroups (Table S3). The non-fungus-gardening species Sphaerotermes sphaerothorax was also included because it has been placed in Macrotermitinae by some authors [3,9]. Some sequences were excluded due to ambiguity or that they are identical to other sequences (Table S4).
The COI gene alignment was checked for stop codons and indels in multiples other than three (the region is protein-coding). The first-, second-, and third-codon positions of COI were tested for deviations from stationary (base composition bias among taxa) using PAUP v4.0a146 [32] because this violates the assumptions of most phylogenetic methods. Two datasets were analyzed for COI: one comprising a wide selection of Termitidae and another comprising only Macrotermitinae. Third-codon positions of COI were excluded in sequences from across Termitidae datasets where there was non-stationarity. RNAfold [33] was used to estimate the secondary structure of several stem–loops in the 28S RNA.
Distance-based dendrograms were calculated, and phylogenetic analyses were performed using two methods (maximum parsimony and Bayesian inference) [34,35], as explained previously [10].
JMODELTEST v2.1.6 [36] was used to select the model of sequence evolution to be applied to Bayesian analyses. The best model under the BIC criterion (HKY [37], including a proportion of invariable sites (I) and gamma-distributed among-site rate variation (Γ)) was then implemented as a prior in MrBayes v3.2.6 [38] and BEAST. MrBayes was run for 10 million generations, sampling every 1000 generations. Convergence was determined to have occurred when the differences in the harmonic mean of the two runs were less than two, and ESS values were indicated to be well-sampled using the software TRACER v1.6 [39]. The samples saved post-burn-in were pooled before calculating the majority rule consensus. Posterior probabilities of 0.95 and above were considered significant (for a comparison of bootstrap values and posterior probabilities.
28S
Alleles (variants of the sequence of nucleotides at a particular location, or locus, on a DNA molecule) of 28S from heterozygotes were phased using PHASE v2.1.1 [40] and implemented in DnaSP v5.10 [41]. Highly ambiguous (multiple polymorphisms that were not confidently phased) and identical sequences were removed before the analysis to decrease polytomies that result from conflict and to reduce the over-representation of identical sequences to the model estimation. The sequences were aligned using MAFFT under the option (L-INS-I) implemented in GENEIOUS.
The whole of 28S was tested for deviations from stationary using PAUP v4.0a146 [32] because this violates the assumptions of most phylogenetic methods. Sequences edited and aligned using MAFFT v7.017 [30] under the option (E-INS-I: iterative refinement method incorporating local alignment with generalized affine gap costs (gap opening penalty = 1.5; 200 PAM/K = 2 scoring matrix for nucleotide sequences) implemented in the Geneious program R9 [31]. The sequences were checked for base variations and site heterozygosity. In cases where heterozygosity is present, the PCR sequence product does not allow the determination of the phase of any variation sites detected or haplotypes, except in cases of homozygous samples or in cases in which all but one variation site is homozygous. Thus, computational inferences using probabilistic models are necessary to obtain haplotypes before running any phylogenetic analysis.
The PHASE v2.1.1 package program [40], implemented with the DNA polymorphism data (DnaSP v5.10) software [41], was used to assign the most probable haplotype constitution of each 28S heterozygous sequence. The database containing homologous and heterozygous sequences was loaded into the PHASE software v 2.1.1 [40]. Analysis was performed using six independent runs with different seed values; number of iterations = 100; thinning interval = 1; and burn-in iterations = 100. Haplotypes with > 0.9 (90%) probability were considered. We included 21 terminals of the fungus-gardening species subfamily Macrotermitinae as in-taxa, and 61 terminals of non-fungus-gardening species (outgroup) from GenBank to infer the phylogenetic placement of the Omani Macrotermes using both parsimony and Bayesian analysis.
We checked for recombination among alleles using the “detect recombination” option implemented in the Geneious program based on a dual multiple change-point model [42,43]. Analysis was performed using a random seeding number; a chain length of 1,100,000; a subsampling frequency of every 10,000 states; and a 10% burn-in. Furthermore, we predicted the secondary structure for homozygous haplotypes A1, K4, and C4 using the computer method for folding an RNA molecule that finds a conformation of minimum free energy (MFE) using the values of the stacking and destabilizing energies (RNAfold) [33] (web server: http://rna.tbi.univie.ac.at, accessed on 8 November 2017). We compared the helix length, loop structures, and base composition of the predicted structures with the structural elements of the expansion regions D3–D5 of the Arthropods [44].
To test the effect of base composition heterogeneity among taxa on divergence times, we compared our dataset (with outgroup) before and after the RY coding of the third-codon position. For the non-RY-coded dataset, we applied two different relaxed-clock models, the lognormal uncorrelated relaxed clock model (UCLN) and the exponential uncorrelated relaxed clock model (UCED) implemented in BEAST using the HKY + I + G substitution model for the (1st + 2nd)- and 3rd-codon partitions. For the RY coding, we followed the Harrison et al. [45] method, coding the third-codon positions as purines or pyrimidines. RY coding reduces the effect of differences in the nucleotide composition between species resulting from C-T differences (pyrimidine bias), or between A and G (purine bias) [46]. Appropriate substitution models of the sequence evolution for each partition were assigned according to JMODELTEST v2.1.6. These were HKY + I + G for the (1st + 2nd)-codon partition and F81 + I + G [47] for the RY-coded 3rd-codon partition.

3. Results

3.1. COI

Specimens from 72 of the 76 collection locations in Oman were successfully sequenced for COI. All were identical across the 538 bp after trimming, and, therefore, only one representative sample was used in further analyses. When sequences from across the whole of Termitidae were included, there was significant non-stationarity (base composition bias among taxa) at third-codon positions (p = 0.0003) but not at first- and second-codon positions (Table 2). There was no non-stationarity at any codon position within Macrotermitinae (Table 2) or Macrotermitinae plus the non-fungus-gardening genus Sphaerotermes (Table 2).
There was strong support from the analyses of COI without RY coding for the monophyly of Macrotermitinae plus Sphaerotermes (PP = 1.00 and BS = 100; Figure 2) but not for Macrotermitinae without Sphaerotermes, except in the MrBayes analysis (PP = 0.98; Figure 2). Similar results were obtained for COI based on the RY coding, with strong support from all analyses for the monophyly of Macrotermitinae plus Sphaerotermes (PP = 1.00; BS = 100) but not for Macrotermitinae without Sphaerotermes.
The tree topology and support values of the phylogeny estimates using RY coding were very different, with inaccurate grouping of lineages with similar base frequencies (e.g., Beast retrieved both genus Macrotermes and Odontotermes as non-monophyletic) (Figure 3) and posterior probabilities’ support values (e.g., the posterior probabilities for most groups were very low, at < 0.95, compared with the COI tree analysis without RY coding).
Macrotermes formed a monophyletic group in all analyses. but with little support (Figure 2). The three African forest species (M. muelleri, M. nobilis, and M. lilljeborgi) clustered together with strong support (PP = 1.00; BS = 100). The African species M. natalensis, M. jeanneli, M. subhyalinus, M. falciger, and M. herus formed a second well-supported clade (PP = 1.00; BS = 0.99) (Figure 2), whereas the Asian species (M. ahmadi, M. annandalei, M. barneyi, M. glivus, and M. carbonarius) formed a clade in the MrBayes analysis, but it was not well-supported (BS < 0.95). The two haplotypes of the African species M. bellicosus clustered together with strong support in the MP analyses but not in the Bayesian analysis (PP = 1.00; BS < 0.95).
Macrotermes subhyalinus was recovered as non-monophyletic in the analyses of COI. The haplotype presented in the Oman fell sister to a GenBank sequence recorded therein as being from M. falciger (Figure 2), with a 1.1% difference. Together, these formed a clade with sequences of M. subhyalinus from East Africa. The West African haplotypes from M. subhyalinus fell among sequences of M. herus with strong support in the MP analyses but not in the Bayesian analysis (PP = 1.00; BS < 0.95).
In contrast with the lack of variation in COI among Omani specimens, there was up to 0.5% divergence among the M. subhyalinus specimens from Kenya and up to 0.2% divergence in another Macrotermes michaelseni in Kenya.

3.2. 28S

We amplified multiple alleles of 28S from 68 specimens collected in Oman. In total, 3 alleles were found in the homozygous state, but most individuals (n = 57) were heterozygous (an allele is represented by 1 or more base pair sequence differences for a given stem loop). One allele (C4) (Figure 4) was identical to those of M. subhyalinus (FJ806532) and M. malaccensis (DQ441945) in GenBank, whereas the other alleles fell outside GenBank accessions of Macrotermes and its sister genera but inside Macrotermitinae (Figure 4). Phasing estimated 24 haplotypes (probability > 0.9). The phylogenetic trees inferred from both the parsimony and Bayesian methods were highly similar. Only one homozygous specimen (haplotype C4) was placed within Macrotermes, and the rest formed a clade sister to the Macrotermitinae (Figure 1).
The recombination test detected no recombination rate among the tested haplotypes. The homozygous sequence (C4) formed similar helix lengths and loops to the structural elements of Arthropods (Figure 5a). In contrast, there was significant variability in the helix lengths, loop structures, sequence lengths, and base composition of the conserved regions in (K4, A1) (Figure 5b,c), which indicated the presence of multiple defunct relatives to the normal 28S gene or pseudogenes. The estimation of the RNA secondary structure using RNAfold indicated that these copies were likely to be pseudogenes, defunct copies of 28S that formed a different secondary structure for the D3 region than that estimated for all other arthropods. The amplification of the D2–D3 region of 28S using the primers S3660 and A335 recovered only the C4 variant from all the Omani specimens trialed, including those that were identified as heterozygous when using the primer pair from Hux and Win [34].

4. Discussion

The populations of M. subhyalinus across their distribution in Oman are members of an East African clade and distinct from M. subhyalinus in West Africa, and there was no genetic diversity found in Oman. Analyses of COI showed that there is base composition bias among the taxa. There is no specific evidence or documentation indicating that M. falciger has been introduced into Oman. The inclusion of M. falciger in the East African clade can be explained by geographic proximity. When populations are geographically closer, they are more likely to experience gene flow, which can lead to genetic similarities. This proximity facilitates interactions such as migration and interbreeding, which can result in the observed genetic relatedness. Therefore, the close geographic distance between M. falciger and East African subhyalinus populations likely contributed to their genetic similarities and their inclusion in the same clade. In addition, there are pseudogene copies of 28S in M. subhyalinus that are differentially amplified with different primers. The inclusion of COI and 28S from the same samples was crucial for this study. These genetic markers provided complementary information that was essential for accurately distinguishing between the East and West populations. The COI marker, being mitochondrial, offers insights into maternal lineage, while the 28S marker, being nuclear, provides a broader genetic perspective. Together, they enhanced the resolution of our phylogenetic analysis, leading to the clear separation of the populations. Non-stationarity violates the assumptions of most methods of phylogenetic analysis, including MP, ML, and Bayesian methods [48], and potentially leads to the erroneous grouping of lineages with similar base frequencies. It might also artificially increase the observable differences between taxa and lead to the inappropriate modeling of substitution rates among bases (averaging such that parameters do not fit either bias), which may affect the molecular results through the perturbation of relative branch lengths.
Both genes analyzed here place the Omani populations of Macrotermes with M. subhyalinus from East Africa, but a sequence of M. falciger is also in the clade (Figure 2). The lack of genetic variation in COI among Omani populations, and the variation among Kenyan populations, indicates that Macrotermes subhyalinus likely dispersed into Oman. The lack of variation among populations could be a result of a relatively recent single establishment event or indicate a genetic bottleneck sometime after establishment (e.g., [49]). The lack of genetic diversity in M. subhyalinus suggests a bottleneck event, which could have reduced the population size and genetic variation. However, the close genetic relationship between M. falciger and East African M. subhyalinus raises questions about potential genetic exchange. The possibility of genetic exchange between these two groups lacks direct evidence. Further studies, such as more detailed genetic analyses or ecological investigations, could provide additional insights into the relationship between these populations and help clarify whether genetic exchange has occurred.
The relationship of Omani populations with M. subhyalinus and M. falciger from eastern Africa makes sense in terms of biogeography: Oman and the rest of the Arabian Peninsula are geographically closer to East Africa. More finely resolving markers and better sampling from Africa are needed to assess the biogeography of Omani M. subhyalinus.
The COI haplotype from Omani termites identified as M. subhyalinus fell sister to a haplotype from a termite identified as M. falciger, and samples identified as M. subhyalinus did not form a monophyletic group (Figure 2). There are well-known problems around the taxonomy of species of Macrotermes [5,15,16,19,50], and our analyses reiterate that M. subhyalinus is not monophyletic. To date, there has been an over-reliance on data from COI for estimating relationships among Macrotermitinae and other Termitidae. Furthermore, there is little overlap between the species included in studies using COI and those using 28S, and, other than here, none have used the same specimens. Resolution of the species status of M. subhyalinus will need more sampling of multiple nuclear genes from a geographically comprehensive sampling of the population of M. subhyalinus and other closely related species, such as has been carried out with Calligrapha [51] and Gonioctena [52] (Coleoptera: Chrysomelidae).
The mounds of M. subhyalinus in Oman have many open ventilation chimneys, similar to those described for M. subhyalinus in Kenya [5,23], whereas the mounds in West Africa have only one large opening [23]. The relationship between the Omani populations of M. subhyalinus is, therefore, consistent with previous observations that the mound shape differs between the eastern and western clades of M. subhyalinus. This is further evidence that the fossil mound cannot be definitively assigned to an extant species and that the species differs between east and west and further supports the consideration of species status for the two types.
Macrotermes subhyalinus from Oman is closely related to M. falciger and M. subhyalinus from East Africa. The lack of diversity at COI and 28S suggests that populations have only recently arrived in Oman from only a few founding individuals. Furthermore, our analyses reiterate that M. subhyalinus is not monophyletic, with the populations from West Africa having a different sister group from East African populations. More molecular data and broad geographic sampling are needed to resolve the taxonomy of M. subhyalinus.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/insects15090648/s1. Table S1: location longitude, latitude, and elevation of the mounds used in this study; Table S2: origin, and GenBank accession number of the fungus-gardening termite Macrotermitinae sequences used in this study. Table S3: Species of non-fungus-gardening Termitidae included as outgroup in this study. Table S4: GenBank accession numbers of sequences excluded in this study and reasons of exclusion.

Author Contributions

Conceptualization, H.S.A., A.M.A.-S. and L.G.C.; methodology, H.S.A.; validation, H.S.A.; formal analysis, H.S.A.; investigation, H.S.A.; writing—original draft preparation, H.S.A.; writing—review and editing, A.M.A.-S. and L.G.C.; supervision, A.M.A.-S. and L.G.C.; funding acquisition, H.S.A., A.M.A.-S. and L.G.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Royal Court Affairs and Sultan Qaboos University, Oman.

Data Availability Statement

The original data presented in this study are available in the Supplementary Materials.

Acknowledgments

The authors would like to thank Sultan Qaboos University, the Department of Plant Sciences, for providing us with a well-equipped platform to undergo our research activities. Thanks to Elham Kazerooni for her help in formatting the final draft of this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rouland-Lefèvre, C. Symbiosis with fungi. In Termites: Evolution, Sociality, Symbioses, Ecology; Springer: Berlin/Heidelberg, Germany, 2000; pp. 289–306. [Google Scholar]
  2. Sieber, R. Establishment of fungus comb in Laboratory colonies ofMacrotermes michaelseni andOdontotermes montanus (Isoptera, Macrotermitinae). Insectes Sociaux 1983, 30, 204–209. [Google Scholar] [CrossRef]
  3. Aanen, D.K.; Eggleton, P.; Rouland-Lefevre, C.; Guldberg-Frøslev, T.; Rosendahl, S.; Boomsma, J.J. The evolution of fungus-growing termites and their mutualistic fungal symbionts. Proc. Natl. Acad. Sci. USA 2002, 99, 14887–14892. [Google Scholar] [CrossRef] [PubMed]
  4. Nobre, T.; Kone, N.A.; Konate, S.; Linsenmair, K.E.; Aanen, D.K. Dating the fungus-growing termites’ mutualism shows a mixture between ancient codiversification and recent symbiont dispersal across divergent hosts. Mol. Ecol. 2011, 20, 2619–2627. [Google Scholar] [CrossRef] [PubMed]
  5. Brandl, R.; Hyodo, F.; von Korff-Schmising, M.; Maekawa, K.; Miura, T.; Takematsu, Y.; Matsumoto, T.; Abe, T.; Bagine, R.; Kaib, M. Divergence times in the termite genus Macrotermes (Isoptera: Termitidae). Mol. Phylogenetics Evol. 2007, 45, 239–250. [Google Scholar] [CrossRef]
  6. Aanen, D.K.; Eggleton, P. Fungus-growing termites originated in African rain forest. Curr. Biol. 2005, 15, 851–855. [Google Scholar] [CrossRef] [PubMed]
  7. Miura, T.; Maekawa, K.; Kitade, O.; Abe, T.; Matsumoto, T. Phylogenetic relationships among subfamilies in higher termites (Isoptera Termitidae) based on mitochondrial COII gene sequences. Ann. Entomol. Soc. Am. 1998, 91, 515–523. [Google Scholar] [CrossRef]
  8. Donovan, S.; Jones, D.; Sands, W.; Eggleton, P. Morphological phylogenetics of termites (Isoptera). Biol. J. Linn. Soc. 2000, 70, 467–513. [Google Scholar] [CrossRef]
  9. Kambhampati, S.; Eggleton, P. Taxonomy and phylogeny of termites. In Termites: Evolution, Sociality, Symbioses, Ecology; Springer: Berlin/Heidelberg, Germany, 2000; pp. 1–23. [Google Scholar]
  10. AlShamakhi, H.S.; Al-Sadi, A.M.; Cook, L.G. Phylogenetic Relationships of the Mutualistic Fungi Associated with Macrotermes subhyalinus in Oman. Mycobiology 2023, 51, 281–287. [Google Scholar] [CrossRef]
  11. Eggleton, P. Global patterns of termite diversity. In Termites: Evolution, Sociality, Symbioses, Ecology; Springer: Berlin/Heidelberg, Germany, 2000; pp. 25–51. [Google Scholar]
  12. Darlington, J.P.E.C. Nutrition and evolution in fungus-growing termites. In Nourishment and Evolution in Insect Societies; Hunt, J.H., Nalepa, C.A., Eds.; Westview Press, Inc.: Boulder, CO, USA, 1994; pp. 105–130. [Google Scholar]
  13. Wang, M.-M.; Song, N.; Guo, S.-B.; Yin, X.-M. A comprehensive sampling of mitogenomes shows the utility to infer phylogeny of termites (Blattodea: Termitoidae). J. Insect Sci. 2024, 24, 7. [Google Scholar] [CrossRef]
  14. Qiu, B.; Elsner, D.; Korb, J. High-quality long-read genome assemblies reveal evolutionary patterns of transposable elements and DNA methylation in termites. bioRxiv 2023, preprint. [Google Scholar] [CrossRef]
  15. Ruelle, J.E. A Revision of the Termites of the Genus Macrotermes from the Ethiopian Region (Isoptera: Termitidae); British Museum (Natural History): London, UK, 1970; pp. 366–444. [Google Scholar]
  16. Bagine, R.; Darlington, J.; Kat, P.; Ritchie, J. Nest structure, population structure and genetic differentiation of some morphologically similar species of Macrotermes in Kenya. Sociobiology 1989, 15, 125–132. [Google Scholar]
  17. Egan, B.; Nethavhani, Z.; van Asch, B. Overview of the genetic diversity of African Macrotermes (Termitidae: Macrotermitinae) and implications for taxonomy, ecology and food science. Insects 2021, 12, 518. [Google Scholar] [CrossRef]
  18. van der Werff, P.A. Two mound types of Macrotermes near Kajiado (Kenya): Intraspecific variation or interspecific divergence? In Biosystematics of Social Insects; Howse, P.E., Clement, J.L., Eds.; Academic Press: New York, NY, USA, 1981; Volume 19, pp. 231–247. [Google Scholar]
  19. Marten, A.; Kaib, M.; Brandl, R. Cuticular hydrocarbon phenotypes do not indicate cryptic species in fungus-growing termites (Isoptera: Macrotermitinae). J. Chem. Ecol. 2009, 35, 572–579. [Google Scholar] [CrossRef] [PubMed]
  20. Rambur, P. Histoire Naturelle des Insectes. Névroptères; Roret: Paris, France, 1842. [Google Scholar]
  21. Haviland, G.D. Observations on termites; with descriptions of new species. J. Linn. Soc. Lond. Zool. 1898, 26, 358–442. [Google Scholar] [CrossRef]
  22. Silvestri, F. Contribuzione alla conoscenza dei Termitidae e Termitofili dell’Africa occidentale. 1. Termitidi. Boll. Del Lab. Zool. Gen. E Agrar. 1914, 1–146. [Google Scholar]
  23. Darlington, J.P.E.C. Two types of mound built by the termite Macrotermes subhyalinus in Kenya. Int. J. Trop. Insect Sci. 1984, 5, 481–492. [Google Scholar] [CrossRef]
  24. Sjostedt, Y. Isoptera in: W. Michaelsen. Beitr. Land-u. Siiswasserfauna Dtsch-SiidwAfr 1914, 1, 73–92. [Google Scholar]
  25. Inward, D.J.; Vogler, A.P.; Eggleton, P. A comprehensive phylogenetic analysis of termites (Isoptera) illuminates key aspects of their evolutionary biology. Mol. Phylogenet. Evol. 2007, 44, 953–967. [Google Scholar] [CrossRef]
  26. Dowton, M.; Austin, A. Phylogenetic relationships among the microgastroid wasps (Hymenoptera: Braconidae): Combined analysis of 16S and 28S rDNA genes and morphological data. Mol. Phylogenetics Evol. 1998, 10, 354–366. [Google Scholar] [CrossRef]
  27. Whiting, M.F.; Carpenter, J.C.; Wheeler, Q.D.; Wheeler, W.C. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Syst. Biol. 1997, 46, 1–68. [Google Scholar] [CrossRef]
  28. Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  29. Lin, Y.P.; Edwards, R.D.; Kondo, T.; Semple, T.L.; Cook, L.G. Species delimitation in asexual insects of economic importance: The case of black scale (Parasaissetia nigra), a cosmopolitan parthenogenetic pest scale insect. PLoS ONE 2017, 12, e0175889. [Google Scholar] [CrossRef]
  30. Katoh, K.; Misawa, K.; Kuma, K.i.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
  31. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
  32. Swofford, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (* and other Methods), 4; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
  33. Zuker, M.; Stiegler, P. Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 1981, 9, 133–148. [Google Scholar] [CrossRef] [PubMed]
  34. Hillis, D.M.; Bull, J.J. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 1993, 42, 182–192. [Google Scholar] [CrossRef]
  35. Maddison, D.R. The discovery and importance of multiple islands of most-parsimonious trees. Syst. Biol. 1991, 40, 315–328. [Google Scholar] [CrossRef]
  36. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
  37. Hasegawa, M.; Kishino, H.; Yano, T.-a. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 1985, 22, 160–174. [Google Scholar] [CrossRef]
  38. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
  39. Rambaut, A.; Suchard, M.; Xie, D.; Drummond, A. Tracer v1. 6. 2014. Available online: http://beast.bio.ed.ac.uk/Tracer (accessed on 12 August 2024).
  40. Stephens, M.; Smith, N.J.; Donnelly, P. A new statistical method for haplotype reconstruction from population data. Am. J. Hum. Genet. 2001, 68, 978–989. [Google Scholar] [CrossRef]
  41. Rozas, J.; Rozas, R. DnaSP, DNA sequence polymorphism: An interactive program for estimating population genetics parameters from DNA sequence data. Comput. Appl. Biosci. CABIOS 1995, 11, 621–625. [Google Scholar] [CrossRef] [PubMed]
  42. Minin, V.N.; Dorman, K.S.; Fang, F.; Suchard, M.A. Dual multiple change-point model leads to more accurate recombination detection. Bioinformatics 2005, 21, 3034–3042. [Google Scholar] [CrossRef]
  43. Suchard, M.A.; Weiss, R.E.; Dorman, K.S.; Sinsheimer, J.S. Inferring Spatial Phylogenetic Variation Along Nucleotide Sequences: A Multiple Changepoint Model. J. Am. Stat. Assoc. 2003, 98, 427–437. [Google Scholar] [CrossRef]
  44. Gillespie, J.J.; Johnston, J.S.; Cannone, J.J.; Gutell, R.R. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): Structure, organization, and retrotransposable elements. Insect Mol. Biol. 2006, 15, 657–686. [Google Scholar] [CrossRef] [PubMed]
  45. Harrison, G.A.; McLenachan, P.; Phillips, M.; Slack, K.E.; Cooper, A.; Penny, D. Four new avian mitochondrial genomes help get to basic evolutionary questions in the late Cretaceous. Mol. Biol. Evol. 2004, 21, 974–983. [Google Scholar] [CrossRef] [PubMed]
  46. Phillips, M.J.; Penny, D. The root of the mammalian tree inferred from whole mitochondrial genomes. Mol. Phylogenetics Evol. 2003, 28, 171–185. [Google Scholar] [CrossRef]
  47. Felsenstein, J. Evolutionary trees from DNA sequences: A maximum likelihood approach. J. Mol. Evol. 1981, 17, 368–376. [Google Scholar] [CrossRef]
  48. Jermiin, L.S.; Ho, S.Y.; Ababneh, F.; Robinson, J.; Larkum, A.W. The biasing effect of compositional heterogeneity on phylogenetic estimates may be underestimated. Syst. Biol. 2004, 53, 638–643. [Google Scholar] [CrossRef]
  49. Nei, M.; Maruyama, T.; Chakraborty, R. The bottleneck effect and genetic variability in populations. Evolution 1975, 29, 1–10. [Google Scholar] [CrossRef]
  50. Korb, J.; Kasseney, B.D.; Cakpo, Y.T.; Casalla Daza, R.H.; Gbenyedji, J.N.K.; Ilboudo, M.E.; Josens, G.; Koné, N.g.A.; Meusemann, K.; Ndiaye, A.B. Termite taxonomy, challenges and prospects: West Africa, a case example. Insects 2019, 10, 32. [Google Scholar] [CrossRef] [PubMed]
  51. Montelongo, T.; Gómez-Zurita, J. Multilocus molecular systematics and evolution in time and space of Calligrapha (Coleoptera: Chrysomelidae, Chrysomelinae). Zool. Scr. 2014, 43, 605–628. [Google Scholar] [CrossRef]
  52. Quinzin, M.C.; Mardulyn, P. Multi-locus DNA sequence variation in a complex of four leaf beetle species with parapatric distributions: Mitochondrial and nuclear introgressions reveal recent hybridization. Mol. Phylogenetics Evol. 2014, 78, 14–24. [Google Scholar] [CrossRef] [PubMed]
Insects 15 00648 g001
Figure 1. Map showing sampled localities (red dots) across Dhofar region in southern Oman: (JAQM) Jabal Qamar, (JAE) Jabal Eitin, (JAQR) Jabal Qara, and (JAM) Jabal Murbat (see Table S1).
Figure 1. Map showing sampled localities (red dots) across Dhofar region in southern Oman: (JAQM) Jabal Qamar, (JAE) Jabal Eitin, (JAQR) Jabal Qara, and (JAM) Jabal Murbat (see Table S1).
Insects 15 00648 g001
Insects 15 00648 g002
Figure 2. Phylogenetic relationships of Macrotermes from Oman and related fungus-gardening termites, including GenBank sequences. Phylogeny is from Beast Bayesian analysis of COI without RY coding, including all codon positions. Posterior probabilities (first and second numbers) and bootstrap support (third number) from 1000 pseudoreplicates are shown above internodes. Collection localities of Macrotermes are indicated by colored names (see insert legend). Scale bar: 2.0 bp. Arrow represents the Omani samples.
Figure 2. Phylogenetic relationships of Macrotermes from Oman and related fungus-gardening termites, including GenBank sequences. Phylogeny is from Beast Bayesian analysis of COI without RY coding, including all codon positions. Posterior probabilities (first and second numbers) and bootstrap support (third number) from 1000 pseudoreplicates are shown above internodes. Collection localities of Macrotermes are indicated by colored names (see insert legend). Scale bar: 2.0 bp. Arrow represents the Omani samples.
Insects 15 00648 g002
Insects 15 00648 g003
Figure 3. Phylogenetic relationships of Macrotermes from Oman and related fungus-gardening termites, including GenBank sequences. Phylogeny is from Beast Bayesian analysis of COI with RY coding, including all codon positions. Posterior probabilities (first and second numbers) and bootstrap support (third number) from 1000 pseudoreplicates are shown above internodes. Scale bar: 0.004 bp.
Figure 3. Phylogenetic relationships of Macrotermes from Oman and related fungus-gardening termites, including GenBank sequences. Phylogeny is from Beast Bayesian analysis of COI with RY coding, including all codon positions. Posterior probabilities (first and second numbers) and bootstrap support (third number) from 1000 pseudoreplicates are shown above internodes. Scale bar: 0.004 bp.
Insects 15 00648 g003
Insects 15 00648 g004
Figure 4. Phylogenetic placement of the Omani Macrotermes populations and its relationship to other related fungus-gardening termite, including Genbank specimens based on Bayesian analysis of 28S D3–D5 region of Arthropods. Posterior probabilities are shown above internodes. Scale bar: 0.003 bp.
Figure 4. Phylogenetic placement of the Omani Macrotermes populations and its relationship to other related fungus-gardening termite, including Genbank specimens based on Bayesian analysis of 28S D3–D5 region of Arthropods. Posterior probabilities are shown above internodes. Scale bar: 0.003 bp.
Insects 15 00648 g004
Insects 15 00648 g005
Figure 5. Minimum Free Energy (MFE) structure for the homozygous haplotype C4, drawing encoding base-pair probabilities. (a) C4 haplotype formed similar helix length and loops to the structural elements of Arthropods. (b) Minimum Free Energy (MFE) structure for the homozygous haplotype K4, drawing encoding base-pair probabilities, black arrow point to the changes in loops structure and variability in helix length compared to 2a. (c) Minimum Free Energy (MFE) structure for the homozygous haplotype A1, drawing encoding base-pair probabilities, black arrow point to the changes in loops structure and variability in helix length compared to 2a.
Figure 5. Minimum Free Energy (MFE) structure for the homozygous haplotype C4, drawing encoding base-pair probabilities. (a) C4 haplotype formed similar helix length and loops to the structural elements of Arthropods. (b) Minimum Free Energy (MFE) structure for the homozygous haplotype K4, drawing encoding base-pair probabilities, black arrow point to the changes in loops structure and variability in helix length compared to 2a. (c) Minimum Free Energy (MFE) structure for the homozygous haplotype A1, drawing encoding base-pair probabilities, black arrow point to the changes in loops structure and variability in helix length compared to 2a.
Insects 15 00648 g005
Table 1. Main overlap in characteristics between M. falciger and M. subhyalinus [15].
Table 1. Main overlap in characteristics between M. falciger and M. subhyalinus [15].
Major Soldier Head CapsuleDistinctive FeaturesMound StructureSwarming BehaviorKnown Distribution
M. falcigerMeasurements: 142 specimens from 64 localities, range is in millimeters

Length (5.20–7.43)
Width (4.00–6.14)
Length of left mandible (2.85–4.01)
Max. length of pronotum (1.70–261)
Max. width of pronotum (3.30–5.18)		Colors:

Dark chestnut-brown		Major soldiers of M. falciger are usually darker and are characterized by huge thoracic nota, a wide head, thick antennae, and conspicuous pilosity of the gula
The minor soldiers have longer tibiae and more incurved mandibles than in M. subhyalinus

Imagos of M. falciger are usually larger than those of M. subhyalinus and have proportionately smaller eyes and longer tibiae, and the depressed area around the fontanelle also differs in shape		Low hummocks, but can vary under different circumstancesJust after darkPredominantly a woodland species, which is widely distributed in eastern and southern parts of Africa
M. subhyalinusMeasurements: 456 specimens from 163 localities, range is in millimeters

Length (4.13–6.21)
Width (3.26–4.89)
Length of left mandible (2.52–3.14)
Max. length of pronotum (1.43–1.90)
Max. width of pronotum (2.55–3.74)		Red–yellow to reddish brownErects tall and spired, but can vary under different circumstancesAround midnightWidely distributed through West, Central, and East Africa
Table 2. Base frequencies among taxa and chi-square test of homogeneity of state frequencies across taxa. Significant deviation from stationarity is in bold.
Table 2. Base frequencies among taxa and chi-square test of homogeneity of state frequencies across taxa. Significant deviation from stationarity is in bold.
MeanACGTSitesVariable SitesAmong Taxa
Chi-Squaredfp > 0.05
Macrotermitinae1st-codon position0.324150.232340.276050.16746179.004224.9096762641.00000000
2nd-codon position0.137230.278830.170320.41362178.99153.2457482641.00000000
3rd-codon position0.488860.289160.072860.14912178.99168249.2226792640.81496609
All codon positions0.316610.266820.173200.24337536.9722578.0743552641.00000000
Macrotermitinae and outgroup1st-codon position0.325370.228560.274860.17121179.004953.1975463541.00000000
2nd-codon position0.136670.277730.170710.41488178.99174.6983183541.00000000
3rd-codon position0.489250.273400.069340.16801178.99169518.4193393540.00000003
All codon positions0.317050.259880.171670.25140536.98235194.9232333541.00000000
Outgroup only1st-codon position0.328800.216230.271320.18365179.003017.396548871.00000000
2nd-codon position0.135010.274120.171880.41899179.0030.638419871.00000000
3rd-codon position0.493000.223880.057030.22609179.0015460.210541870.98730157
All codon positions0.318800.238020.166830.27634537.0018724.159910871.00000000
RY coding: Macrotermitinae and outgroup1st-codon position0.325370.228560.274860.17121178.974953.1965843541.00000000
2nd-codon position0.136670.277730.170710.41488178.98174.6983183541.00000000
3rd-codon position0.279280.220720.279820.22072178.9810438.2482583541.00000000
All codon positions0.248790.236970.239920.27432536.9417047.3665123541.00000000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

AlShamakhi, H.S.; Al-Sadi, A.M.; Cook, L.G. Evolutionary Relationships of Omani Macrotermes subhyalinus, Macrotermitinae. Insects 2024, 15, 648. https://doi.org/10.3390/insects15090648

AMA Style

AlShamakhi HS, Al-Sadi AM, Cook LG. Evolutionary Relationships of Omani Macrotermes subhyalinus, Macrotermitinae. Insects. 2024; 15(9):648. https://doi.org/10.3390/insects15090648

Chicago/Turabian Style

AlShamakhi, Hilal S., Abdullah M. Al-Sadi, and Lyn G. Cook. 2024. "Evolutionary Relationships of Omani Macrotermes subhyalinus, Macrotermitinae" Insects 15, no. 9: 648. https://doi.org/10.3390/insects15090648

APA Style

AlShamakhi, H. S., Al-Sadi, A. M., & Cook, L. G. (2024). Evolutionary Relationships of Omani Macrotermes subhyalinus, Macrotermitinae. Insects, 15(9), 648. https://doi.org/10.3390/insects15090648

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop