Linking Histone Methylation States and hsp Transcriptional Regulation in Thermo-Tolerant and Thermo-Susceptible A. mellifera L. Subspecies in Response to Heat Stress
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Honeybee Sample Preparation
2.2. Cross-Linking, Quenching, and Chromatin Isolation
2.3. Chromatin Immunoprecipitation (ChIP)
2.4. Quantitative Polymerase Chain Reaction (qPCR)
2.5. Heat Shock Protein Primer Design
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Severson, D.W.; Erickson, E.H.; Williamson, J.L.; Aiken, J.M. Heat stress induced enhancement of heat shock protein gene activity in the honey bee (Apis mellifera). Experientia 1990, 46, 737–739. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Jones, W.A. Expression of heat shock protein genes in insect stress responses. Invert. Survival. J. 2012, 9, 93–101. [Google Scholar]
- Perez, R.; Aron, S. Adaptations to thermal stress in social insects: Recent advances and future directions. Biol. Rev. 2020, 95, 1535–1553. [Google Scholar] [CrossRef] [PubMed]
- Jing, X.Y.; Li, F.M. Identifying Heat Shock Protein Families from Imbalanced Data by Using Combined Features. Comput. Math. Methods Med. 2020, 2020, 1–11. [Google Scholar] [CrossRef]
- Huang, C.; Xu, M.; Zhu, B. Epigenetic inheritance mediated by histone lysine methylation: Maintaining transcriptional states without the precise restoration of marks? Philos. Trans. R. Soc. Lond. B. Biol. Sci. 2013, 368, 20110332. [Google Scholar] [CrossRef] [Green Version]
- Caparros, M.L.; Allis, C.D.; Jenuwein, T.; Reinberg, D. Epigenetics, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, USA, 2015; p. 984. ISBN 139781936113590. [Google Scholar]
- Binda, O. On your histone mark, SET, methylate! Epigenetica 2013, 8, 457–463. [Google Scholar] [CrossRef] [Green Version]
- Dickman, M.J.; Kucharski, R.; Maleszka, R.; Hurd, P.J. Extensive histone post-translational modification in honey bees. Insect Biochem. Mol. Biol. 2013, 43, 125–137. [Google Scholar] [CrossRef]
- Allis, C.D.; Jenuwein, T. The molecular hallmarks of epigenetic control. Nat. Rev. Genet. 2016, 17, 487–500. [Google Scholar] [CrossRef]
- Wojciechowski, M.; Lowe, R.; Maleszka, J.; Conn, D.; Maleszka, R.; Hurd, P.J. Phenotypically distinct female castes in honey bees are defined by alternativechromatin states during larval development. Genome Res. 2018, 28, 1532–1542. [Google Scholar] [CrossRef] [Green Version]
- Southwick, E.E. The honey bee cluster as a homeothermic superorganism. Comp. Biochem. Physiol. Part A Physiol. 1983, 75, 641–645. [Google Scholar] [CrossRef]
- Ruttner, F. Biogeography and Taxonomy of Honeybees, 1st ed.; Springer: Berlin, Germany, 1988; p. 284. ISBN 978-3-64272651-4. [Google Scholar] [CrossRef]
- Kronenberg, F.; Heller, H.C. Colonial thermoregulation in honey bees (Apis mellifera). J. Comp. Physiol. 1982, 148, 65–76. [Google Scholar] [CrossRef]
- Bloch, G.; Grozinger, C.M. Social molecular pathways and the evolution of bee societies. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2011, 366, 2155–2170. [Google Scholar] [CrossRef] [Green Version]
- Winston, M.L. The Biology of the Honeybee, 1st ed.; Harvard University Press: Cambridge, MA, USA, 1991; p. 294. ISBN 9780674074095. [Google Scholar]
- Elekonich, M.M. Extreme thermotolerance and behavioral induction of 70-kDa heat shock proteins and their encoding genes in honey bees. Cell Stress Chaperones 2009, 14, 219–226. [Google Scholar] [CrossRef] [Green Version]
- Bordier, C.; Dechatre, H.; Suchail, S.; Peruzzi, M.; Soubeyrand, S.; Pioz, M.; Pélissier, M.; Crauser, D.; Conte, Y.L.; Alaux, C. Le Colony adaptive response to simulated heat waves and consequences at the individual level in honeybees (Apis mellifera). Sci. Rep. 2017, 7, 3760. [Google Scholar] [CrossRef] [Green Version]
- Alattal, Y.; Alghamdi, A. Impact of temperature extremes on survival of indigenous and exotic honey bee subspecies, Apis mellifera, under desert and semiarid climates. Bull. Insectology 2015, 68, 219–222. [Google Scholar]
- Ilyasov, R.A.; Lee, M.; Takahashi, J.; Kwon, H.W.; Nikolenko, A.G. A revision of subspecies structure of western honeybee Apis mellifera. Saudi J. Biol. Sci. 2020, 27, 3615–3621. [Google Scholar] [CrossRef]
- Stabentheiner, A.; Kovac, H.; Mandl, M.; Kaefar, H. Coping with the cold and fighting the heat: Thermal homeostasis of a superorganism, the honeybee colony. J. Comp. Physiol. A 2021, 207, 337–351. [Google Scholar] [CrossRef]
- Zhao, H.; Li, G.; Guo, D.; Li, H.; Liu, Q.; Xu, B.; Guo, X. Response mechanisms to heat stress in bees. Apidologie 2011, 52, 388–399. [Google Scholar] [CrossRef]
- Alqarni, A.S.; Hannan, M.A.; Owayss, A.A.; Engel, M.S. The indigenous honey bees of Saudi Arabia (Hymenoptera, Apidae, Apis mellifera jemenitica Ruttner): Their natural history and role in beekeeping. ZooKeys 2011, 134, 83–98. [Google Scholar] [CrossRef] [Green Version]
- Alattal, Y.; Alghamdi, A. Evidence for sub-populations of Apis mellifera jemenitica colonies along the Red Sea coast of Saudi Arabia. Bull. Insectology 2022, 71, 7–14. [Google Scholar]
- Alghamdi, A.; Alsharhi, M.; Alattal, Y.; Adgaba, N. Morphometric diversity of indigenous honeybees, Apis mellifera (Linnaeus, 1758), in Saudi Arabia. Zool. Middle East 2012, 58, 97–103. [Google Scholar] [CrossRef]
- Milne, T.A.; Zhao, K.; Hess, J.L. Chromatin immunoprecipitation (ChIP) for analysis of histone modifications and chromatin-associated proteins. Methods Mol. Biol. 2009, 538, 409–423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia, V.M.; Nillegoda, N.B.; Bukau, B.; Morano, K.A. Substrate binding by the yeast Hsp110 nucleotide exchange factor and molecular chaperone Sse1 is not obligate for its biological activities. Mol. Biol. Cell. 2017, 28, 2066–2075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, H.J.; Chen, X.; Subjeck, J.R. Hsp110 protects heat denatured proteins and confers cellular thermoresistance. J. Biol. Chem. 1997, 272, 31636–31640. [Google Scholar] [CrossRef] [Green Version]
- Oh, H.J.; Easton, D.; Murawski, M.; Kaneko, Y.; Subjeck, J.R. The chaperoning activity of Hsp110: Identification of functional domains by use of targeted deletions. J. Biol. Chem. 1999, 274, 15712–15718. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.; Sarbeng, E.B.; Vorvis, C.; Kumar, D.P.; Zhou, L.; Liu, Q. Unique peptide substrate binding properties of 110-kDa heatshock protein (Hsp110) determine its distinct chaperone activity. J. Biol. Chem. 2012, 287, 5661–5672. [Google Scholar] [CrossRef] [Green Version]
- Alqarni, A.S.; Ali, H.; Iqbal, J.; Owayss, A.A.; Smith, B.H. Expression of heat shock proteins in adult honey bee (Apis mellifera L.) workers under hot-arid subtropical ecosystems. Saudi J. Biol. Sci. 2019, 26, 1372–1376. [Google Scholar] [CrossRef]
- Pereboom, J.J.; Biesmeijer, J.C. Thermal constraints for stingless bee foragers: The importance of body size and coloration. Oecologia 2003, 137, 42–50. [Google Scholar] [CrossRef]
- Alattal, Y.; Alghamdi, A.; Alsharhi, M.; Fuchs, S. Morphometric characterisation of the native Honeybee, Apis mellifera Linnaeus, 1758, of Saudi Arabia. Zool. Middle East 2014, 60, 226–235. [Google Scholar] [CrossRef]
- Velazquez, J.M.; Sonoda, S.; Bugaisky, G.; Lindquist, S. Is the major Drosophila heat shock protein present in cells that have not been heat shocked? J. Cell. Biol. 1983, 96, 286–290. [Google Scholar] [CrossRef] [Green Version]
- Gardiner, N.M.; Munday, P.L.; Nilsson, G.E. Counter-gradient variation in respiratory performance of coral reef fishes at elevated temperatures. PLoS ONE 2010, 5, e13299. [Google Scholar] [CrossRef] [Green Version]
- Yampolsky, L.Y.; Schaer, T.M.M.; Ebert, D. Adaptivephenotypic plasticity and local adaptation for temperaturetolerance in freshwater zooplankton. Proc. Biol. Sci. 2014, 281, 20132744. [Google Scholar] [CrossRef] [Green Version]
- Angilletta, M.J.; Wilson, R.S.; Navas, C.A.; James, R.S. Tradeoffs and the evolution of thermal reaction norms. Trends Ecol. Evol. 2003, 18, 234–240. [Google Scholar] [CrossRef]
- Chen, C.H.; Hill, J.K.; Ohlemüller, R.; Roy, D.B.; Thomas, C.H.H. Rapid Range Shifts of Species Associated with High Levels of Climate Warming. Science 2011, 333, 1024–1026. [Google Scholar] [CrossRef]
Locus/Gene Identifier | Gene/DNA Region | Primers |
---|---|---|
LOC724487 | 28 KDa heat- and acid-stable phosphoprotein-like | F- GAGGAACCCAAAGCACATGGT R- TCTACACCCTTTGTTTTTCCCTGT |
LOC552531 | 10 KDa heat shock protein, mitochondrial-like | F- AGCAATTGGACCTGGACAAAGA R- GCCAGTATATCTGACTCACGGAAT |
LOC409384 | 60 KDa heat shock protein, mitochondrial-like | F- CCACGCCTGCATTTTGAGCA R- GCAACCAGAGCAGCCGTTGA |
LOC410620 | Heat shock protein 70Ab | F- TGGCATTCCACCTGCACCTA R- TGGTGATCTTGTTCTCCTTTCCAGT |
LOC408706 | Heat shock cognate 70Cb ortholog | F- CGCGCGTCTACACGTTCTTT R- CGTGATTTTGATGCCGCAGT |
LOC411700 | Heat shock protein 83-like | F- TCCACATCTTCTGCTTTTGTTTCC R- TCAACGCGCGTCTTCATTCA |
LOC408928 | Heat shock protein 90 | F- TGGATCCGTGAGAGATTCATAGCG R- CGCTTTCCAAGCTGAAATTGCACA |
XM_006559101.1 | Apis mellifera histone-lysine N-methyltrans-ferase trithorax (trx), transcript variant X4, | F-TGCAGCTAGATTCATTAATCATTCATG R-CATGGAATCTTGATATCCTCGAAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alattal, Y.Z.; Alghamdi, A.A. Linking Histone Methylation States and hsp Transcriptional Regulation in Thermo-Tolerant and Thermo-Susceptible A. mellifera L. Subspecies in Response to Heat Stress. Insects 2023, 14, 225. https://doi.org/10.3390/insects14030225
Alattal YZ, Alghamdi AA. Linking Histone Methylation States and hsp Transcriptional Regulation in Thermo-Tolerant and Thermo-Susceptible A. mellifera L. Subspecies in Response to Heat Stress. Insects. 2023; 14(3):225. https://doi.org/10.3390/insects14030225
Chicago/Turabian StyleAlattal, Yehya Z., and Ahmad A. Alghamdi. 2023. "Linking Histone Methylation States and hsp Transcriptional Regulation in Thermo-Tolerant and Thermo-Susceptible A. mellifera L. Subspecies in Response to Heat Stress" Insects 14, no. 3: 225. https://doi.org/10.3390/insects14030225