Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Mites
2.2. Acaricides
2.3. Laboratory Toxicology Assays
2.3.1. Eggs
2.3.2. Adult Females
2.4. General Sequencing and Pyrosequencing of CHS1 and PSST in T. urticae
2.5. Data Analysis
3. Results
3.1. Resistance Ratios (RRs) to Etoxazole and Pyridaben
3.2. Cross-Resistance to 10 Acaricides in the S, ER, and PR Strains
3.3. Acaricide Susceptibility of 8 Field-Collected Populations
3.4. Genotypes of Point Mutations (I1017F and H92R)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Bolland, H.R.; Gutierrez, J.; Flechtmann, C.H.W. World Catalogue of the Spider Mite Family (Acari: Tetranychidae); Koninklijke Brill: Leiden, The Netherlands, 1998. [Google Scholar]
- Choi, K.M.; Ahn, S.B.; Lee, S.W.; Lee, M.H. Compendium of Insect Pests of Fruit Trees with Color Plates; Agricultural Sciences Institute, Rural Development Administration: Suwon, Korea, 1989. [Google Scholar]
- Ilias, A.; Vontas, J.; Tsagkarakou, A. Global distribution and origin of target site insecticide resistance mutations in Tetranychus urticae. Insect Biochem. Mol. Biol. 2014, 48, 17–28. [Google Scholar] [CrossRef] [Scilit]
- Ilias, A.; Vassiliou, V.A.; Vontas, J.; Tsagkarakou, A. Molecular diagnostics for detecting pyrethroid and abamectin resistance mutations in Tetranychus urticae. Pestic. Biochem. Physiol. 2017, 135, 9–14. [Google Scholar] [CrossRef] [Scilit]
- Van Leeuwen, T.; Vontas, J.; Tsagkarakou, A.; Tirry, L. Mechanisms of acaricide resistance in the two-spotted spider mite Tetranychus urticae. In Biorational Control of Arthropod Pests: Application and Resistance Management; Ishaaya, I., Horowitz, A.R., Eds.; Springer: Dordrecht, The Netherlands, 2009; pp. 347–393. [Google Scholar]
- Van Leeuwen, T.; Vontas, J.; Tsagkarakou, A.; Dermauw, W.; Tirry, L. Acaricide resistance mechanisms in the two-spotted spider mite Tetranychus urticae and other important Acari: A review. Insect Biochem. Mol. Biol. 2010, 40, 563–572. [Google Scholar] [CrossRef] [Scilit]
- Herron, G.A.; Woolley, L.K.; Langfield, K.L.; Chen, Y. First detection of etoxazole resistance in Australian two-spotted mite Tetranychus urticae Koch (Acarina: Tetranychidae) via bioassay and DNA methods. Austral Entomol. 2018, 57, 365–368. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.S.; Song, M.H.; Ahn, K.S.; Lee, K.Y.; Kim, J.W.; Kim, G.H. Monitoring of acaricide resistance in two-spotted spider mite (Tetranychus urticae) populations from rose greenhouses in Korea. J. Asia-Pac. Entomol. 2003, 6, 91–96. [Google Scholar] [CrossRef] [Scilit]
- Monteiro, V.B.; Gondim, M.G.C.; Oliveira, J.E.M.; Siqueira, H.A.A.; Sousa, J.M. Monitoring Tetranychus urticae Koch (Acari: Tetranychidae) resistance to abamectin in vineyards in the Lower Middle São Francisco Valley. Crop Prot. 2015, 69, 90–96. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; He, Y.; Zhang, Y.; Xie, W.; Wu, Q.; Wang, S. Status of pesticide resistance and associated mutations in the two-spotted spider mite, Tetranychus urticae, in China. Pestic. Biochem. Physiol. 2018, 150, 89–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dekeyser, M.A. Acaricide mode of action. Pest Manag. Sci. 2005, 61, 103–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, J.; Ishida, T.; Toda, K.; Ikeda, T.; Tsukidate, Y.; Kikuchi, Y.; Ito, Y. Preparation of 2,4-diphenyloxazolines and—thia-zolines as ovicidal insecticides and acaricides. Eur. Pat. EP 1989, 345, 775. [Google Scholar]
- Suzuki, J.; Ishida, T.; Kikuchi, Y.; Ito, Y.; Morikawa, C.; Tsukidate, Y.; Tanji, I.; Ota, Y.; Toda, K. Synthesis and activity of novel acaricidal/insecticidal 2, 4-diphenyl-1, 3-oxazolines. J. Pestic. Sci. 2002, 27, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Van Leeuwen, T.; Demaeght, P.; Osborne, E.J.; Dermauw, W.; Gohlke, S.; Nauen, R.; Grbic, M.; Tirry, L.; Merzendorfer, H.; Clark, R.M. Population bulk segregant mapping uncovers resistance mutations and the mode of action of a chitin synthesis inhibitor in arthropods. Proc. Natl. Acad. Sci. USA 2012, 109, 4407–4412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, M.; Kobayashi, S.; Nishimori, T. Occurrence of etoxazole resistance individuals of the two-spotted spider mite, Tetranychus urticae Koch from a limited region. Jpn. J. Appl. Entomol. Zool. 2001, 45, 83–88. [Google Scholar] [CrossRef] [Scilit]
- Demaeght, P.; Osborne, E.J.; Odman-Naresh, J.; Grbić, M.; Nauen, R.; Merzendorfer, H.; Clark, R.M.; Van Leeuwen, T. High resolution genetic mapping uncovers chitin synthase-1 as the target-site of the structurally diverse mite growth inhibitors clofentezine, hexythiazox and etoxazole in Tetranychus urticae. Insect Biochem. Mol. Biol. 2014, 51, 52–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osakabe, M.; Imamura, T.; Nakano, R.; Kamikawa, S.; Tadatsu, M.; Kunimoto, Y.; Doi, M. Combination of restriction endonuclease digestion with the ΔΔCt method in real-time PCR to monitor etoxazole resistance allele frequency in the two-spotted spider mite. Pestic. Biochem. Physiol. 2017, 139, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tirello, P.; Pozzebon, A.; Cassanelli, S.; Van Leeuwen, T.; Duso, C. Resistance to acaricides in Italian strains of Tetranychus urticae: Toxicological and enzymatic assays. Exp. Appl. Acarol. 2012, 57, 53–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hollingworth, R.M.; Ahammadsahib, K.I.; Gadelhak, G.; McLaughlin, J.L. New inhibitors of Complex I of the mitochondrial electron transport chain with activity as pesticides. Biochem. Soc. Trans. 1994, 22, 230–233. [Google Scholar] [CrossRef] [Scilit]
- Stumpf, N.; Nauen, R. Cross-resistance, inheritance, and biochemistry of mitochondrial electron transport inhibitor-acaricide resistance in Tetranychus urticae (Acari: Tetranychidae). J. Econ. Entomol. 2001, 94, 1577–1583. [Google Scholar] [CrossRef] [Scilit]
- Hirata, K.; Kawamura, Y.; Kudo, M.; Igarashi, H. Development of a new acaricide, pyridaben. J. Pestic. Sci. 1995, 20, 213–221. [Google Scholar] [CrossRef] [Scilit]
- Devine, G.J.; Barber, M.; Denholm, I. Incidence and inheritance of resistance to METI-acaricides in European strains of the two-spotted spider mite (Tetranychus urticae) (Acari: Tetranychidae). Pest Manag. Sci. 2001, 57, 443–448. [Google Scholar] [CrossRef] [Scilit]
- Nauen, R.; Stumpf, N.; Elbert, A.; Zebitz, C.P.W.; Kraus, W. Acaricide toxicity and resistance in larvae of different strains of Tetranychus urticae and Panonychus ulmi (Acari: Tetranychidae). Pest Manag. Sci. 2001, 57, 253–261. [Google Scholar] [CrossRef] [Scilit]
- Khajehali, J.; Van Nieuwenhuyse, P.; Demaeght, P.; Tirry, L.; Van Leeuwen, T. Acaricide resistance and resistance mechanisms in Tetranychus urticae populations from rose greenhouses in the Netherlands. Pest Manag. Sci. 2011, 67, 1424–1433. [Google Scholar] [CrossRef] [Scilit]
- Sparks, T.C.; Nauen, R. IRAC: Mode of action classification and insecticide resistance management. Pestic. Biochem. Physiol. 2015, 121, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Van Leeuwen, T.; Dermauw, W.; Grbic, M.; Tirry, L.; Feyereisen, R. Spider mite control and resistance management: Does a genome help? Pest Manag. Sci. 2013, 69, 156–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bajda, S.; Dermauw, W.; Panteleri, R.; Sugimoto, N.; Douris, V.; Tirry, L.; Osakabe, M.; Vontas, J.; Van Leeuwen, T. A mutation in the PSST homologue of complex I (NADH: Ubiquinone oxidoreductase) from Tetranychus urticae is associated with resistance to METI acaricides. Insect Biochem. Mol. Biol. 2017, 80, 79–90. [Google Scholar] [CrossRef] [Scilit]
- SAS Institute. SAS/STAT User’s Guide: Statistics, Version 9.1; SAS Institute: Cary, NC, USA, 2010. [Google Scholar]
- Choi, J.; Koo, H.N.; Kim, S.I.; Park, B.; Kim, H.; Kim, G.H. Target-site mutations and glutathione S-transferases are associated with acequinocyl and pyridaben resistance in the two-spotted spider mite Tetranychus urticae (Acari: Tetranychidae). Insects 2020, 11, 511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.Y.; Ahn, K.S.; Kim, C.S.; Shin, S.C.; Kim, G.H. Inheritance and stability of etoxazole resistance in twospotted spider mite. Tetranychus urticae, and its cross resistance. Korean J. Appl. Entomol. 2004, 43, 43–48. [Google Scholar]
- Fotoukkiaii, S.M.; Mermans, C.; Wybouw, N.; Van Leeuwen, T. Resistance risk assessment of the novel Complex II inhibitor pyflubumide in the polyphagous pest Tetranychus urticae. J. Pest Sci. 2020, 93, 1085–1096. [Google Scholar] [CrossRef] [Scilit]
- Ochiai, N.; Mizuno, M.; Mimori, N.; Miyake, T.; Dekeyser, M.; Canlas, L.J.; Takeda, M. Toxicity of bifenazate and its principal active metabolite, diazene, to Tetranychus urticae and Panonychus citri and their relative toxicity to the predaceous mites, Phytoseiulus persimilis and Neoseiulus californicus. Exp. Appl. Acarol. 2007, 43, 181–197. [Google Scholar] [CrossRef] [Scilit]
- Feng, K.; Ou, S.; Zhang, P.; Wen, X.; Shi, L.; Yang, Y.; Hu, Y.; Zhang, Y.; Shen, G.; Xu, Z.; et al. The cytochrome P450 CYP389C16 contributes to the cross-resistance between cyflumetofen and pyridaben in Tetranychus cinnabarinus (Boisduval). Pest Manag. Sci. 2019, 76, 665–675. [Google Scholar] [CrossRef] [Scilit]
- Salman, S.Y.; Aydınlı, F.; Ay, R. Etoxazole resistance in predatory mite Phytoseiulus persimilis A.-H. (Acari: Phytoseiidae): Cross-resistance, inheritance and biochemical resistance mechanisms. Pestic. Biochem. Physiol. 2015, 122, 96–102. [Google Scholar] [CrossRef] [Scilit]
- Ioriatti, C.; Anfora, G.; Angeli, G.; Mazzoni, V.; Trona, F. Effects of chlorantraniliprole on eggs and larvae of Lobesia botrana (Denis & Schiffermüller) (Lepidoptera: Tortricidae). Pest Manag. Sci. 2009, 65, 717–722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ouyang, Y.; Montez, G.H.; Liu, L.; Grafton-Cardwell, E.E. Spirodiclofen and spirotetramat bioassays for monitoring resistance in citrus red mite, Panonychus citri (Acari: Tetranychidae). Pest Manag. Sci. 2012, 68, 781–787. [Google Scholar] [CrossRef] [Scilit]
- Khalighi, M.; Tirry, L.; Van Leeuwen, T. Cross-resistance risk of the novel complex II inhibitors cyenopyrafen and cyflumetofen in resistant strains of the two-spotted spider mite Tetranychus urticae. Pest Manag. Sci. 2014, 70, 365–368. [Google Scholar] [CrossRef] [Scilit]
- Insecticide Resistance Action Committee (IRAC). Available online: http://www.irac-online.org/modes-of-action/ (accessed on 5 October 2020).
- Fotoukkiaii, S.M.; Wybouw, N.; Kurlovs, A.H.; Tsakireli, D.; Pergantis, S.A.; Clark, R.M.; Vontas, J.; Van Leeuven, T. High-resolution genetic mapping reveals cis-regulatory and copy number variation in loci associated with cytochrome P450-mediated detoxification in a generalist arthropod pest. PLoS Genet. 2021, 17, e1009422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nauen, R. Spirodiclofen: Mode of action and resistance risk assessment in tetranychid pest mites. J. Pestic. Sci. 2005, 30, 272–274. [Google Scholar] [CrossRef] [Scilit]
- Marcic, D.; Mutavdzic, S.; Medjo, I.; Prijovic, M.; Peric, L. Spirotetramat toxicity to immatures and sublethal effects on fecundity of female adults of Tetranychus urticae Koch. Zoosymposia 2011, 6, 99–103. [Google Scholar] [CrossRef] [Scilit]
- Cho, J.R.; Kim, Y.J.; Ahn, Y.J.; Yoo, J.K.; Lee, J.O. Monitoring of acaricide resistance in field-collected populations of Tetranychus urticae (Acari: Tetranychidae) in Korea. Korean J. Appl. Entomol. 1995, 34, 40–45. [Google Scholar]
- Sugimoto, N.; Osakabe, M. Cross-resistance between cyenopyrafen and pyridaben in the twospotted spider mite Tetranychus urticae (Acari: Tetranychidae). Pest Manag. Sci. 2014, 70, 1090–1096. [Google Scholar] [CrossRef] [Scilit]
| Populations | Date Collected | Region | Host | Collection Locations (South Korea) | |
|---|---|---|---|---|---|
| Lab-selected | Etoxazole resistant (ER) | Aug 2000 | Buyeo | Rose | ![]() |
| Pyridaben resistant (PR) | Feb 2003 | Uiseong | Rose | ||
| Field-collected | Cheongju (CJ) | Mar 2020 | Cheongju | Melon | |
| Gimhae-1 (GH-1) | Aug 2019 | Gimhae | Rose | ||
| Gimhae-2 (GH-2) | Aug 2019 | Gimhae | Rose | ||
| Gumi-1 (GM-1) | Aug 2019 | Gumi | Rose | ||
| Gumi-2 (GM-2) | Aug 2019 | Gumi | Rose | ||
| Okcheon (OC) | Feb 2020 | Okcheon | Rose | ||
| Peongtaek (PT) | Mar 2020 | Pyeongtaek | Rose | ||
| Yongin (YI) | Oct 2019 | Yongin | Strawberry | ||
| Reaction | Target | Name | Sequence |
|---|---|---|---|
| General sequencing | CHS1 | Demaeght-F | AGATCCTTTACGTCTGGGGC |
| Demaeght-R | CAATTGGGACTCGTTTCTTTTCA | ||
| PSST | PSST-F | ACAGGTCAGCCAATCGAATC | |
| PSST-R | ATACCAAGCCTGAGCAGTGG | ||
| Pyrosequencing | CHS1 | CHS-F | GTCTTTTGTAGTGGCGGCATT |
| CHS-R | TCCCCAAGTAACAACGTTCAAGT | ||
| PSST | PSST-F | TGACTTTTGGATTAGCCTGTTGTG | |
| PSST-R | AGGACTTGCTCTGAATAACATACCA |
| Acaricide | Stage | Strain | n | LC50 (ppm) (95% CL a) | Slope ± SE | RR b |
|---|---|---|---|---|---|---|
| Etoxazole | S | 1780 | 0.02 (0.02–0.03) | 1.95 ± 0.16 | 1 | |
| Egg | ER | 1075 | >100,000 | - | >5,000,000 | |
| PR | 1846 | 0.19 (0.04–0.67) | 2.36 ± 0.45 | 9.5 | ||
| S | 266 | >100,000 | - | No effect | ||
| Adult | ER | 107 | >100,000 | - | - | |
| PR | 93 | >100,000 | - | - | ||
| Pyridaben | S c | 462 | 0.73 (0.31–1.48) | 0.91 ± 0.10 | 1.0 | |
| Egg | ER | 1826 | 2.65 (1.27–4.16) | 0.61 ± 0.10 | 3.6 | |
| PR c | 619 | >3000 | - | >4109.6 | ||
| S | 90 | >400 | Not measurable | |||
| Adult | ER | 90 | >400 | - | ||
| PR | 98 | >400 | - |
| Acaricide | Strain | n | LC50 (ppm) (95% CL a) | Slope ± SE | RR b |
|---|---|---|---|---|---|
| Abamectin | S | 720 | 0.87 (0.34–2.82) | 1.72 ± 0.24 | 1.0 |
| ER | 496 | 9.24 (8.71–15.62) | 1.64 ± 0.25 | 10.6 | |
| PR | 642 | 8.52 (5.64–11.84) | 1.34 ± 0.38 | 9.8 | |
| Acequinocyl | S | 1230 | 8.02 (6.91–9.53) | 2.14 ± 0.19 | 1.0 |
| ER | 1719 | 12.59 (4.92–37.54) | 1.94 ± 0.51 | 1.6 | |
| PR c | 881 | 1.47 (0.53–3.10) | 1.42 ± 0.21 | 0.2 | |
| Bifenazate | S | 1780 | 65.21 (23.60–136.91) | 0.45 ± 0.11 | 1.0 |
| ER | 2391 | >700 | - | >10.7 | |
| PR | 378 | >700 | - | >10.7 | |
| Cyenopyrafen | S | 496 | 1.68 (0.87–2.63) | 2.65 ± 0.47 | 1.0 |
| ER | 2306 | 33.85 (20.23–45.74) | 1.73 ± 0.26 | 20.2 | |
| PR | 1024 | 1.32 (0.85–2.54) | 1.35 ± 0.28 | 1.3 | |
| Cyflumetofen | S | 732 | 0.79 (0.29–0.99) | 1.83 ± 0.31 | 1.0 |
| ER | 988 | >300 | - | >379.7 | |
| PR | 865 | 4.57 (1.38–10.32) | 1.56 ± 0.19 | 5.8 | |
| Fluxametamide | S | 962 | 4.62 (1.46–14.73) | 1.24 ± 0.22 | 1.0 |
| ER | 477 | 48.32 (39.12–56.25) | 1.56 ± 0.33 | 10.5 | |
| PR | 884 | 52.64 (27.86–79.19) | 2.88 ± 0.37 | 11.4 | |
| Pyflubumide | S | 517 | 0.08 (0.01–0.25) | 1.23 ± 0.16 | 1.0 |
| ER | 727 | 54.62 (40.07–86.89) | 0.94 ± 0.19 | 682.8 | |
| PR | 875 | 4.33 (2.21–12.36) | 1.95 ± 0.14 | 54.1 | |
| Spirodiclofen | S | 857 | 18.23 (12.78–21.38) | 1.56 ± 0.28 | 1.0 |
| ER | 1549 | 18.02 (12.87–24.33) | 2.31 ± 0.13 | 1.0 | |
| PR | 984 | 19.32 (12.64–32.54) | 1.35 ± 1.25 | 1.1 | |
| Spiromesifen | S | 909 | 0.74 (0.38–1.79) | 1.85 ± 0.37 | 1.0 |
| ER | 698 | 0.33 (0.25–0.43) | 1.71 ± 0.16 | 0.4 | |
| PR | 921 | 0.94 (0.31–2.54) | 1.34 ± 0.25 | 1.3 | |
| Spirotetramat | S | 873 | 0.31 (0.08–0.40) | 1.22 ± 0.24 | 1.0 |
| ER | 1733 | >500 | - | >1612.9 | |
| PR | 932 | >500 | - | >1612.9 |
| Acaricide | Strain | n | LC50 (ppm) (95% CL a) | Slope ± SE | RR b |
|---|---|---|---|---|---|
| Abamectin | S | 134 | 0.21 (0.08–0.82) | 1.27 ± 0.18 | 1.0 |
| ER | 192 | 0.10 (0.09–0.12) | 1.02 ± 0.15 | 0.5 | |
| PR | 245 | 0.23 (0.01–0.75) | 1.84 ± 0.32 | 1.1 | |
| Acequinocyl | S c | 225 | 2.78 (1.48–6.58) | 0.51 ± 0.07 | 1.0 |
| ER | 545 | 20.38 (17.31–23.87) | 1.72 ± 0.14 | 7.3 | |
| PR c | 225 | 13.41 (10.06–21.94) | 0.92 ± 0.10 | 4.8 | |
| Bifenazate | S | 359 | 5.08 (2.84–10.90) | 1.37 ± 0.23 | 1.0 |
| ER | 363 | 23.39 (19.44–28.70) | 1.19 ± 0.10 | 4.6 | |
| PR | 256 | 4.76 (2.62–8.29) | 1.25 ± 0.33 | 0.9 | |
| Cyenopyrafen | S | 182 | 1.32 (0.54–4.72) | 1.37 ± 0.18 | 1.0 |
| ER | 208 | 70.61 (54.39–93.28) | 1.02 ± 0.13 | 53.5 | |
| PR | 243 | 6.51 (3.01–17.86) | 1.31 ± 0.12 | 4.9 | |
| Cyflumetofen | S | 68 | 0.58 (0.29–0.99) | 1.83 ± 0.31 | 1.0 |
| ER | 212 | >1000 | - | >1724.1 | |
| PR | 135 | 23.54 (14.81–25.66) | 1.35 ± 0.10 | 40.6 | |
| Fluxametamide | S | 362 | 2.26 (1.66–3.09) | 2.54 ± 0.32 | 1.0 |
| ER | 121 | 1.96 (1.42–5.07) | 1.68 ± 0.23 | 0.9 | |
| PR | 253 | 2.12 (1.73–4.62) | 1.26 ± 0.33 | 0.9 | |
| Pyflubumide | S | 180 | 2.75 (1.32–5.31) | 1.27 ± 0.14 | 1.0 |
| ER | 181 | >2000 | - | >727.3 | |
| PR | 183 | 0.72 (0.34–0.62) | 1.16 ± 0.15 | 0.3 | |
| Spirodiclofen | S | 67 | >1800 | - | No effect |
| ER | 167 | >1800 | - | - | |
| PR | 108 | >1800 | - | - | |
| Spiromesifen | S | 75 | >1000 | - | No effect |
| ER | 131 | >1000 | - | - | |
| PR | 109 | >1000 | - | - | |
| Spirotetramat | S | 332 | 32.62 (21.81–57.43) | 1.95 ± 0.31 | 1.0 |
| ER | 221 | 354.01 (69.44–3345) | 0.17 ± 0.06 | 10.9 | |
| PR | 192 | 262.13 (142.54–1283) | 0.67 ± 0.11 | 8.0 |
| Acaricide | % Mortality a (mean ± SE) | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| n | CJ | n | GH-1 | n | GH-2 | n | GM-1 | n | GM-2 | n | OC | n | PT | n | YI | |
| Abamectin | 124 | 3.4 ± 3.2 | 135 | 3.1 ± 3.0 | 111 | 3.8 ± 2.5 | 82 | 13.0 ± 2.2 | 82 | 12.5 ± 5.3 | 314 | 11.2 ± 0.1 | 97 | 15.1 ± 8.4 | 219 | 15.7 ± 1.6 |
| Acequinocyl | 86 | 17.1 ± 3.1 | 94 | 9.2 ± 1.5 | 80 | 20.0 ± 5.2 | 101 | 15.7 ± 3.0 | 103 | 11.5 ± 6.0 | 287 | 12.3 ± 6.2 | 79 | 12.9 ± 5.5 | 233 | 18.2 ± 2.2 |
| Bifenazate | 108 | 5.0 ± 6.3 | 93 | 15.7 ± 5.7 | 77 | 16.5 ± 8.4 | 78 | 19.5 ± 4.1 | 76 | 14.9 ± 7.3 | 197 | 12.3 ± 3.3 | 105 | 21.6 ± 8.7 | 216 | 14.7 ± 6.7 |
| Cyenopyrafen | 97 | 17.7 ± 6.2 | 129 | 7.0 ± 1.3 | 76 | 11.7 ± 1.3 | 111 | 12.6 ± 2.1 | 102 | 11.0 ± 3.7 | 372 | 1.4 ± 2.4 | 111 | 9.2 ± 2.5 | 80 | 3.7 ± 2.8 |
| Cyflumetofen | 177 | 11.9 ± 3.0 | 104 | 3.8 ± 0.7 | 86 | 9.3 ± 0.9 | 83 | 8.5 ± 2.5 | 113 | 7.6 ± 4.7 | 481 | 2.8 ± 2.1 | 96 | 3.3 ± 2.6 | 79 | 8.6 ± 4.4 |
| Etoxazole | 330 | 33.9 ± 4.0 | 126 | 0.0 ± 0.0 | 164 | 16.9 ± 6.1 | 320 | 0.0 ± 0.0 | 114 | 0.0 ± 0.0 | 262 | 0.0 ± 0.0 | 149 | 2.1 ± 2.2 | 463 | 3.0 ± 2.8 |
| Fluxametamide | 339 | 60.2 ± 3.9 | 172 | 16.5 ± 7.7 | 106 | 23.5 ± 4.9 | 128 | 48.2 ± 6.1 | 103 | 47.6 ± 5.2 | 405 | 41.4 ± 1.1 | 149 | 2.1 ± 2.2 | 80 | 24.0 ± 5.8 |
| Pyflubumide | 149 | 22.6 ± 4.9 | 109 | 6.5 ± 1.0 | 357 | 11.2 ± 1.6 | 94 | 12.3 ± 2.5 | 90 | 9.4 ± 3.2 | 457 | 3.6 ± 2.3 | 110 | 4.7 ± 1.9 | 113 | 6.4 ± 4.13 |
| Pyridaben | 308 | 63.5 ± 3.4 | 269 | 2.7 ± 2.2 | 431 | 0.0 ± 0.0 | 268 | 0.4 ± 0.8 | 285 | 2.1 ± 0.9 | 220 | 1.3 ± 1.3 | 323 | 2.1 ± 0.7 | 401 | 29.7 ± 10.2 |
| Spirodiclofen | 232 | 100.0 ± 0.0 | 94 | 82.7 ± 3.6 | 278 | 84.5 ± 5.7 | 101 | 91.1 ± 1.6 | 76 | 89.1 ± 5.1 | 462 | 85.0 ± 3.6 | 93 | 77.5 ± 4.3 | 102 | 100.0 ± 0.0 |
| Spiromesifen | 254 | 98.8 ± 0.1 | 116 | 82.8 ± 1.4 | 82 | 82.5 ± 1.7 | 94 | 95.8 ± 0.3 | 109 | 95.5 ± 2.1 | 467 | 94.8 ± 2.2 | 116 | 89.8 ± 5.2 | 94 | 89.8 ± 5.0 |
| Spirotetramat | 113 | 18.5 ± 6.2 | 153 | 7.9 ± 0.2 | 72 | 10.4 ± 1.0 | 114 | 13.9 ± 5.0 | 89 | 25.7 ± 3.7 | 314 | 0.0 ± 0.0 | 104 | 18.6 ± 2.5 | 127 | 0.0 ± 0.0 |
| Acaricide | % Mortality a (mean ± SE) | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| n | CJ | n | GH-1 | n | GH-2 | n | GM-1 | n | GM-2 | n | OC | n | PT | n | YI | |
| Abamectin | 75 | 90.8 ± 2.0 | 81 | 16.5 ± 4.5 | 80 | 10.0 ± 5.8 | 84 | 13.7 ± 3.0 | 67 | 12.5 ± 3.0 | 80 | 13.3 ± 3.3 | 83 | 11.8 ± 2.6 | 80 | 24.7 ± 4.4 |
| Acequinocyl | 86 | 100.0 ± 0.0 | 65 | 6.4 ± 3.6 | 84 | 14.6 ± 7.9 | 98 | 2.6 ± 2.6 | 80 | 20.0 ± 5.1 | 96 | 10.7 ± 3.0 | 67 | 27.7 ± 1.4 | 92 | 50.0 ± 4.8 |
| Bifenazate | 76 | 73.3 ± 8.2 | 81 | 22.7 ± 3.7 | 78 | 19.9 ± 3.9 | 92 | 11.1 ± 2.8 | 81 | 23.0 ± 2.0 | 90 | 65.9 ± 6.5 | 80 | 6.7 ± 3.3 | 86 | 51.5 ± 3.0 |
| Cyenopyrafen | 76 | 78.5 ± 5.5 | 80 | 13.3 ± 3.3 | 86 | 9.1 ± 5.3 | 92 | 13.9 ± 2.8 | 80 | 11.7 ± 3.3 | 78 | 14.1 ± 7.1 | 88 | 13.9 ± 7.4 | 90 | 0.0 ± 0.0 |
| Cyflumetofen | 85 | 30.5 ± 4.4 | 86 | 38.7 ± 4.7 | 92 | 0.0 ± 0.0 | 86 | 11.9 ± 2.4 | 73 | 20.3 ± 5.9 | 82 | 18.7 ± 4.1 | 84 | 6.1 ± 6.1 | 80 | 10.0 ± 5.8 |
| Etoxazole | 75 | 0.2 ± 2.2 | 76 | 0.0 ± 0.0 | 75 | 0.0 ± 0.0 | 75 | 0.0 ± 0.0 | 70 | 0.0 ± 0.0 | 85 | 1.3 ± 3.9 | 64 | 0.0 ± 0.0 | 62 | 0.0 ± 0.0 |
| Fluxametamide | 81 | 94.3 ± 1.5 | 82 | 41.7 ± 4.8 | 70 | 52.4 ± 4.0 | 72 | 47.6 ± 2.4 | 71 | 43.1 ± 2.1 | 68 | 94.4 ± 5.6 | 98 | 25.6 ± 7.8 | 79 | 54.7 ± 1.6 |
| Pyflubumide | 82 | 13.0 ± 4.4 | 80 | 16.7 ± 4.8 | 86 | 0.0 ± 0.0 | 88 | 17.8 ± 4.9 | 74 | 5.4 ± 3.4 | 80 | 0.0 ± 0.0 | 82 | 6.7 ± 6.7 | 78 | 3.3 ± 3.3 |
| Pyridaben | 70 | 2.7 ± 2.7 | 75 | 2.6 ± 2.3 | 60 | 1.0 ± 3.3 | 63 | 2.3 ± 2.9 | 72 | 6.4 ± 3.2 | 68 | 3.5 ± 3.1 | 67 | 16.0 ± 4.3 | 67 | 5.3 ± 1.9 |
| Spirodiclofen | 86 | 2.1 ± 3.5 | 0 | 0.0 ± 0.0 | 88 | 5.4 ± 8.9 | 76 | 0.0 ± 0.0 | 80 | 8.3 ± 9.2 | 80 | 10.2 ± 7.1 | 83 | 6.3 ± 3.3 | 81 | 9.5 ± 6.9 |
| Spiromesifen | 83 | 3.5 ± 5.3 | 81 | 3.1 ± 1.6 | 80 | 0.0 ± 0.0 | 80 | 0.0 ± 0.0 | 90 | 5.4 ± 8.7 | 93 | 8.6 ± 5.1 | 81 | 3.1 ± 3.6 | 81 | 7.3 ± 8.4 |
| Spirotetramat | 76 | 29.7 ± 5.2 | 84 | 18.5 ± 5.0 | 84 | 0.0 ± 0.0 | 96 | 36.8 ± 4.8 | 75 | 12.6 ± 1.2 | 82 | 15.8 ± 8.2 | 80 | 20.0 ± 5.8 | 82 | 9.7 ± 0.3 |
| Populations | n | %Mortality a | LC50 (ppm a.i.) (95% CL b) | Slope ± SE | RR c |
|---|---|---|---|---|---|
| S | 1780 | 100.0 | 0.02 (0.02–0.03) | 1.95 ± 0.16 | 1.0 |
| CJ | 1647 | 33.9 | >500 | - | >25,500 |
| GH-1 | 479 | 0.0 | >500 | - | >25,500 |
| GH-2 | 904 | 19.6 | >500 | - | >25,500 |
| GM-1 | 1687 | 0.0 | >500 | - | >25,500 |
| GM-2 | 369 | 0.0 | >500 | - | >25,500 |
| OC | 1153 | 0.0 | >500 | - | >25,500 |
| PT | 339 | 2.1 | >500 | - | >25,500 |
| YI | 1127 | 3.0 | >500 | - | >25,500 |
| Populations | n | %Mortality a | LC50 (ppm a.i.) (95% CL b) | Slope ± SE | RR c |
|---|---|---|---|---|---|
| S | 462 | 100.0 | 0.73 (0.31–1.48) | 0.91 ± 0.10 | 1.0 |
| CJ | 2243 | 63.5 | 103.26 (76.59–150.66) | 1.32 ± 0.12 | 144.5 |
| GH-1 | 1449 | 2.7 | >4000 | - | >5480 |
| GH-2 | 1819 | 0.0 | >4000 | - | >5480 |
| GM-1 | 887 | 0.4 | >4000 | - | >5480 |
| GM-2 | 778 | 2.1 | >4000 | - | >5480 |
| OC | 2227 | 1.3 | >4000 | - | >5480 |
| PT | 1073 | 2.1 | >4000 | - | >5480 |
| YI | 1533 | 29.7 | >4000 | - | >5480 |
| Population | n | Predominant Genotype | CHS1 Genotypes (%) | Predominant Genotype | PSST Genotypes (%) | ||
|---|---|---|---|---|---|---|---|
| I1017F | H92R | ||||||
| I | F | H | R | ||||
| S | 200 | I | 100.0 | 0.0 | H | 89.0 | 11.0 |
| ER | 200 | F | 0.0 | 100.0 | H | 71.0 | 29.0 |
| PR | 200 | I | 98.0 | 2.0 | R | 3.0 | 97.0 |
| CJ | 200 | F | 28.0 | 72.0 | H | 70.0 | 30.0 |
| GH-1 | 200 | F | 9.0 | 91.0 | R | 13.0 | 87.0 |
| GH-2 | 200 | F | 3.0 | 97.0 | R | 6.0 | 94.0 |
| GM-1 | 200 | F | 1.0 | 99.0 | R | 8.0 | 92.0 |
| GM-2 | 200 | F | 11.0 | 89.0 | R | 7.0 | 93.0 |
| OC | 200 | F | 20.0 | 80.0 | H/R | 63.0 | 37.0 |
| PT | 200 | F | 3.0 | 97.0 | R | 9.0 | 91.0 |
| YI | 200 | F | 15.0 | 85.0 | H/R | 55.0 | 45.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koo, H.-N.; Choi, J.; Shin, E.; Kang, W.; Cho, S.-R.; Kim, H.; Park, B.; Kim, G.-H. Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae). Insects 2021, 12, 660. https://doi.org/10.3390/insects12070660
Koo H-N, Choi J, Shin E, Kang W, Cho S-R, Kim H, Park B, Kim G-H. Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae). Insects. 2021; 12(7):660. https://doi.org/10.3390/insects12070660
Chicago/Turabian StyleKoo, Hyun-Na, Jihye Choi, Eungyeong Shin, Wonjin Kang, Sun-Ran Cho, Hyunkyung Kim, Bueyong Park, and Gil-Hah Kim. 2021. "Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae)" Insects 12, no. 7: 660. https://doi.org/10.3390/insects12070660
APA StyleKoo, H.-N., Choi, J., Shin, E., Kang, W., Cho, S.-R., Kim, H., Park, B., & Kim, G.-H. (2021). Susceptibility to Acaricides and the Frequencies of Point Mutations in Etoxazole- and Pyridaben-Resistant Strains and Field Populations of the Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae). Insects, 12(7), 660. https://doi.org/10.3390/insects12070660


