Identifying the Gut Virome of Diaphorina citri from Florida Groves
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Asian Citrus Psyllid Collection, Gut Dissection and Total RNA Preparation
2.2. RNA-Sequencing, Assembly, and Sequence Analyses
2.3. Verification of Viral Sequences in D. citri
2.4. Psyllid Gut Staining with DAPI
3. Results
3.1. Identification of D. citri-Associated Viruses in the Gut Tissue by HTS and Validation by RT-PCR
3.2. Nuclear Damage of Psyllid Adult Guts under D. citri-Associated Virus Infection
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jagoueix, S.; Bove, J.M.; Garnier, M. The phloem-limited bacterium of greening disease of citrus is a member of the alpha subdivision of the proteobcteria. Int. J. Syst. Bacteriol. 1994, 44, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Dala-Paula, B.M.; Plotto, A.; Bai, J.; Manthey, J.A.; Baldwin, E.A.; Ferrarezi, R.S.; Gloria, M.B.A. Effect of huanglongbing or greening disease on orange juice quality: A review. Front. Plant Sci. 2019, 9, 1976. [Google Scholar] [CrossRef] [PubMed]
- McCollum, G.; Hilf, M.; Irey, M.; Luo, W.; Gottwald, T. Susceptibility of sixteen citrus genotypes to ‘Candidatus Liberibacter asiaticus’. Plant Dis. 2016, 100, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
- Gottwald, T.R. Current epidemiological understanding of citrus huanglongbing. Ann. Rev. Phytopathol. 2010, 48, 119–139. [Google Scholar] [CrossRef] [PubMed]
- Hall, D.G.; Richardson, M.L.; Ammar, E.D.; Halbert, S.E. Asian citrus psyllid, Diaphorina citri, vector of citrus huanglongbing disease. Entomol. Exp. Appl. 2013, 146, 207–223. [Google Scholar] [CrossRef]
- Kunta, M.; Sétamou, M.; Skaria, M.; Rascoe, J.E.; Li, W.; Nakhla, M.K.; da Graça, J.V. First report of citrus huanglongbing in Texas. Phytopathology 2012, 102, S4–S66. [Google Scholar]
- Kumagai, L.B.; LeVesque, C.S.; Blomquist, C.L.; Madishetty, K.; Guo, Y.; Woods, P.W.; Rooney-Latham, S.; Rascoe, J.; Gallindo, T.; Schnabel, D.; et al. First report of Candidatus Liberibacter asiaticus associated with citrus huanglongbing in California. Plant Dis. 2013, 97, 283. [Google Scholar] [CrossRef]
- Oliver, J.E.; Ali, M.E.; Waliullah, S.; Price, J.; Warren, J.; Jacobs, J.; Hoppers, A.; Evans, R.; Dowdy, M.; Curry, S. Huanglongbing, caused by ‘Candidatus Liberibacter asiaticus’, Detected in new locations across Southern and Coastal Georgia. Plant Health Prog. 2020, 21, 31–35. [Google Scholar] [CrossRef]
- Blaustein, R.A.; Lorca, G.L.; Teplitski, M. Challenges for managing Candidatus Liberibacter spp. (Huanglongbing disease pathogen): Current control measures and future directions. Phytopathology 2018, 108, 424–435. [Google Scholar] [CrossRef]
- Munir, S.; He, P.; Wu, Y.; He, P.; Khan, S.; Huang, M.; Cui, W.; He, P.; He, Y. Huanglongbing control: Perhaps the end of the beginning. Microb. Ecol. 2018, 76, 192–204. [Google Scholar] [CrossRef]
- Chen, X.D.; Stelinski, L.L. Rapid detection of insecticide resistance in Diaphorina citri (Hemiptera: Liviidae) populations, using a bottle bioassay. Fla. Entomol. 2017, 100, 124–133. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.D.; Gill, T.A.; Pelz-Stelinski, K.S.; Stelinski, L.L. Risk assessment of various insecticides used for management of Asian citrus psyllid, Diaphorina citri in Florida citrus, against honeybee, Apis mellifera. Ecotoxicology 2017, 26, 351–359. [Google Scholar] [CrossRef] [PubMed]
- Kanga, L.H.; Eason, J.; Haseeb, M.; Qureshi, J.; Stansly, P. Monitoring for insecticide resistance in Asian citrus psyllid (Hemiptera: Psyllidae) populations in Florida. J. Econ. Entomol. 2016, 109, 832–836. [Google Scholar] [CrossRef] [PubMed]
- Tiwari, S.; Mann, R.S.; Rogers, M.E.; Stelinski, L.L. Insecticide resistance in field populations of Asian citrus psyllid in Florida. Pest Manag. Sci. 2011, 67, 1258–1268. [Google Scholar] [CrossRef] [PubMed]
- Britt, K.; Gebben, S.; Levy, A.; Rwahnih, M.A.; Batuman, O. The detection and surveillance of Asian citrus psyllid (Diaphorina citri)-associated viruses in Florida citrus grove. Front. Plant Sci. 2020, 10, 1687. [Google Scholar] [CrossRef]
- Francis, F.; Jacquemyn, H.; Delvigne, F.; Lievens, B. From diverse origins to specific targets: Role of microorganisms in indirect pest biological control. Insects 2020, 11, 533. [Google Scholar] [CrossRef]
- Niang, E.H.A.; Bassene, H.; Fenollar, F.; Mediannikov, O. Biological control of mosquito-borne diseases: The potential of Wolbachia-based interventions in an IVM framework. J. Trop. Med. 2018, 2018. [Google Scholar] [CrossRef]
- Tanzini, M.; Alves, S.; Setten, A.; Augusto, N. Compatibilidad de agent estensoactivos com Beauveria bassiana y Metarhizium anisopliae. Manejo Integr. Plagas 2001, 59, 15–18. [Google Scholar]
- Ignoffo, C.M. Development of a viral insecticide: Concept to commercialization. Exp. Parasitol. 1973, 33, 380–406. [Google Scholar] [CrossRef]
- Lacey, L.A.; Grzywacz, D.; Shapiro-Ilan, D.I.; Frutos, R.; Brownbridge, M.; Goettel, M.S. Insect pathogens as biological control agents: Back to the future. J. Invertebr. Pathol. 2015, 132, 1–41. [Google Scholar] [CrossRef]
- Sosa-Gómez, D.R.; Morgado, F.S.; Corrê, R.F.T.; Silva, L.A.; Ardisson-Araújo, D.M.P.; Rodrigues, B.M.P.; Oliveira, E.E.; Aguiar, R.W.S.; Ribeiro, B.M. Entomopathogenic viruses in the Neotropics: Current status and recently discovered species. Neotrop. Entomol. 2020, 49, 315–331. [Google Scholar] [PubMed]
- Naik, N.G.; Lo, Y.W.; Wu, T.Y.; Lin, C.C.; Kuo, S.C.; Chao, Y.C. Baculovirus as an efficient vector for gene delivery into mosquitoes. Sci. Rep. 2018, 8, 17778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsai, C.H.; Wei, S.C.; Lo, H.R.; Chao, Y.C. Baculovirus as versatile vectors for protein display and biotechnological applications. Curr. Issues Mol. Biol. 2020, 34, 231–255. [Google Scholar]
- Arbuthnott, D.; Levin, T.C.; Promislow, D.E. The impacts of Wolbachia and the microbiome on mate choice in Drosophila melanogaster. J. Evol. Biol. 2016, 29, 461–468. [Google Scholar] [CrossRef]
- Ben-Yosef, M.; Pasternak, Z.; Jurkevitch, E.; Yuval, B. Symbiotic bacteria enable olive flies (Bactrocera oleae) to exploit intractable sources of nitrogen. J. Evol. Biol. 2014, 27, 2695–2705. [Google Scholar]
- Engel, P.; Moran, N.A. The gut microbiota of insects–diversity in structure and function. FEMS Microbiol. Rev. 2013, 37, 699–735. [Google Scholar] [CrossRef] [PubMed]
- Engl, T.; Kaltenpoth, M. Influence of microbial symbionts on insect pheromones. Nat. Prod. Rep. 2018, 35, 386–397. [Google Scholar] [PubMed]
- Gupta, A.; Nair, S. Dynamics of insect–microbiome interaction influence host and microbial symbiont. Front. Microbiol. 2020, 11. [Google Scholar] [CrossRef]
- Bonning, B.C. The insect virome: Opportunities and challenges. Curr. Issues Mol. Biol. 2019, 34, 1–12. [Google Scholar]
- Huang, H.J.; Ye, Z.X.; Wang, X.; Yan, X.T.; Zhang, Y.; He, Y.J.; Qi, Y.H.; Zhang, X.D.; Zhuo, J.C.; Lu, G.; et al. Diversity and infectivity of the RNA virome among different cryptic species of an agriculturally important insect vector: Whitefly Bemisia tabaci. Npj Biofilms Microbiomes 2021, 7. [Google Scholar] [CrossRef]
- Muñoz-Benavent, M.; Pérez-Cobas, A.E.; García-Ferris, C.; Moya, A.; Latorre, A. Insects’ potential: Understanding the functional role of their gut microbiome. J. Pharm. Biomed. 2021, 194, 113787. [Google Scholar]
- Ng, T.F.F.; Willner, D.L.; Lim, Y.W.; Schmieder, R.; Chau, B.; Nilsson, C.; Anthony, S.; Ruan, Y.; Rohwer, F.; Breitbart, M. Broad surveys of DNA viral diversity obtained through viral metagenomics of mosquitoes. PLoS ONE 2011, 6, e20579. [Google Scholar]
- Kuo, Y.W.; Matsumura, E.E.; Nigg, J.C.; Chen, Q.; Henry, E.; Nouri, S.; Godfrey, K.E.; Falk, B.W. ACP are full of viruses. Can we use them against HLB? Citrograph 2020, 11, 52–56. [Google Scholar]
- Marutani-Hert, M.; Hunter, W.B.; Katsar, C.S.; Sinisterra, X.H.; Hall, D.G.; Powell, C.A. Reovirus-like sequences isolated from adult Asian citrus psyllid, (Hemiptera: Psyllidae: Diaphorina citri). Fla. Entomol. 2009, 92, 314–320. [Google Scholar] [CrossRef]
- Nouri, S.; Salem, N.; Falk, B.W. Complete genome sequence of Diaphorina citri-associated C virus, a novel putative RNA virus of the Asian citrus psyllid, Diaphorina citri. Genome Announc. 2016, 4, e00639-16. [Google Scholar]
- Nouri, S.; Salem, N.; Nigg, J.C.; Falk, B.W. Diversity array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 2016, 90, 2434–2445. [Google Scholar]
- Nouri, S.; Matsumura, E.E.; Kuo, Y.W.; Falk, B.W. Insect-specific viruses: From discovery to potential translational applications. Curr. Opin. Virol. 2018, 33, 33–41. [Google Scholar]
- Britt, K.; Stevens, K.; Gebben, S.; Levy, A.; Al Rwahnih, M.; Batuman, O. Partial genome sequence of a novel Reo-like virus detected in Asian citrus psyllid (Diaphorina citri) populations from Florida citrus groves. Microbiol. Resour. Announc. 2021, 10, e00563-21. [Google Scholar]
- Britt, K.; Gebben, S.; Levy, A.; Achor, D.; Sieburth, P.; Stevens, K.; Al Rwahnih, M.; Batuman, O. Analysis of Citrus tristeza virus incidences within Asian citrus psyllid (Diaphorina citri) populations in Florida via high-throughput sequencing. Insects 2022, 13, 275. [Google Scholar]
- Wu, F.; Huang, M.; Fox, E.G.P.; Huang, J.; Cen, Y.; Deng, X.; Xu, M. Preliminary report on the acquisition, persistence, and potential transmission of Citrus tristeza virus by Diaphorina citri. Insect 2021, 12, 735. [Google Scholar] [CrossRef]
- Ammar, E.D.; Shatters Jr, R.G.; Hall, D.G. Localization of Candidatus Liberibacter asiaticus, associated with citrus huanglongbing disease, in its psyllid vector using fluorescence in situ hybridization. J. Phytopathol. 2011, 159, 726–734. [Google Scholar] [CrossRef]
- Ghanim, M.; Fattah-Hosseini, S.; Levy, A.; Cilia, M. Morphological abnormalities and cell death in the Asian citrus psyllid (Diaphorina citri) midgut associated with Candidatus Liberibacter asiaticus. Sci. Rep. 2016, 6. [Google Scholar] [CrossRef] [PubMed]
- Ghanim, M.; Achor, D.; Ghosh, S.; Kontsedalov, S.; Lebedev, G.; Levy, A. ‘Candidatus Liberibacter asiaticus’ accumulates inside endoplasmic reticulum associated vacuoles in the gut cells of Diaphorina citri. Sci. Rep. 2017, 7, 16945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, C.Y.; Achor, D.; Levy, A. Intracellular life cycle of ‘Candidatus Liberibacter asiaticus’ inside psyllid gut cells. Phytopathology 2022, 112, 145–153. [Google Scholar] [CrossRef]
- Rashidi, M.; Lin, C.Y.; Britt, K.; Batuman, O.; Al Rwahnih, M.; Achor, D.; Levy, A. Diaphorina citri flavi-like virus localization, transmission, and association with Candidatus Liberibacter asiaticus in its psyllid host. Virology 2022, 567, 47–56. [Google Scholar] [PubMed]
- Al Rwahnih, M.; Rowhani, A.; Westrick, N.; Stevens, K.; Diaz-Lara, A.; Trouillas, F.P.; Preece, J.; Kallsen, C.; Farrar, K.; Golino, D. Discovery of viruses and virus-like pathogens in pistachio using high-throughput sequencing. Plant Dis. 2018, 102, 1419–1425. [Google Scholar]
- Hong, C.; Manimaran, S.; Shen, Y.; Perez-Rogers, J.F.; Byrd, A.L.; Castro-Nallar, E.; Crandall, K.A.; Johnson, W.E. PathoScope 2.0: A complete computational framework for strain identification in environmental or clinical sequencing samples. Microbiome 2014, 2, 33. [Google Scholar]
- Tatusova, T.A.; Madden, T.L. BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 1999, 174, 247–250. [Google Scholar]
- Harper, S.J.; Cowell, S.J. The past and present status of Citrus tristeza virus in Florida. J. Citrus Pathol. 2016, 3. [Google Scholar] [CrossRef]
- van Lenteren, J.C.; Bolckmans, K.; Köhl, J.; Ravensberg, W.J.; Urbaneja, A. Biological control using invertebrates and microorganisms: Plenty of new opportunities. BioControl 2018, 63, 39–59. [Google Scholar]
- Hajek, A.E.; Gardescu, S.; Delalibera Jr., I. Summary of classical biological control introductions of entomopathogens and nematodes for insect control. BioControl 2021, 66, 167–180. [Google Scholar] [CrossRef]
- Deka, B.; Baruah, C.; Babu, A. Entomopathogenic microorganisms: Their role in insect pest management. Egypt. J. Biol. Pest Control. 2021, 31, 121. [Google Scholar] [CrossRef]
- Carvalho, V.L.; Long, M.T. Perspectives on new vaccines against Arboviruses using insect-specific viruses as platforms. Vaccines 2021, 9, 263. [Google Scholar] [CrossRef] [PubMed]
- Patterson, E.I.; Villinger, J.; Muthoni, J.N.; Dobel-Ober, L.; Hughes, G.L. Exploiting insect-specific viruses as a novel strategy to control vector-borne disease. Curr. Opin. Insect Sci. 2020, 39, 50–56. [Google Scholar] [CrossRef]
- Roundy, C.M.; Azar, S.R.; Rossi, S.L.; Weaver, S.C.; Vasilakis, N. Insect-specific viruses: A historical overview and recent developments. Adv. Virus Res. 2017, 98, 119–146. [Google Scholar]
- Sarkar, P.; Ghanim, M. Unravelling the pathogenesis and molecular interactions of Liberibacter phytopathogens with their psyllid vectors. Agronomy 2020, 10, 1132. [Google Scholar] [CrossRef]
- Hobson-Peters, J.; Harrison, J.J.; Watterson, D.; Hazlewood, J.E.; Vet, L.J.; Newton, N.D.; Warrilow, D.; Colmant, A.M.; Taylor, C.; Huang, B.; et al. A recombinant platform for flavivirus vaccines and diagnostics using chimeras of a new insect-specific virus. Sci. Transl. Med. 2019, 11, eaax7888. [Google Scholar] [CrossRef]
- Szewczyk, B.; Hoyos-Carvajal, L.; Paluszek, M.; Skrzecz, I.; De Souza, M.L. Baculoviruses-re-emerging biopesticides. Biotechnol. Adv. 2006, 24, 143–160. [Google Scholar] [CrossRef] [Green Version]
- Gray, S.M.; Cilia, M.; Ghanim, M. Circulative, “nonpropagative” virus transmission: An orchestra of virus, insect and plant derived instruments. Adv. Virus Res. 2014, 89, 141–199. [Google Scholar]
- Liu, S.; Sivakumar, S.; Sparks, W.O.; Miller, W.A.; Bonning, B.C. A peptide that binds the pea aphid gut impedes entry of Pea enation mosaic virus into the aphid hemocoel. Virology 2010, 401, 107–116. [Google Scholar] [CrossRef]
- Vasilakis, N.; Tesh, R.B. Insect-specific viruses and their potential impact on arbovirus transmission. Curr. Opin. Virol. 2015, 15, 69–74. [Google Scholar] [CrossRef] [PubMed]
- Airs, P.M.; Bartholomay, L.C. RNA interference for mosquito and mosquito-borne disease control. Insect 2017, 8, 4. [Google Scholar] [CrossRef] [PubMed]
- Adelman, Z.N.; Blair, C.D.; Carlson, J.O.; Beaty, B.J.; Olson, K.E. Sindbis virus-induced silencing of dengue viruses in mosquitoes. Insect Mol. Biol. 2001, 10, 265–273. [Google Scholar] [CrossRef] [PubMed]
- Travieso, T.; Li, J.; Mahesh, S.; Mello, J.D.F.R.E.; Blasi, M. The use of viral vectors in vaccine development. Vaccines 2022, 7. [Google Scholar] [CrossRef] [PubMed]
- Cicero, J.M.; Fisher, T.W.; Brown, J.K. Localization of ‘Candidatus Liberibacter solanacearum’ and evidence for surface appendages in the potato psyllid vector. Phytopathology 2016, 106, 142–154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Virus 1 | Primers | Length of Amplicon | Tm (°C) | Accession Number | Reference |
---|---|---|---|---|---|
DcACV | F-5′ GCCGCACGAAACTAGTGATAAACGCA 3′ | 473 bp | 50 | KX235518.1 | [15] |
R-5′ GGATCGGTGGTGCACGAGTATGTAAGTA 3′ | |||||
DcCLV | F-5′ ATTTAGGGCCATGTGCAAAG 3′ R-3′ CCAACACACCGAGCATACAC 3′ | 526 bp | 62 | MZ484733.1 | |
DcDV | F-5′ AGTCGGTGAGACTGATATCTTCGAGACC 3′ | 1068 bp | 60 | KX165268 | |
R-5′ GTTTAGTTCGCTTGTCGGTTACACAGG 3′ | |||||
DcFLV | F-5′ AGGCGAGTACTCCCATCGGATACATT 3′ | 1391 bp | 58 | KX267823.1 | |
R-5′ GAGGGCCGCTAAGTCTGTAGGACATATT 3′ | |||||
DcPLV | F-5′ TAGGTGAACGTGATAATCCTGGTAT 3′ | 698 bp | 62 | KT698837.1 | |
R-5′ CAGAACGTCTGTTATGAATCGGAC 3′ | |||||
DcRV | F-5′ TTTTCCCAGGTACATCGA 3′ | 900 bp | 50 | KT698831.1 | [36] |
R-5′ ACCATTCAGCCAGTCCTA 3′ | |||||
CTV | F-5′ ACCGGAGCTGGCTTGACTGAT 3′ | 113 bp | 60 | MZ670758.1 | [49] |
R-5′ CCAAGCTGCCTGACATTAGTAA 3′ | |||||
Probe: 6-Fam/AGAGTGTGCTGTGTACATACAAGCTAAAGA |
County | Region | No. of Read Sequences | Megabases | No. of Contigs | BLASTN Virus Contigs | Known Viruses Detected |
---|---|---|---|---|---|---|
Orange | Winter Garden | 16,748,063 | 1256 | 46,344 | 115 | 17 |
Collier | Immokalee | 26,004,558 | 1950 | 22,670 | 21 | 12 |
Polk | Lake Alfred | 20,340,968 | 1526 | 49,651 | 58 | 19 |
Indian River | Vero Beach | 18,793,456 | 1410 | 54,646 | 8 | 14 |
Polk | Lake Wales | 12,836,297 | 963 | 32,765 | 99 | 17 |
Virus Name | Region 1 | Reference Accession Number | Longest Contig Length (bp) | Identity (%) | Coverage (%) |
---|---|---|---|---|---|
Diaphorina citri associated C virus | WG, LA, LW, VB, IK | KX235518.1-19.1 | 2376 | 98.5–99.9 | 99–100 |
Diaphorina citri densovirus | LA, LW, VB | YP_009256210.1-11.1 | 679 | 34.6–85.5 | 21–88 |
Diaphorina citri flavi-like virus | LW, IK | KX267823.1 | 27709 | 95.2–100 | 99–100 |
Diaphorina citri reovirus | IK | KT698830.1-36.1 | 4266 | 94.3–98.8 | 88–100 |
Shuangao insect virus 7 | WG, LA, VB | YP_009179392.1 | 136 | 33.0 | 26 |
Wuhan insect virus 19 | WG, LW | YP_009342322.1 | 4134 | 37.1–41.8 | 74–98 |
Culex mononega-like virus 2 | WG, LW | ASA47292.1 | 2079 | 44.8–46.7 | 43–81 |
Photinus pyralis orthomyxo-like virus 2 | LA, LW, VB | AVR52573.1 | 710 | 25.1–32.5 | 32–91 |
Liberibacter phage SGCA5-1 | LA | KX879601.1 | 36022 | 99.5 | 100 |
Wolbachia phage WO | LA | KX522565.1 | 65653 | 90.5 | 100 |
Trichoplusia ni TED virus | VB | YP_009507248.1 | 1084 | 46.7 | 95 |
Hubei earwig virus 1 | LW | APG77904.1 | 758 | 52.4 | 58 |
Lampyris noctiluca errantivirus 1 | LW | QBP37036.1 | 1096 | 49.6 | 87 |
Citrus tristeza virus | WG, LA, LW, VB, IK | MK018120.12 | 19293 | 89.1–100 | 89–100 |
Region | DcACV | DcCLV | DcDV | DcFLV | DcPLV | DcRV | CTV | CLas |
---|---|---|---|---|---|---|---|---|
Winter Garden | V 1/+ 2 | X/+ | X/− | X/− | X/− | X/− | V/+ | + |
Lake Alfred | V/+ | X/− | X/− | X/− | X/− | X/− | V/+ | + |
Lake Wales | V/+ | X/− | V/+ | V/+ | X/− | X/− | V/+ | + |
Vero Beach | V/+ | X/− | V/+ | X/− | X/− | X/− | X/− | + |
Immokalee | V/+ | X/− | X/− | V/+ | X/− | V/+ | V/+ | + |
Avg. Percentage | 100% | 20% | 40% | 40% | 0% | 20% | 80% | 100% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, C.-Y.; Batuman, O.; Levy, A. Identifying the Gut Virome of Diaphorina citri from Florida Groves. Insects 2023, 14, 166. https://doi.org/10.3390/insects14020166
Lin C-Y, Batuman O, Levy A. Identifying the Gut Virome of Diaphorina citri from Florida Groves. Insects. 2023; 14(2):166. https://doi.org/10.3390/insects14020166
Chicago/Turabian StyleLin, Chun-Yi, Ozgur Batuman, and Amit Levy. 2023. "Identifying the Gut Virome of Diaphorina citri from Florida Groves" Insects 14, no. 2: 166. https://doi.org/10.3390/insects14020166