Next Article in Journal
Multiple Introductions of the Pestiferous Land Snail Theba pisana (Müller, 1774) (Gastropoda: Helicidae) in Southern California
Previous Article in Journal
Scanning Electron Microscope Study of Antennae and Mouthparts in the Pollen-Beetle Meligethes (Odonthogethes) chinensis (Coleoptera: Nitidulidae: Meligethinae)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae)

1
Department of Plant Medicine, College of Agriculture, Life and Environment Sciences, Chungbuk National University, Cheongju 28644, Korea
2
Crop Protection Division, National Institute of Agricultural Science, Wanju 55365, Korea
*
Author to whom correspondence should be addressed.
First coauthor.
Insects 2021, 12(7), 660; https://doi.org/10.3390/insects12070660
Submission received: 7 June 2021 / Revised: 15 July 2021 / Accepted: 16 July 2021 / Published: 20 July 2021

Simple Summary

Tetranychus urticae Koch is a difficult-to-control pest due to its short life cycle and rapid resistance development. Strains exhibiting resistance to etoxazole or pyridaben exposure have been identified over the past 16 years We collected 8 T. urticae field populations from Korea. The resistance ratios of the etoxazole- and pyridaben-resistant (ER and PR) strains were significantly higher than the susceptible strain. The ER and PR strains showed cross-resistance to several acaricides. In addition, the point mutations of the target site were detected in resistant populations.

Abstract

The two-spotted spider mite Tetranychus urticae Koch is a major agricultural pest worldwide and is known to rapidly develop resistance to pesticides. In the present study, we explored a field strain that was collected in 2000 and 2003 and has been exhibiting resistance to etoxazole and pyridaben over the last 16 years. The resistance ratios of the etoxazole- and pyridaben-resistant strains (ER and PR) to etoxazole or pyridaben were more than 5,000,000- and 4109.6-fold higher than that of the susceptible strain, respectively. All field-collected populations showed resistance to etoxazole and pyridaben. The ER and PR strains showed cross-resistance to several acaricides. Both I1017F and H92R point mutations were detected in 7 out of 8 field groups. Spirodiclofen and spiromesifen resulted in more than 77.5% mortality in the 8 field groups. In addition, the genotype frequency of the I1017F point mutation was 100.0% in the ER strain, and that of the H92R point mutation was 97.0% in the PR strain. All of the field populations were found to have a high frequency of I1017F. These results suggest that the observation of resistance patterns will help in designing a sustainable IPM program for T. urticae.

1. Introduction

Tetranychids or spider mites belong to a family of phytophagous mites that cause severe economic effects on agriculture [1]. In Korea, Tetranychus urticae has been known as an important pest and has been causing economic damage since the 1950s [2]. Tetranychus urticae control is largely based on the use of acaricides in the field; therefore, it rapidly develops resistance due to its short life cycle and high reproductivity [3,4,5,6]. Additionally, resistance of T. urticae to various acaricides has become a problem in South America, North America, Asia, Austria, and Europe [7,8,9,10]. Among the acaricides to which this pest has developed resistance, etoxazole was developed in the 1980s by Yashima, a company located in Japan, and was commercialized in 1998 [11,12]. Etoxazole is an oxazoline compound and provides effective control during the egg–nymph stage and is an insect growth regulator that exerts insecticidal activity by inhibiting chitin biosynthesis [13]. The target site is glycosyltransferase chitin synthase 1 (CHS1) [13,14]. Etoxazole resistance was first reported in Japan in 1997 before its commercialization [7,15,16,17,18]. Pyridaben was developed at approximately the same time as etoxazole. It is a pyridazine compound and was discovered in 1984 by Nissan Chemical and was commercialized in 1991 [11]. It inhibits NADH:CoQ, oxidoreductase activity, and provides good efficacy against all developmental stages of various mite species [19,20]. In addition, pyridaben was commonly used in 32 countries until 1994 because it is fast-acting, stable, and biodegrades relatively quickly [21]. However, due to the use of many acaricides, METI (Mitochondrial Complex Electron Transport Inhibitor)-resistant T. urticae has been reported since the 1990s [22,23]. Tetranychus urticae can be resistant to one acaricide or exhibit multiple or cross resistance to various other acaricides [24,25,26]. The I1017F point mutation is located within the last transmembrane helix and was found to be related to etoxazole resistance [7,14]. The H92R point mutation is located within the PSST homolog in mitochondria complex I and was found to be related to pyridaben resistance [27]. Rapid molecular diagnostics for detecting single resistant and multi-resistant populations primarily identify mutations in the T. urticae genes associated with acaricide resistance.
The objective of this study was to evaluate the susceptibility to acaricides in etoxazole- and pyridaben-resistant (ER and PR) strains and in field-collected populations of T. urticae. Furthermore, the frequencies of the I1017F and H92R point mutations were investigated to identify potential resistance mechanisms.

2. Materials and Methods

2.1. Mites

The susceptible (S) strain was first collected in 2005. This strain had never been exposed to acaricides. Resistant strains were treated once a week with the LC30~LC50 of etoxazole or pyridaben. Information on the eight field populations and resistant strains is shown in Table 1. The mites were reared at 25–27 °C with a 16 L: 8 D photoperiod and 40~60% relative humidity. Kidney beans (Phaseolus vulgaris L.) were used as a host.

2.2. Acaricides

Commercially formulated abamectin (10% SC), acequinocyl (15% SC), bifenazate (13.5% SC), cyenopyrafen (25% SC), cyflumetofen (20% SC), etoxazole (10% SC), fluxametamide (9% EC), pyflubumide (10% SC), pyridaben (20% WP), spirodiclofen (22% WP), spiromesifen (20% SC), and spirotetramat (22% SC) were purchased from a farm supply store (Cheongju, Korea).

2.3. Laboratory Toxicology Assays

2.3.1. Eggs

Kidney bean leaf discs (approximately 35 mm in diameter) were used as substrates for oviposition. Ten mated females (2- to 3-day-old) were transferred on the ventral side of a bean leaf disc placed on cotton soaked in water in a Petri dish (60 mm diameter) and given a 24-h period in which to lay eggs. After 24 h, the adults were removed, and the eggs were counted. The leaf discs with eggs were treated with the selected pesticide (1/8-, 1/4-, 1/2-, 1-, 2-, and 4 times the recommended concentration) suspension using a sprayer and were then dried in the dark for 30 min. The recommended concentration of each pesticide was only used to treat the field-collected populations. Control groups were sprayed with distilled water only. All leaf discs were examined daily for 7 days. The numbers of hatched and unhatched eggs were recorded. The dishes were incubated at 25–27 °C under 40–60% relative humidity and a 16 L:8 D photoperiod. All experiments were replicated three times.

2.3.2. Adult Females

Adult females (2 to 3 days old, avg. 20–150/experiment) were transferred to bean leaf discs (35 mm in diameter) on wet cotton wool using a brush. Solutions diluted to various concentrations (1/8-, 1/4-, 1/2-, 1-, 2-, and 4 times the recommended concentration of pesticide) were sprayed (3 mL each) onto the discs, which were then dried in the dark for 30 min. The recommended concentration of each pesticide was only used to treat the field-collected populations. The dishes were incubated at 25–27 °C under 40–60% relative humidity and a 16 L:8 D photoperiod. Mortality was evaluated at 48 h after treatment. Control groups were sprayed with distilled water only, and the control mortality in all tests never exceeded 5%. All experiments were replicated three times.

2.4. General Sequencing and Pyrosequencing of CHS1 and PSST in T. urticae

Genomic DNA was extracted from 200 mites from each T. urticae strain using the G-spin Total DNA Extraction Mini Kit (Intron, Seongnam, Korea) according to the manufacturer’s instructions. Approximately 100 ng of DNA was used as template DNA for PCR. The reactions were performed using a PCR Premix kit (HotStart, Bioneer Co., Daejeon, Korea) and the primers listed in Table 2. The resulting PCR products were purified and directly sequenced using Bioneer Co. The pyrosequencing protocol consisted of 45 PCR cycles performed with the forward primer and biotinylated reverse primer at 0.5 μM, each in 20 μL reaction mixture containing 1× Taq enzyme reaction mix (Enzynomics, Daejeon, Korea). The following cycling conditions were used: one cycle at 95 °C for 15 min; 45 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; and a final step at 72 °C for 10 min. The reactions were performed using a PyroGold reagent kit and a PyroMark ID system (Qiagen, Germantown, MD, USA).

2.5. Data Analysis

To estimate the parameters of a concentration–mortality line for each leaf-dip bioassay, replicate data were collected and analyzed using the probit model in the SAS program [28]. Two LC50 values were considered different at p < 0.01.

3. Results

3.1. Resistance Ratios (RRs) to Etoxazole and Pyridaben

Bioassays were conducted using etoxazole and pyridaben in etoxazole-resistant (ER) and pyridaben-resistant (PR) strains of T. urticae. When the eggs were treated with etoxazole, the ER strain showed an RR that was > 5,000,000-fold higher than that of the S strain (Table 3). The RR of PR strain was 9.5-fold. However, the ER strain had a low RR of 3.6-fold to pyridaben. The PR strain had an RR that was over 4109.6-fold higher than the S strain to pyridaben. As already reported, etoxazole had no effect on the adults. Additionally, pyridaben was not treated with concentrations above 400 ppm (4 times recommended dose) because it showed a repellent characteristic towards adults.

3.2. Cross-Resistance to 10 Acaricides in the S, ER, and PR Strains

Cross-resistance to 10 acaricides with different modes of action was determined in the S, ER, and PR strains of T. urticae eggs and adults. First, eggs from the ER strain of T. urticae showed resistance to abamectin, bifenazate, cyenopyrafen, cyflumetofen, fluxametamide, pyflubumide, and spirotetramat, with RRs of 10.6, >10.7, 20.2, >378.7, 10.5, 682.8, and >1612.9, respectively (Table 4). Eggs from the PR strain of T. urticae showed resistance to bifenazate, fluxametamide, pyflubumide, and spirotetramat, with RRs of >10.7, 11.4, 54.1, and >1612.9, respectively. Next, adults from the ER strain of T. urticae were resistant to cyenopyrafen, cyflumetofen, pyflubumide, and spirotetramat (Table 5). Adults from the PR strain of T. urticae had resistance to cyflumetofen, with an RR of 40.6.

3.3. Acaricide Susceptibility of 8 Field-Collected Populations

Of the twelve acaricides, spirodiclofen and spiromesifen had acaricidal activity in all of the field population eggs. Spirodiclofen and spiromesifen resulted in mortality rates of more than 77.5% and 82.5%, respectively (Table 6). Twelve acaricides did not cause mortality of more than 80% in all field adults. OC and CJ had mortality rates greater than 90% with fluxametamide, and CJ had mortality rates greater than 90% with abamectin (Table 7). The LC50 value for all field populations was more than 500 ppm when they were treated with etoxazole, and the RR was > 25,500 (Table 8). For pyridaben, seven of the eight field populations, CJ being the exception, had LC50 values greater than 4000 ppm, and the RR was > 5480. The LC50 value for the CJ population was 103.26 ppm, and the RR was 144.5 (Table 9).

3.4. Genotypes of Point Mutations (I1017F and H92R)

Using pyrosequencing, the frequencies of I1017F in CHS1 and H92R in the PSST subunit of mitochondrial electron transport complex I were identified (Table 10). The I1017F point mutation was found in the ER strain but not in the S and PR strains. The H92R point mutation in the PSST gene was present in the PR strain but not in the S and ER strains. The sequencing results from the eight field populations showed that the I1017F mutation was present in all of the groups. The H92R point mutation was present in seven field populations. Five of them had a homozygous allele for histidine (H). The OC and YI populations showed heterozygous alleles for H and R (arginine). The genotype frequency of a phenylalanine (F) at the 1017th amino acid position of CHS1 was 100% in the ER strain. In the eight field populations, it was 72~99.0%. However, in the S and PR strains, it was 0.0% and 2.0%, respectively. The genotype frequency of an arginine (R) on the 92th amino acid position of PSST was 99.0% in the PR strain. However, in the S and ER strains, it was 11.0% and 29.0%, respectively.

4. Discussion

The controlling of two-spotted spider mites mainly depends on chemical control methods, and there are many reports on the development of resistance to acaricides due to their short lifespan and high fecundity. In this study, we determined the cross-resistance of ER and PR strains and the complex resistance of the field-collected populations. We also observed the frequency of point mutations in the etoxazole resistance- (I1017F of CHS1) and pyridaben resistance-related gene (H92R of PSST). As a result, the resistance ratio of the ER and PR strains was less than 10, and there was no cross-resistance. In previous studies, ER strains also showed low cross-resistance to pyridaben [30]. Our results were also similar to that research. However, the PR strain was shown to have cross-resistance to etoxazole by Choi et al. [29]. Since the PR strain used in this study is a more carefully selected strain, this result is considered to be more reliable. In addition, both strains showed a high resistance ratio because they had been exposed to etoxazole or pyridaben for a long period of time (more than 16 years), and the possibility of cross-resistance is low (Table 3). In order to find effective acaricides against etoxazole- and pyridaben-resistant strains, we performed sensitivity evaluation using 10 pesticides. As a result of treatment with ER eggs, the pesticides that showed less than 70% acaricidal effect were abamectin, bifenazate, cyflumetofen, fluxametamide, pyflubumide, and spirotetramat. In PR eggs, the pesticides that showed less than 70% acaricidal effect were abamectin, bifenazate, cyflumetofen, fluxametamide, and spirotetramat (Table 4). Abamectin, bifenazate and pyflubumide were less effective for eggs than adults in a recent study [31,32]. P450s are known to be related to cyflumetofen resistance [33]. Additionally, P450s are known to be related to pyridaben and etoxazole resistance, so the ER and PR strains showed cross resistance to cyflumetofen [33,34]. Fluxametamide has a similar mode of action to diamide. Diamides are more effective in larvae than in the eggs of Lepidopterans, and they seem to have worked similarly in T. urticae [35]. Spirodiclofen and spiromesifen showed high acaricidal effects in both resistant strains, but spirotetramat, insecticides belonging to the same chemical class, had a low effect. In a previous study, spirotetramat showed an LC50 value 34 times higher than that of spirodiclofen in Panonychus citri eggs [36]. Since T. urticae and P. citri belong to the same family, similar results seem to have been obtained. Therefore, acequinocyl, spirodiclofen, and spiromesifen could be used to the control eggs from the ER and PR strains. Additionally, cyenopyrafen was effective against eggs from the PR strain.
When adults from the ER strain were treated with ten acaricides, the mortality due to cyenopyrafen, cyflumetofen, pyflubumide, spirodiclofen, and spirotetramat was less than 70%. Adults from the PR strain showed resistance to spirotetramat (Table 5). Khalighi et al. [37] reported that etoxazole-resistant strains did not have cross-resistance to cyenopyrafen and cyflumetofen. Cyflumetofen and cyenopyrafen show an increased acaricidal effect when P450 activity is inhibited. P450s and glutathione-S-transferases have been related to the acaricidal effect of cyflumetofen [33,38]. Pyflubumide is classified in the new subgroup 25B (carboxanilide) in the IRAC (Insecticide Resistance Action Committee) MoA classification as a novel inhibitor of mitochondrial complex II on the respiratory chain and has a similar mechanism to cyenopyrafen and cyflumetofen, so resistance to this compound may have developed via the same factors [39,40]. Spirodiclofen, spiromesifen, and spirotetramat have sterility effects on adult females and ovicidal effects on eggs but do not have a control effect on adults [41]. Therefore, abamectin, acequinocyl, bifenazate, and fluxametamide will be effective in controlling adults that have developed resistance to etoxazole and pyridaben. In a previous report, Marcic et al. showed that the toxicity of spirotetramat to eggs is most likely caused by its residual effect on hatching larvae [42].
We also compared the acaricidal activities of etoxazole and pyridaben in resistant groups and field populations. As a result, all field populations showed resistance to the two acaricides (Table 6 and Table 7). Etoxazole has been used for over 20 years since its registration in Korea in 1998, and pyridaben has been used for nearly 30 years since its registration in Korea in 1992 [30,43]. Resistance to the two acaricides began to be reported in the late 1990s [11,15,22]. All field populations had some level of resistance because resistance has steadily developed with the long-term use of these chemicals [7,16,17,18]. Based on this result, we treated resistant groups and eight field populations with ten different acaricides on. Since the pesticides used in each region may be different, there may be differences in the degree of resistance development to each pesticide. In all of the field populations, spirodiclofen and spiromesifen had an acaricidal effect of more 77.5% in eggs.
The results of the genotype frequency analysis of the H92R point mutation showed that the OC and YI populations had a lower frequency than the other populations, but the bioassays showed that the resistance ratio was more than 5480-fold (Table 9). In this regard, it has been reported that cyflumetofen and cyenopyrafen-resistant mites have cross resistance to pyridaben [37,43]. Additionally, the mutation frequency of the I1017F gene was different for each region, and the resistance ratio was the same by more than 25,500 times. The reason for this is that although there is a difference in the degree of resistance by region, it seems that the same result appeared because it was not treated at a dose of 500 ppm or more. All field populations had resistance to most of the acaricides used in this experiment. Spirodiclofen and spiromesifen showed excellent effects in the eggs of field populations with complex resistance and may be effective in controlling T. urticae.

5. Conclusions

To control T. urticae effectively, the alternation of acaricides is necessary, and indiscriminate pesticide use should be avoided. Before applying an acaricide, the degree of resistance development should be checked. The development of resistance to etoxazole and pyridaben can be diagnosed using the I1017F and H92R point mutations as resistance diagnostic markers. Almost all field populations have multiple resistance genes; therefore, continuous research on the development of resistance is needed.

Author Contributions

Conceptualization, G.-H.K.; data curation, H.-N.K. and S.-R.C.; formal analysis, W.K.; funding acquisition, G.-H.K.; investigation, J.C. and E.S.; methodology, H.-N.K.; project administration, G.-H.K.; software, H.K.; supervision, G.-H.K.; writing-original draft, B.P.; writing-review and editing, H.-N.K. and G.-H.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bolland, H.R.; Gutierrez, J.; Flechtmann, C.H.W. World Catalogue of the Spider Mite Family (Acari: Tetranychidae); Koninklijke Brill: Leiden, The Netherlands, 1998. [Google Scholar]
  2. Choi, K.M.; Ahn, S.B.; Lee, S.W.; Lee, M.H. Compendium of Insect Pests of Fruit Trees with Color Plates; Agricultural Sciences Institute, Rural Development Administration: Suwon, Korea, 1989. [Google Scholar]
  3. Ilias, A.; Vontas, J.; Tsagkarakou, A. Global distribution and origin of target site insecticide resistance mutations in Tetranychus urticae. Insect Biochem. Mol. Biol. 2014, 48, 17–28. [Google Scholar] [CrossRef] [Scilit]
  4. Ilias, A.; Vassiliou, V.A.; Vontas, J.; Tsagkarakou, A. Molecular diagnostics for detecting pyrethroid and abamectin resistance mutations in Tetranychus urticae. Pestic. Biochem. Physiol. 2017, 135, 9–14. [Google Scholar] [CrossRef] [Scilit]
  5. Van Leeuwen, T.; Vontas, J.; Tsagkarakou, A.; Tirry, L. Mechanisms of acaricide resistance in the two-spotted spider mite Tetranychus urticae. In Biorational Control of Arthropod Pests: Application and Resistance Management; Ishaaya, I., Horowitz, A.R., Eds.; Springer: Dordrecht, The Netherlands, 2009; pp. 347–393. [Google Scholar]
  6. Van Leeuwen, T.; Vontas, J.; Tsagkarakou, A.; Dermauw, W.; Tirry, L. Acaricide resistance mechanisms in the two-spotted spider mite Tetranychus urticae and other important Acari: A review. Insect Biochem. Mol. Biol. 2010, 40, 563–572. [Google Scholar] [CrossRef] [Scilit]
  7. Herron, G.A.; Woolley, L.K.; Langfield, K.L.; Chen, Y. First detection of etoxazole resistance in Australian two-spotted mite Tetranychus urticae Koch (Acarina: Tetranychidae) via bioassay and DNA methods. Austral Entomol. 2018, 57, 365–368. [Google Scholar] [CrossRef] [Scilit]
  8. Lee, Y.S.; Song, M.H.; Ahn, K.S.; Lee, K.Y.; Kim, J.W.; Kim, G.H. Monitoring of acaricide resistance in two-spotted spider mite (Tetranychus urticae) populations from rose greenhouses in Korea. J. Asia-Pac. Entomol. 2003, 6, 91–96. [Google Scholar] [CrossRef] [Scilit]
  9. Monteiro, V.B.; Gondim, M.G.C.; Oliveira, J.E.M.; Siqueira, H.A.A.; Sousa, J.M. Monitoring Tetranychus urticae Koch (Acari: Tetranychidae) resistance to abamectin in vineyards in the Lower Middle São Francisco Valley. Crop Prot. 2015, 69, 90–96. [Google Scholar] [CrossRef] [Scilit]
  10. Xu, D.; He, Y.; Zhang, Y.; Xie, W.; Wu, Q.; Wang, S. Status of pesticide resistance and associated mutations in the two-spotted spider mite, Tetranychus urticae, in China. Pestic. Biochem. Physiol. 2018, 150, 89–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Dekeyser, M.A. Acaricide mode of action. Pest Manag. Sci. 2005, 61, 103–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Suzuki, J.; Ishida, T.; Toda, K.; Ikeda, T.; Tsukidate, Y.; Kikuchi, Y.; Ito, Y. Preparation of 2,4-diphenyloxazolines and—thia-zolines as ovicidal insecticides and acaricides. Eur. Pat. EP 1989, 345, 775. [Google Scholar]
  13. Suzuki, J.; Ishida, T.; Kikuchi, Y.; Ito, Y.; Morikawa, C.; Tsukidate, Y.; Tanji, I.; Ota, Y.; Toda, K. Synthesis and activity of novel acaricidal/insecticidal 2, 4-diphenyl-1, 3-oxazolines. J. Pestic. Sci. 2002, 27, 1–8. [Google Scholar] [CrossRef] [Scilit]
  14. Van Leeuwen, T.; Demaeght, P.; Osborne, E.J.; Dermauw, W.; Gohlke, S.; Nauen, R.; Grbic, M.; Tirry, L.; Merzendorfer, H.; Clark, R.M. Population bulk segregant mapping uncovers resistance mutations and the mode of action of a chitin synthesis inhibitor in arthropods. Proc. Natl. Acad. Sci. USA 2012, 109, 4407–4412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Kobayashi, M.; Kobayashi, S.; Nishimori, T. Occurrence of etoxazole resistance individuals of the two-spotted spider mite, Tetranychus urticae Koch from a limited region. Jpn. J. Appl. Entomol. Zool. 2001, 45, 83–88. [Google Scholar] [CrossRef] [Scilit]
  16. Demaeght, P.; Osborne, E.J.; Odman-Naresh, J.; Grbić, M.; Nauen, R.; Merzendorfer, H.; Clark, R.M.; Van Leeuwen, T. High resolution genetic mapping uncovers chitin synthase-1 as the target-site of the structurally diverse mite growth inhibitors clofentezine, hexythiazox and etoxazole in Tetranychus urticae. Insect Biochem. Mol. Biol. 2014, 51, 52–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Osakabe, M.; Imamura, T.; Nakano, R.; Kamikawa, S.; Tadatsu, M.; Kunimoto, Y.; Doi, M. Combination of restriction endonuclease digestion with the ΔΔCt method in real-time PCR to monitor etoxazole resistance allele frequency in the two-spotted spider mite. Pestic. Biochem. Physiol. 2017, 139, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Tirello, P.; Pozzebon, A.; Cassanelli, S.; Van Leeuwen, T.; Duso, C. Resistance to acaricides in Italian strains of Tetranychus urticae: Toxicological and enzymatic assays. Exp. Appl. Acarol. 2012, 57, 53–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Hollingworth, R.M.; Ahammadsahib, K.I.; Gadelhak, G.; McLaughlin, J.L. New inhibitors of Complex I of the mitochondrial electron transport chain with activity as pesticides. Biochem. Soc. Trans. 1994, 22, 230–233. [Google Scholar] [CrossRef] [Scilit]
  20. Stumpf, N.; Nauen, R. Cross-resistance, inheritance, and biochemistry of mitochondrial electron transport inhibitor-acaricide resistance in Tetranychus urticae (Acari: Tetranychidae). J. Econ. Entomol. 2001, 94, 1577–1583. [Google Scholar] [CrossRef] [Scilit]
  21. Hirata, K.; Kawamura, Y.; Kudo, M.; Igarashi, H. Development of a new acaricide, pyridaben. J. Pestic. Sci. 1995, 20, 213–221. [Google Scholar] [CrossRef] [Scilit]
  22. Devine, G.J.; Barber, M.; Denholm, I. Incidence and inheritance of resistance to METI-acaricides in European strains of the two-spotted spider mite (Tetranychus urticae) (Acari: Tetranychidae). Pest Manag. Sci. 2001, 57, 443–448. [Google Scholar] [CrossRef] [Scilit]
  23. Nauen, R.; Stumpf, N.; Elbert, A.; Zebitz, C.P.W.; Kraus, W. Acaricide toxicity and resistance in larvae of different strains of Tetranychus urticae and Panonychus ulmi (Acari: Tetranychidae). Pest Manag. Sci. 2001, 57, 253–261. [Google Scholar] [CrossRef] [Scilit]
  24. Khajehali, J.; Van Nieuwenhuyse, P.; Demaeght, P.; Tirry, L.; Van Leeuwen, T. Acaricide resistance and resistance mechanisms in Tetranychus urticae populations from rose greenhouses in the Netherlands. Pest Manag. Sci. 2011, 67, 1424–1433. [Google Scholar] [CrossRef] [Scilit]
  25. Sparks, T.C.; Nauen, R. IRAC: Mode of action classification and insecticide resistance management. Pestic. Biochem. Physiol. 2015, 121, 122–128. [Google Scholar] [CrossRef] [Scilit]
  26. Van Leeuwen, T.; Dermauw, W.; Grbic, M.; Tirry, L.; Feyereisen, R. Spider mite control and resistance management: Does a genome help? Pest Manag. Sci. 2013, 69, 156–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Bajda, S.; Dermauw, W.; Panteleri, R.; Sugimoto, N.; Douris, V.; Tirry, L.; Osakabe, M.; Vontas, J.; Van Leeuwen, T. A mutation in the PSST homologue of complex I (NADH: Ubiquinone oxidoreductase) from Tetranychus urticae is associated with resistance to METI acaricides. Insect Biochem. Mol. Biol. 2017, 80, 79–90. [Google Scholar] [CrossRef] [Scilit]
  28. SAS Institute. SAS/STAT User’s Guide: Statistics, Version 9.1; SAS Institute: Cary, NC, USA, 2010. [Google Scholar]
  29. Choi, J.; Koo, H.N.; Kim, S.I.; Park, B.; Kim, H.; Kim, G.H. Target-site mutations and glutathione S-transferases are associated with acequinocyl and pyridaben resistance in the two-spotted spider mite Tetranychus urticae (Acari: Tetranychidae). Insects 2020, 11, 511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Lee, S.Y.; Ahn, K.S.; Kim, C.S.; Shin, S.C.; Kim, G.H. Inheritance and stability of etoxazole resistance in twospotted spider mite. Tetranychus urticae, and its cross resistance. Korean J. Appl. Entomol. 2004, 43, 43–48. [Google Scholar]
  31. Fotoukkiaii, S.M.; Mermans, C.; Wybouw, N.; Van Leeuwen, T. Resistance risk assessment of the novel Complex II inhibitor pyflubumide in the polyphagous pest Tetranychus urticae. J. Pest Sci. 2020, 93, 1085–1096. [Google Scholar] [CrossRef] [Scilit]
  32. Ochiai, N.; Mizuno, M.; Mimori, N.; Miyake, T.; Dekeyser, M.; Canlas, L.J.; Takeda, M. Toxicity of bifenazate and its principal active metabolite, diazene, to Tetranychus urticae and Panonychus citri and their relative toxicity to the predaceous mites, Phytoseiulus persimilis and Neoseiulus californicus. Exp. Appl. Acarol. 2007, 43, 181–197. [Google Scholar] [CrossRef] [Scilit]
  33. Feng, K.; Ou, S.; Zhang, P.; Wen, X.; Shi, L.; Yang, Y.; Hu, Y.; Zhang, Y.; Shen, G.; Xu, Z.; et al. The cytochrome P450 CYP389C16 contributes to the cross-resistance between cyflumetofen and pyridaben in Tetranychus cinnabarinus (Boisduval). Pest Manag. Sci. 2019, 76, 665–675. [Google Scholar] [CrossRef] [Scilit]
  34. Salman, S.Y.; Aydınlı, F.; Ay, R. Etoxazole resistance in predatory mite Phytoseiulus persimilis A.-H. (Acari: Phytoseiidae): Cross-resistance, inheritance and biochemical resistance mechanisms. Pestic. Biochem. Physiol. 2015, 122, 96–102. [Google Scholar] [CrossRef] [Scilit]
  35. Ioriatti, C.; Anfora, G.; Angeli, G.; Mazzoni, V.; Trona, F. Effects of chlorantraniliprole on eggs and larvae of Lobesia botrana (Denis & Schiffermüller) (Lepidoptera: Tortricidae). Pest Manag. Sci. 2009, 65, 717–722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Ouyang, Y.; Montez, G.H.; Liu, L.; Grafton-Cardwell, E.E. Spirodiclofen and spirotetramat bioassays for monitoring resistance in citrus red mite, Panonychus citri (Acari: Tetranychidae). Pest Manag. Sci. 2012, 68, 781–787. [Google Scholar] [CrossRef] [Scilit]
  37. Khalighi, M.; Tirry, L.; Van Leeuwen, T. Cross-resistance risk of the novel complex II inhibitors cyenopyrafen and cyflumetofen in resistant strains of the two-spotted spider mite Tetranychus urticae. Pest Manag. Sci. 2014, 70, 365–368. [Google Scholar] [CrossRef] [Scilit]
  38. Insecticide Resistance Action Committee (IRAC). Available online: http://www.irac-online.org/modes-of-action/ (accessed on 5 October 2020).
  39. Fotoukkiaii, S.M.; Wybouw, N.; Kurlovs, A.H.; Tsakireli, D.; Pergantis, S.A.; Clark, R.M.; Vontas, J.; Van Leeuven, T. High-resolution genetic mapping reveals cis-regulatory and copy number variation in loci associated with cytochrome P450-mediated detoxification in a generalist arthropod pest. PLoS Genet. 2021, 17, e1009422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Nauen, R. Spirodiclofen: Mode of action and resistance risk assessment in tetranychid pest mites. J. Pestic. Sci. 2005, 30, 272–274. [Google Scholar] [CrossRef] [Scilit]
  41. Marcic, D.; Mutavdzic, S.; Medjo, I.; Prijovic, M.; Peric, L. Spirotetramat toxicity to immatures and sublethal effects on fecundity of female adults of Tetranychus urticae Koch. Zoosymposia 2011, 6, 99–103. [Google Scholar] [CrossRef] [Scilit]
  42. Cho, J.R.; Kim, Y.J.; Ahn, Y.J.; Yoo, J.K.; Lee, J.O. Monitoring of acaricide resistance in field-collected populations of Tetranychus urticae (Acari: Tetranychidae) in Korea. Korean J. Appl. Entomol. 1995, 34, 40–45. [Google Scholar]
  43. Sugimoto, N.; Osakabe, M. Cross-resistance between cyenopyrafen and pyridaben in the twospotted spider mite Tetranychus urticae (Acari: Tetranychidae). Pest Manag. Sci. 2014, 70, 1090–1096. [Google Scholar] [CrossRef] [Scilit]
Table 1. Collection data of mite populations included in this study.
Table 1. Collection data of mite populations included in this study.
PopulationsDate
Collected
RegionHostCollection Locations
(South Korea)
Lab-selectedEtoxazole resistant (ER)Aug 2000BuyeoRoseInsects 12 00660 i001
Pyridaben resistant (PR)Feb 2003UiseongRose
Field-collectedCheongju (CJ)Mar 2020CheongjuMelon
Gimhae-1 (GH-1)Aug 2019GimhaeRose
Gimhae-2 (GH-2)Aug 2019GimhaeRose
Gumi-1 (GM-1)Aug 2019GumiRose
Gumi-2 (GM-2)Aug 2019GumiRose
Okcheon (OC)Feb 2020OkcheonRose
Peongtaek (PT)Mar 2020PyeongtaekRose
Yongin (YI)Oct 2019YonginStrawberry
Table 2. Primers used for PCR amplification.
Table 2. Primers used for PCR amplification.
ReactionTargetNameSequence
General sequencingCHS1Demaeght-FAGATCCTTTACGTCTGGGGC
Demaeght-RCAATTGGGACTCGTTTCTTTTCA
PSSTPSST-FACAGGTCAGCCAATCGAATC
PSST-RATACCAAGCCTGAGCAGTGG
PyrosequencingCHS1CHS-FGTCTTTTGTAGTGGCGGCATT
CHS-RTCCCCAAGTAACAACGTTCAAGT
PSSTPSST-FTGACTTTTGGATTAGCCTGTTGTG
PSST-RAGGACTTGCTCTGAATAACATACCA
Table 3. Susceptibility to etoxazole and pyridaben in S, ER and PR strains of T. urticae.
Table 3. Susceptibility to etoxazole and pyridaben in S, ER and PR strains of T. urticae.
AcaricideStageStrainnLC50 (ppm) (95% CL a)Slope ± SERR b
Etoxazole S17800.02 (0.02–0.03)1.95 ± 0.161
EggER1075>100,000->5,000,000
PR18460.19 (0.04–0.67)2.36 ± 0.459.5
S266>100,000-No effect
AdultER107>100,000--
PR93>100,000--
Pyridaben S c4620.73 (0.31–1.48)0.91 ± 0.101.0
EggER18262.65 (1.27–4.16)0.61 ± 0.103.6
PR c619>3000->4109.6
S90>400 Not
measurable
AdultER90>400-
PR98>400-
a Confidence limits. b RR, resistance ratio = LC50 of resistant strain/LC50 of susceptible strain. c Choi et al. [29].
Table 4. Susceptibility to acaricides in the eggs of S, ER, and PR strains of T. urticae.
Table 4. Susceptibility to acaricides in the eggs of S, ER, and PR strains of T. urticae.
AcaricideStrainnLC50 (ppm) (95% CL a)Slope ± SERR b
AbamectinS7200.87 (0.34–2.82)1.72 ± 0.241.0
ER4969.24 (8.71–15.62)1.64 ± 0.2510.6
PR6428.52 (5.64–11.84)1.34 ± 0.389.8
AcequinocylS12308.02 (6.91–9.53)2.14 ± 0.191.0
ER171912.59 (4.92–37.54)1.94 ± 0.511.6
PR c8811.47 (0.53–3.10)1.42 ± 0.210.2
BifenazateS178065.21 (23.60–136.91)0.45 ± 0.111.0
ER2391>700->10.7
PR378>700->10.7
CyenopyrafenS4961.68 (0.87–2.63)2.65 ± 0.471.0
ER230633.85 (20.23–45.74)1.73 ± 0.2620.2
PR10241.32 (0.85–2.54)1.35 ± 0.281.3
CyflumetofenS7320.79 (0.29–0.99)1.83 ± 0.311.0
ER988>300->379.7
PR8654.57 (1.38–10.32)1.56 ± 0.195.8
FluxametamideS9624.62 (1.46–14.73)1.24 ± 0.221.0
ER47748.32 (39.12–56.25)1.56 ± 0.3310.5
PR88452.64 (27.86–79.19)2.88 ± 0.3711.4
PyflubumideS5170.08 (0.01–0.25)1.23 ± 0.161.0
ER72754.62 (40.07–86.89)0.94 ± 0.19682.8
PR8754.33 (2.21–12.36)1.95 ± 0.1454.1
SpirodiclofenS85718.23 (12.78–21.38)1.56 ± 0.281.0
ER154918.02 (12.87–24.33)2.31 ± 0.131.0
PR98419.32 (12.64–32.54)1.35 ± 1.251.1
SpiromesifenS9090.74 (0.38–1.79)1.85 ± 0.371.0
ER6980.33 (0.25–0.43)1.71 ± 0.160.4
PR9210.94 (0.31–2.54)1.34 ± 0.251.3
SpirotetramatS8730.31 (0.08–0.40)1.22 ± 0.241.0
ER1733>500->1612.9
PR932>500->1612.9
a Confidence limits. b RR, resistance ratio = LC50 of resistant strain/LC50 of susceptible strain. c Choi et al. [29].
Table 5. Susceptibility to acaricides in adults of the S, ER, and PR strains of T. urticae.
Table 5. Susceptibility to acaricides in adults of the S, ER, and PR strains of T. urticae.
AcaricideStrainnLC50 (ppm) (95% CL a)Slope ± SERR b
AbamectinS1340.21 (0.08–0.82)1.27 ± 0.181.0
ER1920.10 (0.09–0.12)1.02 ± 0.150.5
PR2450.23 (0.01–0.75)1.84 ± 0.321.1
AcequinocylS c2252.78 (1.48–6.58)0.51 ± 0.071.0
ER54520.38 (17.31–23.87)1.72 ± 0.147.3
PR c22513.41 (10.06–21.94)0.92 ± 0.104.8
BifenazateS3595.08 (2.84–10.90)1.37 ± 0.231.0
ER36323.39 (19.44–28.70)1.19 ± 0.104.6
PR2564.76 (2.62–8.29)1.25 ± 0.330.9
CyenopyrafenS1821.32 (0.54–4.72)1.37 ± 0.181.0
ER20870.61 (54.39–93.28)1.02 ± 0.1353.5
PR2436.51 (3.01–17.86)1.31 ± 0.124.9
CyflumetofenS680.58 (0.29–0.99)1.83 ± 0.311.0
ER212>1000->1724.1
PR13523.54 (14.81–25.66)1.35 ± 0.1040.6
FluxametamideS3622.26 (1.66–3.09)2.54 ± 0.321.0
ER1211.96 (1.42–5.07)1.68 ± 0.230.9
PR2532.12 (1.73–4.62)1.26 ± 0.330.9
PyflubumideS1802.75 (1.32–5.31)1.27 ± 0.141.0
ER181>2000->727.3
PR1830.72 (0.34–0.62)1.16 ± 0.150.3
SpirodiclofenS67>1800-No effect
ER167>1800--
PR108>1800--
SpiromesifenS75>1000-No effect
ER131>1000--
PR109>1000--
SpirotetramatS33232.62 (21.81–57.43)1.95 ± 0.311.0
ER221354.01 (69.44–3345)0.17 ± 0.0610.9
PR192262.13 (142.54–1283)0.67 ± 0.118.0
a Confidence limits. b RR, resistance ratio = LC50 of resistant strain/LC50 of susceptible strain. c Choi et al. [29].
Table 6. Mortality of T. urticae eggs of eight field populations in response to 12 acaricides.
Table 6. Mortality of T. urticae eggs of eight field populations in response to 12 acaricides.
Acaricide% Mortality a (mean ± SE)
nCJnGH-1nGH-2nGM-1nGM-2nOCnPTnYI
Abamectin1243.4 ± 3.21353.1 ± 3.01113.8 ± 2.58213.0 ± 2.28212.5 ± 5.331411.2 ± 0.19715.1 ± 8.421915.7 ± 1.6
Acequinocyl8617.1 ± 3.1949.2 ± 1.58020.0 ± 5.210115.7 ± 3.010311.5 ± 6.028712.3 ± 6.27912.9 ± 5.523318.2 ± 2.2
Bifenazate1085.0 ± 6.39315.7 ± 5.77716.5 ± 8.47819.5 ± 4.17614.9 ± 7.319712.3 ± 3.310521.6 ± 8.721614.7 ± 6.7
Cyenopyrafen9717.7 ± 6.21297.0 ± 1.37611.7 ± 1.311112.6 ± 2.110211.0 ± 3.73721.4 ± 2.41119.2 ± 2.5803.7 ± 2.8
Cyflumetofen17711.9 ± 3.01043.8 ± 0.7869.3 ± 0.9838.5 ± 2.51137.6 ± 4.74812.8 ± 2.1963.3 ± 2.6798.6 ± 4.4
Etoxazole33033.9 ± 4.01260.0 ± 0.016416.9 ± 6.13200.0 ± 0.01140.0 ± 0.02620.0 ± 0.01492.1 ± 2.24633.0 ± 2.8
Fluxametamide33960.2 ± 3.917216.5 ± 7.710623.5 ± 4.912848.2 ± 6.110347.6 ± 5.240541.4 ± 1.11492.1 ± 2.28024.0 ± 5.8
Pyflubumide14922.6 ± 4.91096.5 ± 1.035711.2 ± 1.69412.3 ± 2.5909.4 ± 3.24573.6 ± 2.31104.7 ± 1.91136.4 ± 4.13
Pyridaben30863.5 ± 3.42692.7 ± 2.24310.0 ± 0.02680.4 ± 0.82852.1 ± 0.92201.3 ± 1.33232.1 ± 0.740129.7 ± 10.2
Spirodiclofen232100.0 ± 0.09482.7 ± 3.627884.5 ± 5.710191.1 ± 1.67689.1 ± 5.146285.0 ± 3.69377.5 ± 4.3102100.0 ± 0.0
Spiromesifen25498.8 ± 0.111682.8 ± 1.48282.5 ± 1.79495.8 ± 0.310995.5 ± 2.146794.8 ± 2.211689.8 ± 5.29489.8 ± 5.0
Spirotetramat11318.5 ± 6.21537.9 ± 0.27210.4 ± 1.011413.9 ± 5.08925.7 ± 3.73140.0 ± 0.010418.6 ± 2.51270.0 ± 0.0
a % Mortality stands for the % mortality at the field recommended dose.
Table 7. Mortality of T. urticae adults of eight field populations in response to 12 acaricides.
Table 7. Mortality of T. urticae adults of eight field populations in response to 12 acaricides.
Acaricide% Mortality a (mean ± SE)
nCJnGH-1nGH-2nGM-1nGM-2nOCnPTnYI
Abamectin7590.8 ± 2.08116.5 ± 4.58010.0 ± 5.88413.7 ± 3.06712.5 ± 3.08013.3 ± 3.38311.8 ± 2.68024.7 ± 4.4
Acequinocyl86100.0 ± 0.0656.4 ± 3.68414.6 ± 7.9982.6 ± 2.68020.0 ± 5.19610.7 ± 3.06727.7 ± 1.49250.0 ± 4.8
Bifenazate7673.3 ± 8.28122.7 ± 3.77819.9 ± 3.99211.1 ± 2.88123.0 ± 2.09065.9 ± 6.5806.7 ± 3.38651.5 ± 3.0
Cyenopyrafen7678.5 ± 5.58013.3 ± 3.3869.1 ± 5.39213.9 ± 2.88011.7 ± 3.37814.1 ± 7.18813.9 ± 7.4900.0 ± 0.0
Cyflumetofen8530.5 ± 4.48638.7 ± 4.7920.0 ± 0.08611.9 ± 2.47320.3 ± 5.98218.7 ± 4.1846.1 ± 6.18010.0 ± 5.8
Etoxazole750.2 ± 2.2760.0 ± 0.0750.0 ± 0.0750.0 ± 0.0700.0 ± 0.0851.3 ± 3.9640.0 ± 0.0620.0 ± 0.0
Fluxametamide8194.3 ± 1.58241.7 ± 4.87052.4 ± 4.07247.6 ± 2.47143.1 ± 2.16894.4 ± 5.69825.6 ± 7.87954.7 ± 1.6
Pyflubumide8213.0 ± 4.48016.7 ± 4.8860.0 ± 0.08817.8 ± 4.9745.4 ± 3.4800.0 ± 0.0826.7 ± 6.7783.3 ± 3.3
Pyridaben702.7 ± 2.7752.6 ± 2.3601.0 ± 3.3632.3 ± 2.9726.4 ± 3.2683.5 ± 3.16716.0 ± 4.3675.3 ± 1.9
Spirodiclofen862.1 ± 3.500.0 ± 0.0885.4 ± 8.9760.0 ± 0.0808.3 ± 9.28010.2 ± 7.1836.3 ± 3.3819.5 ± 6.9
Spiromesifen833.5 ± 5.3813.1 ± 1.6800.0 ± 0.0800.0 ± 0.0905.4 ± 8.7938.6 ± 5.1813.1 ± 3.6817.3 ± 8.4
Spirotetramat7629.7 ± 5.28418.5 ± 5.0840.0 ± 0.09636.8 ± 4.87512.6 ± 1.28215.8 ± 8.28020.0 ± 5.8829.7 ± 0.3
a % Mortality stands for the % mortality at the field recommended dose.
Table 8. Toxicity to etoxazole in susceptible and field-collected populations of T. urticae eggs.
Table 8. Toxicity to etoxazole in susceptible and field-collected populations of T. urticae eggs.
Populationsn%Mortality aLC50 (ppm a.i.)
(95% CL b)
Slope ± SERR c
S1780100.00.02 (0.02–0.03)1.95 ± 0.161.0
CJ164733.9>500->25,500
GH-14790.0>500->25,500
GH-290419.6>500->25,500
GM-116870.0>500->25,500
GM-23690.0>500->25,500
OC11530.0>500->25,500
PT3392.1>500->25,500
YI11273.0>500->25,500
a % Mortality stands for the % mortality at field recommended dose. b Confidence limits. c RR represents resistance ratio = LC50 of resistant strain/LC50 of susceptible strain.
Table 9. Toxicity to pyridaben in susceptible and field-collected populations of T. urticae eggs.
Table 9. Toxicity to pyridaben in susceptible and field-collected populations of T. urticae eggs.
Populationsn%Mortality aLC50 (ppm a.i.) (95% CL b)Slope ± SERR c
S462100.00.73 (0.31–1.48)0.91 ± 0.101.0
CJ224363.5103.26 (76.59–150.66)1.32 ± 0.12144.5
GH-114492.7>4000->5480
GH-218190.0>4000->5480
GM-18870.4>4000->5480
GM-27782.1>4000->5480
OC22271.3>4000->5480
PT10732.1>4000->5480
YI153329.7>4000->5480
a % Mortality stands for the % mortality at field recommended dose. b Confidence limits. c RR represents resistance ratio = LC50 of resistant strain/LC50 of susceptible strain.
Table 10. Genotypes of point mutations in the CHS1 and PSST genes of T. urticae.
Table 10. Genotypes of point mutations in the CHS1 and PSST genes of T. urticae.
PopulationnPredominant
Genotype
CHS1 Genotypes (%)Predominant
Genotype
PSST Genotypes (%)
I1017FH92R
IFHR
S200I100.00.0H89.011.0
ER200F0.0100.0H71.029.0
PR200I98.02.0R3.097.0
CJ200F28.072.0H70.030.0
GH-1200F9.091.0R13.087.0
GH-2200F3.097.0R6.094.0
GM-1200F1.099.0R8.092.0
GM-2200F11.089.0R7.093.0
OC200F20.080.0H/R63.037.0
PT200F3.097.0R9.091.0
YI200F15.085.0H/R55.045.0
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Koo, H.-N.; Choi, J.; Shin, E.; Kang, W.; Cho, S.-R.; Kim, H.; Park, B.; Kim, G.-H. Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae). Insects 2021, 12, 660. https://doi.org/10.3390/insects12070660

AMA Style

Koo H-N, Choi J, Shin E, Kang W, Cho S-R, Kim H, Park B, Kim G-H. Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae). Insects. 2021; 12(7):660. https://doi.org/10.3390/insects12070660

Chicago/Turabian Style

Koo, Hyun-Na, Jihye Choi, Eungyeong Shin, Wonjin Kang, Sun-Ran Cho, Hyunkyung Kim, Bueyong Park, and Gil-Hah Kim. 2021. "Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae)" Insects 12, no. 7: 660. https://doi.org/10.3390/insects12070660

APA Style

Koo, H.-N., Choi, J., Shin, E., Kang, W., Cho, S.-R., Kim, H., Park, B., & Kim, G.-H. (2021). Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae). Insects, 12(7), 660. https://doi.org/10.3390/insects12070660

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop