Effects of Deformed Wing Virus Infection on Expressions of Immune- and Apoptosis-Related Genes in Western Honeybees (Apis mellifera)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Honeybee Samples
2.2. Bacterial Strains and Media
2.3. Preparation of DWV Lysate
2.4. In Vitro Challenge of Honeybee Pupae with Virus and Bacteria
2.5. RNA Extraction and cDNA Synthesis
2.6. Quantitative Real-Time PCR Parameters
2.7. Data Analyses
3. Results
3.1. DWV Lysate Type Strain
3.2. Survival of Honeybees from White-Eyed Pupae to Newly Emerged Adult Bees
3.3. Crippled Wings in Newly Emerged Adult Bees
3.4. Amount of DWV in Newly Emerged Adult Bees
3.5. Antimicrobial Peptides and Apoptosis-Related Genes in Newly Emerged Adult Bees
3.6. DWV Levels in Honeybee Pupae Post-Injection
3.7. Antimicrobial Peptides and Apoptosis-Related Genes in Honeybee Pupae
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Evans, J.D.; Spivak, M. Socialized medicine: Individual and communal disease barriers in honey bees. J. Invertebr. Pathol. 2010, 103, S62–S72. [Google Scholar] [CrossRef]
- Wilson-Rich, N.; Spivak, M.; Fefferman, N.H.; Starks, P.T. Genetic, individual, and group facilitation of disease resistance in insect societies. Annu. Rev. Entomol. 2008, 54, 405–423. [Google Scholar] [CrossRef] [Green Version]
- Simone-Finstrom, M. Social immunity and the superorganism: Behavioral defenses protecting honey bee colonies from pathogens and parasites. Bee World 2017, 94, 21–29. [Google Scholar] [CrossRef]
- Wilson-Rich, N.; Dres, S.T.; Starks, P.T. The ontogeny of immunity: Development of innate immune strength in the honey bee (Apis mellifera). J. Insect Physiol. 2008, 54, 1392–1399. [Google Scholar] [CrossRef] [PubMed]
- Brutscher, L.M.; Daughenbaugh, K.F.; Flenniken, M.L. Antiviral defense mechanisms in honey bees. Curr. Opin. Insect Sci. 2015, 10, 71–82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, S.J.; Highfield, A.C.; Brettell, L.; Villalobos, E.M.; Budge, G.E.; Powell, M.; Nikaido, S.; Schroeder, D.C. Global honey bee viral landscape altered by a parasitic mite. Science 2012, 336, 1304–1306. [Google Scholar] [CrossRef]
- Barroso-Arévalo, S.; Fernández-Carrión, E.; Goyache, J.; Molero, F.; Puerta, F.; Sánchez-Vizcaíno, J.M. High load of deformed wing virus and Varroa destructor infestation are related to weakness of honey bee colonies in Southern Spain. Front. Microbiol. 2019, 10, 1331. [Google Scholar] [CrossRef]
- Dainat, B.; Evans, J.D.; Chen, Y.P.; Gauthier, L.; Neumann, P. Dead or alive: Deformed wing virus and Varroa destructor reduce the life span of winter honeybees. Appl. Environ. Microbiol. 2012, 78, 981–987. [Google Scholar] [CrossRef] [Green Version]
- Francis, R.M.; Nielsen, S.L.; Kryger, P. Varroa-virus interaction in collapsing honey bee colonies. PLoS ONE 2013, 8, e57540. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Evans, J.; Feldlaufer, M. Horizontal and vertical transmission of viruses in the honey bee, Apis mellifera. J. Invertebr. Pathol. 2006, 92, 152–159. [Google Scholar] [CrossRef]
- Dainat, B.; Ken, T.; Berthoud, H.; Neumann, P. The ectoparasitic mite Tropilaelaps mercedesae (Acari, Laelapidae) as a vector of honeybee viruses. Insectes Sociaux 2009, 56, 40–43. [Google Scholar] [CrossRef] [Green Version]
- Santamaria, J.; Villalobos, E.M.; Brettell, L.E.; Nikaido, S.; Graham, J.R.; Martin, S. Evidence of varroa-mediated deformed wing virus spillover in Hawaii. J. Invertebr. Pathol. 2018, 151, 126–130. [Google Scholar] [CrossRef] [PubMed]
- Mondet, F.; de Miranda, J.R.; Kretzschmar, A.; Le Conte, Y.; Mercer, A.R. On the front line: Quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 2014, 10, e1004323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Miranda, J.R.; Genersch, E. Deformed wing virus. J. Invertebr. Pathol. 2010, 103 (Suppl. 1), S48–S61. [Google Scholar] [CrossRef] [PubMed]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Kerr, J.F.; Wyllie, A.H.; Currie, A.R. Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 1972, 26, 239–257. [Google Scholar] [CrossRef] [Green Version]
- Clarke, T.E.; Clem, R.J. Insect defenses against virus infection: The role of apoptosis. Int. Rev. Immunol. 2003, 22, 401–424. [Google Scholar] [CrossRef]
- Settles, E.W.; Friesen, P.D. Flock house virus induces apoptosis by depletion of Drosophila inhibitor-of-apoptosis protein DIAP1. J. Virol. 2008, 82, 1378–1388. [Google Scholar] [CrossRef] [Green Version]
- Marques, J.T.; Imler, J.-L. The diversity of insect antiviral immunity: Insights from viruses. Curr. Opin. Microbiol. 2016, 32, 71–76. [Google Scholar] [CrossRef] [Green Version]
- Garrido, C.; Galluzzi, L.; Brunet, M.; Puig, P.E.; Didelot, C.; Kroemer, G. Mechanisms of cytochrome c release from mitochondria. Cell Death Differ. 2006, 13, 1423–1433. [Google Scholar] [CrossRef] [Green Version]
- Quinn, L.; Coombe, M.; Mills, K.; Daish, T.; Colussi, P.; Kumar, S.; Richardson, H. Buffy, a Drosophila bcl-2 protein, has anti-apoptotic and cell cycle inhibitory functions. EMBO J. 2003, 22, 3568. [Google Scholar] [CrossRef] [PubMed]
- McIlwain, D.R.; Berger, T.; Mak, T.W. Caspase functions in cell death and disease. Cold Spring Harb. Perspect. Biol. 2015, 7, a026716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koziy, R.A.-O.; Wood, S.C.; Kozii, I.V.; van Rensburg, C.J.; Moshynskyy, I.; Dvylyuk, I.; Simko, E. Deformed wing virus infection in honey bees (Apis mellifera L.). Vet. Pathol. 2019, 56, 636–641. [Google Scholar] [CrossRef] [PubMed]
- Doublet, V.; Poeschl, Y.; Gogol-Döring, A.; Alaux, C.; Annoscia, D.; Aurori, C.; Barribeau, S.M.; Bedoya-Reina, O.C.; Brown, M.J.F.; Bull, J.C.; et al. Unity in defence: Honeybee workers exhibit conserved molecular responses to diverse pathogens. BMC Genom. 2017, 18, 207. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.D.; Aronstein, K.; Chen, Y.P.; Hetru, C.; Imler, J.L.; Jiang, H.; Kanost, M.; Thompson, G.J.; Zou, Z.; Hultmark, D. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol. Biol. 2006, 15, 645–656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erban, T.; Sopko, B.; Kadlikova, K.; Talacko, P.; Harant, K. Varroa destructor parasitism has a greater effect on proteome changes than the deformed wing virus and activates TGF-β signaling pathways. Sci. Rep. 2019, 9, 9400. [Google Scholar] [CrossRef]
- Azzami, K.; Ritter, W.; Tautz, J.; Beier, H. Infection of honey bees with acute bee paralysis virus does not trigger humoral or cellular immune responses. Arch. Virol. 2012, 157, 689–702. [Google Scholar] [CrossRef] [Green Version]
- Gätschenberger, H.; Azzami, K.; Tautz, J.; Beier, H. Antibacterial immune competence of honey bees (Apis mellifera) is adapted to different life stages and environmental risks. PLoS ONE 2013, 8, e66415. [Google Scholar] [CrossRef] [Green Version]
- Dubois, E.; Dardouri, M.; Schurr, F.; Cougoule, N.; Sircoulomb, F.; Thiéry, R. Outcomes of honeybee pupae inoculated with deformed wing virus genotypes A and B. Apidologie 2020, 51, 18–34. [Google Scholar] [CrossRef] [Green Version]
- Locke, B.; Forsgren, E.; Fries, I.; de Miranda, J.R. Acaricide treatment affects viral dynamics in Varroa destructor-infested honey bee colonies via both host physiology and mite control. Appl. Environ. Microbiol. 2012, 78, 227–235. [Google Scholar] [CrossRef] [Green Version]
- De Miranda, J.R.; Cordoni, G.; Budge, G. The acute bee paralysis virus–Kashmir bee virus–Israeli acute paralysis virus complex. J. Invertebr. Pathol. 2010, 103, S30–S47. [Google Scholar] [CrossRef] [PubMed]
- Orlando, Y.; Graciano, T.; Peter, N. First detection of viruses in Africanized honey bees from Peru. Virol. Sin. 2014, 29, 321–323. [Google Scholar] [CrossRef] [Green Version]
- Khongphinitbunjong, K.; de Guzman, L.I.; Rinderer, T.E.; Tarver, M.R.; Frake, A.M.; Chen, Y.; Chantawannakul, P. Responses of varroa-resistant honey bees (Apis mellifera L.) to deformed wing virus. J. Asia Pac. Entomol. 2016, 19, 921–927. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Evans, J.D.; Pettis, J.S. Colony-level impacts of immune responsiveness in honey bees, Apis mellifera. Evolution 2005, 59, 2270–2274. [Google Scholar] [CrossRef]
- Simone, M.; Evans, J.D.; Spivak, M. Resin collection and social immunity in honey bees. Evolution 2009, 63, 3016–3022. [Google Scholar] [CrossRef]
- DeGrandi-Hoffman, G.; Chen, Y.; Huang, E.; Huang, M.H. The effect of diet on protein concentration, hypopharyngeal gland development and virus load in worker honey bees (Apis mellifera L.). J. Insect Physiol. 2010, 56, 1184–1191. [Google Scholar] [CrossRef]
- Möckel, N.; Gisder, S.; Genersch, E. Horizontal transmission of deformed wing virus: Pathological consequences in adult bees (Apis mellifera) depend on the transmission route. J. Gen. Virol. 2011, 92, 370–377. [Google Scholar] [CrossRef]
- Tehel, A.; Vu, Q.; Bigot, D.; Gogol-Döring, A.; Koch, P.; Jenkins, C.; Doublet, V.; Theodorou, P.; Paxton, R. The two prevalent genotypes of an emerging infectious disease, deformed wing virus, cause equally low pupal mortality and equally high wing deformities in host honey bees. Viruses 2019, 11, 114. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.P.; Siede, R. Honey bee viruses. In Advances in Virus Research Volume 70; Maramorosch, K., Shatkin, A., Eds.; Elsevier: Amsterdam, The Netherlands, 2007; Volume 70, pp. 33–80. [Google Scholar]
- Ahlquist, P.; Noueiry, A.O.; Lee, W.-M.; Kushner, D.B.; Dye, B.T. Host factors in positive-strand RNA virus genome replication. J. Virol. 2003, 77, 8181–8186. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Cox-Foster, D.L. Impact of an ectoparasite on the immunity and pathology of an invertebrate: Evidence for host immunosuppression and viral amplification. Proc. Natl. Acad. Sci. USA 2005, 102, 7470–7475. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de Miranda, J.R.; Fries, I. Venereal and vertical transmission of deformed wing virus in honeybees (Apis mellifera L.). J. Invertebr. Pathol. 2008, 98, 184–189. [Google Scholar] [CrossRef] [PubMed]
- Yue, C.; Schröder, M.; Gisder, S.; Genersch, E. Vertical-transmission routes for deformed wing virus of honeybees (Apis mellifera). J. Gen. Virol. 2007, 88, 2329–2336. [Google Scholar] [CrossRef] [PubMed]
- Page, R.E.; Robinson, G.E. The genetics of division of labour in honey bee colonies. In Advances in Insect Physiology; Evans, P.D., Ed.; Academic Press: Cambridge, MA, USA, 1991; Volume 23, pp. 117–169. [Google Scholar]
- Caporale, M.; Di Gialleonorado, L.; Janowicz, A.; Wilkie, G.; Shaw, A.; Savini, G.; Van Rijn, P.A.; Mertens, P.; Di Ventura, M.; Palmarini, M. Virus and host factors affecting the clinical outcome of bluetongue virus infection. J. Virol. 2014, 88, 10399. [Google Scholar] [CrossRef] [Green Version]
- Maclachlan, N.J.; Drew, C.P.; Darpel, K.E.; Worwa, G. The pathology and pathogenesis of bluetongue. J. Comp. Pathol. 2009, 141, 1–16. [Google Scholar] [CrossRef]
- Forsgren, E.; Fries, I.; de Miranda, J.R. Adult honey bees (Apis mellifera) with deformed wings discovered in confirmed varroa-free colonies. J. Apic. Res. 2012, 51, 136–138. [Google Scholar] [CrossRef]
- Mussabekova, A.; Daeffler, L.; Imler, J.-L. Innate and intrinsic antiviral immunity in Drosophila. Cell. Mol. Life Sci. 2017, 74, 2039–2054. [Google Scholar] [CrossRef]
- van Sluijs, L.; Pijlman, G.P.; Kammenga, J.E. Why do individuals differ in viral susceptibility? A story told by model organisms. Viruses 2017, 9, 284. [Google Scholar] [CrossRef] [Green Version]
- Sinpoo, C.; Paxton, R.J.; Disayathanoowat, T.; Krongdang, S.; Chantawannakul, P. Impact of Nosema ceranae and Nosema apis on individual worker bees of the two host species (Apis cerana and Apis mellifera) and regulation of host immune response. J. Insect Physiol. 2018, 105, 1–8. [Google Scholar] [CrossRef]
- Krongdang, S.; Evans, J.D.; Chen, Y.; Mookhploy, W.; Chantawannakul, P. Comparative susceptibility and immune responses of Asian and European honey bees to the American foulbrood pathogen, Paenibacillus larvae. Insect Sci. 2018, 26, 831–842. [Google Scholar] [CrossRef]
- Aronstein, K.A.; Murray, K.D.; Saldivar, E. Transcriptional responses in honey bee larvae infected with chalkbrood fungus. BMC Genom. 2010, 11, 391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuster, R.D.; Boncristiani, H.F.; Rueppell, O. Immunogene and viral transcript dynamics during parasitic Varroa destructor mite infection of developing honey bee (Apis mellifera) pupae. J. Exp. Biol. 2014, 217, 1710. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ryabov, E.V.; Fannon, J.M.; Moore, J.D.; Wood, G.R.; Evans, D.J. The Iflaviruses sacbrood virus and deformed wing virus evoke different transcriptional responses in the honeybee which may facilitate their horizontal or vertical transmission. PeerJ 2016, 4, e1591. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cruz, J.; Ortiz, C.; Guzmán, F.; Fernández-Lafuente, R.; Torres, R. Antimicrobial peptides: Promising compounds against pathogenic microorganisms. Curr. Med. Chem. 2014, 21, 2299–2321. [Google Scholar] [CrossRef] [PubMed]
- Eleftherianos, I.; More, K.; Spivack, S.; Paulin, E.; Khojandi, A.; Shukla, S. Nitric oxide levels regulate the immune response of Drosophila melanogaster reference laboratory strains to bacterial infections. Infect. Immun. 2014, 82, 4169–4181. [Google Scholar] [CrossRef] [Green Version]
- Alexander, C.; Rietschel, E.T. Bacterial lipopolysaccharides and innate immunity. J. Endotoxin Res. 2001, 7, 167–202. [Google Scholar] [CrossRef]
- Mueller, S.N.; Rouse, B.T. Immune responses to viruses. Clin. Immunol. 2008, 421–431. [Google Scholar] [CrossRef]
- Painter, M.M.; Morrison, J.H.; Zoecklein, L.J.; Rinkoski, T.A.; Watzlawik, J.O.; Papke, L.M.; Warrington, A.E.; Bieber, A.J.; Matchett, W.E.; Turkowski, K.L.; et al. Antiviral protection via RdRP-mediated stable activation of innate immunity. PLoS Pathog. 2015, 11, e1005311. [Google Scholar] [CrossRef]
- Randall, R.E.; Griffin, D.E. Within host RNA virus persistence: Mechanisms and consequences. Curr. Opin. Virol. 2017, 23, 35–42. [Google Scholar] [CrossRef] [Green Version]
- Lin, X.; Guan, H.; Huang, Z.; Liu, J.; Li, H.; Wei, G.; Cao, X.; Li, Y. Downregulation of Bcl-2 expression by miR-34a mediates palmitate-induced min6 cells apoptosis. J. Diabetes Res. 2014, 2014, 7. [Google Scholar] [CrossRef] [Green Version]
- Eischen, C.M.; Woo, D.; Roussel, M.F.; Cleveland, J.L. Apoptosis triggered by Myc-induced suppression of Bcl-X(L) or Bcl-2 is bypassed during lymphomagenesis. Mol. Cell. Biol. 2001, 21, 5063–5070. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hemann, M.T.; Lowe, S.W. The p53–Bcl-2 connection. Cell Death Differ. 2006, 13, 1256–1259. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Celis, U.; López-Martínez, F.J.; Cervantes-Jiménez, R.; Ferríz-Martínez, R.A.; Blanco-Labra, A.; García-Gasca, T. Tepary bean (Phaseolus acutifolius) lectins induce apoptosis and cell arrest in G0/G1 by P53(Ser46) phosphorylation in colon cancer cells. Molecules 2020, 25, 1021. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aloni-Grinstein, R.; Charni-Natan, M.; Solomon, H.; Rotter, V. p53 and the viral connection: Back into the future. Cancers 2018, 10, 178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marsh, M.; Helenius, A. Virus entry: Open sesame. Cell 2006, 124, 729–740. [Google Scholar] [CrossRef] [Green Version]
- Le Gall, O.; Christian, P.; Fauquet, C.M.; King, A.M.Q.; Knowles, N.J.; Nakashima, N.; Stanway, G.; Gorbalenya, A.E. Picornavirales, a proposed order of positive-sense single-stranded RNA viruses with a pseudo-T = 3 virion architecture. Arch. Virol. 2008, 153, 715. [Google Scholar] [CrossRef]
- Lai, Y.; Wang, M.; Cheng, A.; Mao, S.; Ou, X.; Yang, Q.; Wu, Y.; Jia, R.; Liu, M.; Zhu, D.; et al. Regulation of apoptosis by enteroviruses. Front. Microbiol. 2020, 11, 1145. [Google Scholar] [CrossRef]
Target Gene Amplified | Primer Name | Sequence 5′-3′ | References |
---|---|---|---|
Reference gene | |||
Ribosomal protein S5 (RPS5) | AmRPS5.F | AATTATTTGGTCGCTGGAATTG | [35] |
AmRPS5.R | TAACGTCCAGCAGAATGTGGTA | ||
β-Actin | Actin.F | TTGTATGCCAACACTGTCCTTT | [36] |
Actin.R | TGGCGCGATGATCTTAATTT | ||
Immune-related gene (antibacterial peptide) | |||
Abaecin | Abaecin.F | CAGCATTCGCATACGTACCA | [25] |
Abaecin.R | GACCAGGAAACGTTGGAAAC | ||
Defensin | Defensin.F | TGCGCTGCTAACTGTCTCAG | [25] |
Defensin.R | AATGGCACTTAACCGAAACG | ||
Hymenoptaecin | Hymenopt.F | CTCTTCTGTGCCGTTGCATA | [25] |
Hymenopt.R | GCGTCTCCTGTCATTCCATT | ||
Apoptosis-related gene | |||
Apoptotic peptidase activating factor 1-like | Apaf1.F | ACAGATGATAATTTACAGGTGTGGG | NC_007071.3 |
Apaf1.R | TCCGTTCACTCTATCCGTTTGT | ||
Bcl-2 family proteins-like | Buffy.F | TGCCGATGCCTGAAAAGTCT | NC_007072.3 |
Buffy.R | TCTGCGATAAGGTTGGCCTG | ||
Tumor protein p53-inducible nuclear protein 2-like | P53.F | TTCAATTGCACAGTTGAGGGC | NW_003382505.1 |
P53.R | CGGTACACGGACATACTGGG | ||
Cysteine proteases3-like | Caspase3-like.F | CATGCACAGAAGAAATTCGCCA | XM_394855.6 |
Caspase3-like.R | GTTCGTCCCGTTTCGTTGTG | ||
Cysteine proteases8-like | Caspase8-like.F | AAAACAATTGATGCAGTAGGGG | XM_006570913.3 |
Caspase8-like.R | TTCTGGAAATTGAAAATCGGAAGA | ||
Cysteine proteases9-like | Caspase9-like.F | TGGCCAAAGCTTGTTGAAAATCA | XM_026444610.1 |
Caspase9-like.R | ATGCAAAAGGTCCCCGTGTT | ||
Honeybee virus | |||
Deformed wing virus | DWV.F | CGAAACCAACTTCTGAGGAA | [37] |
DWV.R | GTGTTGATCCCTGAGGCTTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mookhploy, W.; Krongdang, S.; Chantawannakul, P. Effects of Deformed Wing Virus Infection on Expressions of Immune- and Apoptosis-Related Genes in Western Honeybees (Apis mellifera). Insects 2021, 12, 82. https://doi.org/10.3390/insects12010082
Mookhploy W, Krongdang S, Chantawannakul P. Effects of Deformed Wing Virus Infection on Expressions of Immune- and Apoptosis-Related Genes in Western Honeybees (Apis mellifera). Insects. 2021; 12(1):82. https://doi.org/10.3390/insects12010082
Chicago/Turabian StyleMookhploy, Wannapha, Sasiprapa Krongdang, and Panuwan Chantawannakul. 2021. "Effects of Deformed Wing Virus Infection on Expressions of Immune- and Apoptosis-Related Genes in Western Honeybees (Apis mellifera)" Insects 12, no. 1: 82. https://doi.org/10.3390/insects12010082
APA StyleMookhploy, W., Krongdang, S., & Chantawannakul, P. (2021). Effects of Deformed Wing Virus Infection on Expressions of Immune- and Apoptosis-Related Genes in Western Honeybees (Apis mellifera). Insects, 12(1), 82. https://doi.org/10.3390/insects12010082