Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Bioassay of Insecticide Resistance
2.3. RNA Extraction, cDNA Synthesis, and Real-Time Quantitative Polymerase Chain Reaction
2.4. RNAi
2.5. Determination of ROS Contents in B. tabaci MED
2.6. Scavenging Effect of N-acetylcysteine on ROS
2.7. Statistical Analysis
3. Results
3.1. Bioassay of Imidacloprid Sensitivity of B. tabaci
3.2. The Role of AKH in the Response of B. tabaci MED to Imidacloprid
3.3. Effect of AKH on the Expression of CYP6CM1 and Its Upstream Regulatory Factors
3.4. Effect of AKH Silencing on Imidacloprid Sensitivity
3.5. ROS Response to Imidacloprid
3.6. Effects of ROS Scavengers on CYP6CM1 and Its Upstream Regulators
3.7. Effect of an ROS Scavenger on Imidacloprid Sensitivity
3.8. Effect of AKH on ROS Levels in B. tabaci MED
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
| AKH | Adipokinetic Hormone |
| CREB | cAMP-response element binding protein |
| ERK | extracellular signal-regulated kinases |
| P38 | p38 mitogen activited protein kinase |
| ROS | reactive oxygen species |
References
- Polston, J.E.; De Barro, P.; Boykin, L.M. Transmission specificities of plant viruses with the newly identified species of the Bemisia tabaci species complex. Pest Manag. Sci. 2014, 70, 1547–1552. [Google Scholar] [CrossRef] [PubMed]
- EFSA Panel on Plant Health (PLH). Scientific opinion on the risks to plant health posed by Bemisia tabaci species complex and viruses it transmits for the EU territory. EFSA J. 2013, 11, 3162. [Google Scholar]
- Yan, F.M.; Bai, R.E. Whitefly Fauna of China; Henan Science and Technology Press: Zhengzhou, China, 2017. [Google Scholar]
- Tomizawa, M.; Casida, J.E. Neonicotinoid insecticide toxicology: Mechanisms of selective action. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 247–268. [Google Scholar] [CrossRef] [PubMed]
- Jeschke, P.; Nauen, R.; Beck, M.E. Nicotinic acetylcholine receptor agonists: A milestone for modern crop protection. Angew. Chem. (Int. Ed. Engl.) 2013, 52, 9464–9485. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Xie, W.; Wang, S.L.; Wu, Q.J.; Pan, H.P.; Li, R.M.; Yang, N.N.; Liu, B.M.; Xu, B.Y.; Zhou, X.; et al. Two cytochrome P450 genes are involved in imidacloprid resistance in field populations of the whitefly, Bemisia tabaci, in China. Pestic. Biochem. Physiol. 2013, 107, 343–350. [Google Scholar] [CrossRef] [PubMed]
- Xue, H.; Fu, B.; Huang, M.; He, C.; Liang, J.; Yang, J.; Wei, X.; Liu, S.; Du, T.; Ji, Y.; et al. CYP6DW3 metabolizes imidacloprid to imidacloprid-urea in whitefly (Bemisia tabaci). J. Agric. Food Chem. 2023, 71, 2333–2343. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Hu, J.; Yang, J.; Yin, C.; Du, T.; Huang, M.; Fu, B.; Gong, P.; Liang, J.; Liu, S.; et al. Cytochrome P450 CYP6DB3 was involved in thiamethoxam and imidacloprid resistance in Bemisia tabaci Q (Hemiptera: Aleyrodidae). Pestic. Biochem. Physiol. 2023, 194, 105468. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Deng, S.; Wei, X.; Yang, J.; Zhao, Q.; Yin, C.; Du, T.; Guo, Z.; Xia, J.; Yang, Z.; et al. MAPK-directed activation of the whitefly transcription factor CREB leads to P450-mediated imidacloprid resistance. Proc. Natl. Acad. Sci. USA 2020, 117, 10246–10253. [Google Scholar] [CrossRef] [PubMed]
- Gong, P.P.; Wei, X.G.; Liu, S.N.; Yang, J.; Fu, B.L.; Liang, J.J.; Huang, M.J.; Du, T.H.; Yin, C.; Ji, Y.; et al. Novel_miR-1517 mediates CYP6CM1 to regulate imidacloprid resistance in Bemisia tabaci (Hemiptera: Aleyrodidae). Pestic. Biochem. Physiol. 2023, 194, 105469. [Google Scholar] [CrossRef]
- Van der Horst, D.J.; Van Marrewijk, W.J.; Diederen, J.H. Adipokinetic hormones of insect: Release, signal transduction, and responses. Int. Rev. Cytol. 2001, 211, 179–240. [Google Scholar]
- Van der Horst, D.J. Insect adipokinetic hormones: Release and integration of fight energy metabolism. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2003, 136, 217–226. [Google Scholar] [CrossRef] [PubMed]
- Grönke, S.; Müller, G.; Hirsch, J.; Fellert, S.; Andreou, A.; Haase, T.; Jäckle, H.; Kühnlein, R.P. Dual lipolytic control of body fat storage and mobilization in Drosophila. PLoS Biol. 2007, 5, e137. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.; Park, J.H. Hemolymph sugar homeostasis and starvation-induced hyperactivity afected by genetic manipulations of the adipokinetic hormone-encoding gene in Drosophila melanogaster. Genetics 2004, 167, 311–323. [Google Scholar] [CrossRef] [PubMed]
- Ledirac, N.; Antherieu, S.; d’Uby, A.D.; Caron, J.C.; Rahmani, R. Effects of organochlorine insecticides on MAP kinase pathways in human HaCaT keratinocytes: Key role of reactive oxygen species. Toxicol. Sci. Off. J. Soc. Toxicol. 2005, 86, 444–452. [Google Scholar] [CrossRef] [PubMed]
- Martelli, F.; Zuo, Z.; Wang, J.; Wong, C.O.; Karagas, N.E.; Roessner, U.; Rupasinghe, T.; Venkatachalam, K.; Perry, T.; Bellen, H.J.; et al. Low doses of the neonicotinoid insecticide imidacloprid induce ROS triggering neurological and metabolic impairments in Drosophila. Proc. Natl. Acad. Sci. USA 2020, 117, 25840–25850. [Google Scholar] [CrossRef] [PubMed]
- Kodrík, D.; Bednářová, A.; Zemanová, M.; Krishnan, N. Hormonal regulation of response to oxidative stress in Insects-An Update. Int. J. Mol. Sci. 2015, 16, 25788–25816. [Google Scholar] [CrossRef] [PubMed]
- Velki, M.; Kodrík, D.; Večeřa, J.; Hackenberger, B.K.; Socha, R. Oxidative stress elicited by insecticides: A role for the adipokinetic hormone. Gen. Comp. Endocrinol. 2011, 172, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.; Cheng, Y.; Li, Y.; Li, W.; Ma, Y.; Zhou, Q.; Lu, K. Adipokinetic hormone regulates cytochrome P450-mediated imidacloprid resistance in the brown planthopper, Nilaparvata lugens. Chemosphere 2020, 259, 127490. [Google Scholar] [CrossRef] [PubMed]
- Sparks, T.C.; Riley, D.G.; Simmons, A.M.; Guo, L. Comparison of toxicological bioassays for whiteflies. Insects 2020, 11, 789. [Google Scholar] [CrossRef]
- Li, J.; Li, X.; Bai, R.; Shi, Y.; Tang, Q.; An, S.; Song, Q.; Yan, F. RNA interference of the P450 CYP6CM1 gene has different efficacy in B and Q biotypes of Bemisia tabaci. Pest Manag. Sci. 2015, 71, 1175–1181. [Google Scholar] [CrossRef]
- Liang, P.; Ning, J.; Wang, W.; Zhu, P.; Gui, L.; Xie, W.; Zhang, Y. Catalase promotes whitefly adaptation to high temperature by eliminating reactive oxygen species. Insect Sci. 2023, 30, 1293–1308. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.H.; Li, J.J.; Bai, R.E.; Yan, F.M. EPG-recorded feeding behaviors reveal adaptability and competitiveness in two species of Bemisia tabaci (Hemiptera: Aleyrodidae). J. Insect Behav. 2021, 34, 26–40. [Google Scholar] [CrossRef]
- He, H.F.; Zhao, C.C.; Zhu, C.Q.; Yan, W.L.; Yan, M.H.; Zhang, Z.L.; Liu, J.L.; Shi, B.Z.; Bai, R.E.; Li, J.J.; et al. Discovery of novel whitefly vector proteins that interact with a virus capsid component mediating virion retention and transmission. Int. J. Biol. Macromol. 2022, 226, 1154–1165. [Google Scholar] [CrossRef] [PubMed]
- Backus, E.A.; Bennett, W.H. The AC–DC Correlation Monitor: New EPG design with flexible input resistors to detect both R and emf components for any piercing–sucking hemipteran. J. Insect Physiol. 2009, 55, 869–884. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.S.; Zhang, Z.; Zhang, D.Y.; Zhang, Z.H.; Liu, Y.; Shi, X.B.; Zhang, Y.J. Transmission characteristics of Tomato chlorosis virus on Capsicum annuum by adult Bemisia tabaci MEAM1 and MED (Hemiptera: Aleryodidae). Acta Entomol. Sin. 2022, 65, 1452–1458. [Google Scholar]
- Lu, K.; Cheng, Y.; Li, W.; Ni, H.; Chen, X.; Li, Y.; Tang, B.; Li, Y.; Chen, D.; Zeng, R.; et al. Copper-induced H2O2 accumulation confers larval tolerance to xanthotoxin by modulating CYP6B50 expression in Spodoptera litura. Pestic. Biochem. Physiol. 2019, 159, 118–126. [Google Scholar] [CrossRef]
- Gilbertson, R.L.; Batuman, O.; Webster, C.G.; Adkins, S. Role of the Insect Supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global spread of plant viruses. Annu. Rev. Virol. 2015, 2, 67–93. [Google Scholar] [CrossRef] [PubMed]
- Mansoor, S.; Zafar, Y.; Briddon, R.W. Geminivirus disease complexes: The threat is spreading. Trends Plant Sci. 2006, 11, 209–212. [Google Scholar] [CrossRef]
- Karunker, I.; Benting, J.; Lueke, B.; Ponge, T.; Nauen, R.; Roditakis, E.; Vontas, J.; Gorman, K.; Denholm, I.; Morin, S. Over-expression of cytochrome P450 CYP6CM1 is associated with high resistance to imidacloprid in the B and Q biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Biochem. Mol. Biol. 2008, 38, 634–644. [Google Scholar] [CrossRef]
- Yan, M.; He, H.; Zhang, Z.; Zhang, B.; Zhu, C.; Yan, W.; Zhao, C.; Li, J.; Yan, F. Molecular basis of mutual benefits between Cucurbit chlorotic yellows virus (CCYV) transmission and imidacloprid resistance in Bemisia tabaci. J. Pest Sci. 2022, 96, 489–497. [Google Scholar] [CrossRef]
- Caers, J.; Verlinden, H.; Zels, S.; Vandersmissen, H.P.; Vuerinckx, K.; Schoofs, L. More than two decades of research on insect neuropeptide GPCRs: An overview. Front. Endocrinol. 2012, 3, 151. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.; Zhang, X.; Chen, X.; Li, Y.; Li, W.; Cheng, Y.; Zhou, J.; You, K.; Zhou, Q. Adipokinetic hormone receptor mediates lipid mobilization to regulate starvation resistance in the Brown Planthopper, Nilaparvata lugens. Front. Physiol. 2018, 9, 1730. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.; Cheng, Y.; Li, Y.; Li, W.; Ma, Y.; Zhou, Q.; Lu, K. Adipokinetic hormone enhances CarE-mediated chlorpyrifos resistance in the brown planthopper, Nilaparvata Lugens. Insect Mol. Biol. 2020, 29, 511–522. [Google Scholar] [CrossRef]
- Diederen, J.H.; Oudejans, R.C.; Harthoorn, L.F.; Van der Horst, D.J. Cell biology of the adipokinetic hormone-producing neurosecretory cells in the locust corpus cardiacum. Microsc. Res. Tech. 2002, 56, 227–236. [Google Scholar] [CrossRef] [PubMed]








| Primer Name | Length (bp) | Sequence (5′→3′) |
|---|---|---|
| CYP6CM1-RT-F | 24 | CACTCTTTTGGATTTACTGCACCC |
| CYP6CM1-RT-R | 22 | GTGAAGCTGCCTCTTTAATGGC |
| CREB-F | 22 | ACTCAAGGCAGTCTCCAAACCC |
| CREB-R | 22 | TTTCTGCTCCGCCTAAATCGTT |
| P38-F | 21 | GAACGCCGTCGGAGGATACTT |
| P38-R | 21 | TTGGCTCCTTTGAACACTTGC |
| ERK-F | 23 | AGATTATTTCCTTCAGCCGATGC |
| ERK-R | 22 | GGGCAAGGGCATCTTCAACTAC |
| Actin-F | 20 | TCTTCCAGCCATCCTTCTTG |
| Actin-R | 20 | CGGTGATTTCCTTCTGCATT |
| dsAKH-F | 47 | GATCACTAATACGACTCACTATAGGGCTTGTCGCACAATTCTGGTGT |
| dsAKH-R | 50 | GATCACTAATACGACTCACTATAGGGAACTTCTGAACTTCTCACAATCTG |
| AKH-RT-F | 21 | CTTGTCGCACAATTCTGGTGT |
| AKH-RT-R | 20 | TTGCGCCTCATTCTCGATCA |
| dsCYP6CM1-F | 46 | GATCACTAATACGACTCACTATAGGGACTTTTTCAGGGAGGCCATT |
| dsCYP6CM1-R | 46 | GATCACTAATACGACTCACTATAGGGGTCGCAGCGTCTCATCAATA |
| Bemisia tabaci | Toxic Regression Equation | Correlation Coefficient | LC50 (mg/L) | Resistance Ratio |
|---|---|---|---|---|
| Resistibility | Y = −4.093 + 1.5X | 0.961 | 535.932 | 10.34 |
| Sensibility | Y = −2.699 + 1.574X | 0.987 | 51.820 | ------ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Zhu, C.; Xu, Y.; He, H.; Zhao, C.; Yan, F. Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly. Insects 2024, 15, 436. https://doi.org/10.3390/insects15060436
Li J, Zhu C, Xu Y, He H, Zhao C, Yan F. Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly. Insects. 2024; 15(6):436. https://doi.org/10.3390/insects15060436
Chicago/Turabian StyleLi, Jingjing, Chaoqiang Zhu, Yunhao Xu, Haifang He, Chenchen Zhao, and Fengming Yan. 2024. "Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly" Insects 15, no. 6: 436. https://doi.org/10.3390/insects15060436
APA StyleLi, J., Zhu, C., Xu, Y., He, H., Zhao, C., & Yan, F. (2024). Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly. Insects, 15(6), 436. https://doi.org/10.3390/insects15060436

