A Study on the Possibility of Early Warning for Cochlodinium polykrikoides Blooms, Using Molecular Methods
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Genomic DNA Extraction
2.2. Quantitative PCR for Microbial Communities, Phytoplankton Communities, and C. polykrikoides
2.3. Library Preparation and Sequencing
2.4. Bioinformatics Analysis of Metabarcoding Data
2.5. Statistical Analysis
3. Results
3.1. Environmental Parameters
3.2. Quantitative Analysis of Microorganisms, Phytoplankton, and C. polykrikoides
3.3. Microbial Community Structure during the Cochlodinium Bloom
3.4. Phytoplanktkonl Community Structure during the Cochlodinium Bloom
3.5. Correlation of C. polykrikoides with Environmental Factors
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Field, C.B.; Behrenfeld, M.J.; Randerson, J.T.; Falkowski, P. Primary production of the biosphere: Integrating terrestrial and oceanic components. Science 1998, 281, 237–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, J.; L Richlen, M.; R Sehein, T.; M Kulis, D.; Anderson, D.; Cai, Z. Microbial community structure and associations during a marine dinoflagellate bloom. Front. Microbiol. 2018, 9, 1201. [Google Scholar] [CrossRef] [PubMed]
- NFRDI. Monitoring, management and mitigation of red tide. In Annual Report of NFRDI on Red Tide of Korea (Written in Korean); NFRDI: Busan, Korea, 2012. [Google Scholar]
- Park, T.G.; Lim, W.A.; Park, Y.T.; Lee, C.K.; Jeong, H.J. Economic impact, management and mitigation of red tides in Korea. Harmful Algae 2013, 30, S131–S143. [Google Scholar] [CrossRef]
- Lee, S.G.; Kim, H.G.; Cho, E.S.; Lee, C.K. Harmful algal blooms (red tides): Management and mitigation in the Republic of Korea. Harmful Algal Bloom. PICES Reg. North Pac. 2002, 39. [Google Scholar]
- Eckford-Soper, L.K.; Daugbjerg, N. Examination of six commonly used laboratory fixatives in HAB monitoring programs for their use in quantitative PCR based on Taqman probe technology. Harmful Algae 2015, 42, 52–59. [Google Scholar] [CrossRef]
- Dolgin, A.; Adolf, J. Scanning electron microscopy of phytoplankton: Achieving high quality images through the use of safer alternative chemical fixatives. J. Young Investig. 2019, 37. [Google Scholar] [CrossRef]
- Engesmo, A.; Strand, D.; Gran-Stadniczeñko, S.; Edvardsen, B.; Medlin, L.K.; Eikrem, W. Development of a qPCR assay to detect and quantify ichthyotoxic flagellates along the Norwegian coast, and the first Norwegian record of Fibrocapsa japonica (Raphidophyceae). Harmful Algae 2018, 75, 105–117. [Google Scholar] [CrossRef]
- Hatfield, R.G.; Bean, T.; Turner, A.D.; Lees, D.N.; Lowther, J.; Lewis, A.; Baker-Austin, C. Development of a TaqMan qPCR assay for detection of Alexandrium spp and application to harmful algal bloom monitoring. Toxicon X 2019, 2, 100011. [Google Scholar] [CrossRef]
- Bidle, K.D.; Azam, F. Accelerated dissolution of diatom silica by marine bacterial assemblages. Nature 1999, 397, 508–512. [Google Scholar] [CrossRef]
- Park, B.S.; Kim, J.-H.; Kim, J.H.; Gobler, C.J.; Baek, S.H.; Han, M.-S. Dynamics of bacterial community structure during blooms of Cochlodinium polykrikoides (Gymnodiniales, Dinophyceae) in Korean coastal waters. Harmful Algae 2015, 48, 44–54. [Google Scholar] [CrossRef]
- Brand, L.E.; Campbell, L.; Bresnan, E. Karenia: The biology and ecology of a toxic genus. Harmful Algae 2012, 14, 156–178. [Google Scholar] [CrossRef]
- Hold, G.L.; Smith, E.A.; Rappë, M.S.; Maas, E.W.; Moore, E.R.; Stroempl, C.; Stephen, J.R.; Prosser, J.I.; Birkbeck, T.H.; Gallacher, S. Characterisation of bacterial communities associated with toxic and non-toxic dinoflagellates: Alexandrium spp. and Scrippsiella trochoidea. FEMS Microbiol. Ecol. 2001, 37, 161–173. [Google Scholar] [CrossRef]
- Jasti, S.B. Phylogenetic Diversity of Bacteria Associated with Alexandrium spp. and Other Phyloplankton from the Gulf of Maine; University of Massachusetts: Lowell, MA, USA, 2003. [Google Scholar]
- Buchan, A.; LeCleir, G.R.; Gulvik, C.A.; González, J.M. Master recyclers: Features and functions of bacteria associated with phytoplankton blooms. Nat. Rev. Microbiol. 2014, 12, 686–698. [Google Scholar] [CrossRef] [PubMed]
- Camarena-Gómez, M.T.; Lipsewers, T.; Piiparinen, J.; Eronen-Rasimus, E.; Perez-Quemaliños, D.; Hoikkala, L.; Sobrino, C.; Spilling, K. Shifts in phytoplankton community structure modify bacterial production, abundance and community composition. Aquat. Microb. Ecol. 2018, 81, 149–170. [Google Scholar] [CrossRef] [Green Version]
- Ferrier, M.; Martin, J.; Rooney-Varga, J. Stimulation of Alexandrium fundyense growth by bacterial assemblages from the Bay of Fundy. J. Appl. Microbiol. 2002, 92, 706–716. [Google Scholar] [CrossRef]
- Haines, K.C.; Guillard, R.R. Growth of vitamin B12-requiring marine diatoms in mixed laboratory cultures with vitamin B12-producing marine bacteria. J. Phycol. 1974, 10, 245–252. [Google Scholar]
- Sakami, T.; Nakahara, H.; Chinain, M.; Ishida, Y. Effects of epiphytic bacteria on the growth of the toxic dinoflagellate Gambierdiscus toxicus (Dinophyceae). J. Exp. Mar. Biol. Ecol. 1999, 233, 231–246. [Google Scholar] [CrossRef]
- Gallacher, S.; Flynn, K.J.; Franco, J.M.; Brueggemann, E.; Hines, H. Evidence for production of paralytic shellfish toxins by bacteria associated with Alexandrium spp.(Dinophyta) in culture. Appl. Environ. Microbiol. 1997, 63, 239–245. [Google Scholar] [CrossRef] [Green Version]
- Doucette, G.J.; McGovern, E.R.; Babinchak, J.A. Algicidal bacteria active against Gymnodinium breve (Dinophyceae). I. Bacterial isolation and characterization of killing activity. J. Phycol. 1999, 35, 1447–1454. [Google Scholar] [CrossRef]
- Imai, I.; Ishida, Y.; Hata, Y. Killing of marine phytoplankton by a gliding bacterium Cytophaga sp., isolated from the coastal sea of Japan. Mar. Biol. 1993, 116, 527–532. [Google Scholar] [CrossRef]
- Wang, X.; Li, Z.; Su, J.; Tian, Y.; Ning, X.; Hong, H.; Zheng, T. Lysis of a red-tide causing alga, Alexandrium tamarense, caused by bacteria from its phycosphere. Biol. Control 2010, 52, 123–130. [Google Scholar] [CrossRef]
- Doucette, G.J. Interactions between bacteria and harmful algae: A review. Nat. Toxins 1995, 3, 65–74. [Google Scholar] [CrossRef]
- Demuez, M.; Gonzalez-Fernandez, C.; Ballesteros, M. Algicidal microorganisms and secreted algicides: New tools to induce microalgal cell disruption. Biotechnol. Adv. 2015, 33, 1615–1625. [Google Scholar] [CrossRef] [PubMed]
- Park, B.S.; Guo, R.; Lim, W.A.; Ki, J.S. Pyrosequencing reveals specific associations of bacterial clades Roseobacter and Flavobacterium with the harmful dinoflagellate Cochlodinium polykrikoides growing in culture. Mar. Ecol. 2017, 38, e12474. [Google Scholar] [CrossRef]
- Shin, H.; Lee, E.; Shin, J.; Ko, S.R.; Oh, H.S.; Ahn, C.Y.; Oh, H.M.; Cho, B.K.; Cho, S. Elucidation of the bacterial communities associated with the harmful microalgae Alexandrium tamarense and Cochlodinium polykrikoides using nanopore sequencing. Sci. Rep. 2018, 8, 5323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, Y.; Chun, S.J.; Baek, S.S.; Baek, S.H.; Kim, P.J.; Son, M.; Cho, K.H.; Ahn, C.Y.; Oh, H.M. Unique microbial module regulates the harmful algal bloom (Cochlodinium polykrikoides) and shifts the microbial community along the Southern Coast of Korea. Sci. Total Environ. 2020, 721, 137725. [Google Scholar] [CrossRef]
- Sildever, S.; Laas, P.; Kolesova, N.; Lips, I.; Lips, U.; Nagai, S. Plankton biodiversity and species co-occurrence based on environmental DNA—A multiple marker study. Metabarcoding Metagenomics 2021, 5, e72371. [Google Scholar] [CrossRef]
- Herlemann, D.P.; Labrenz, M.; Jurgens, K.; Bertilsson, S.; Waniek, J.J.; Andersson, A.F. Transitions in bacterial communities along the 2000 km salinity gradient of the Baltic Sea. ISME J. 2011, 5, 1571–1579. [Google Scholar] [CrossRef] [Green Version]
- Kang, H.E.; Yoon, T.H.; Yoon, S.; Kim, H.J.; Park, H.; Kang, C.K.; Kim, H.W. Genomic analysis of red-tide water bloomed with Heterosigma akashiwo in Geoje. PeerJ 2018, 6, e4854. [Google Scholar] [CrossRef] [Green Version]
- Park, T.G.; Kim, J.J.; Kim, W.J.; Won, K.M. Development of real-time RT-PCR for detecting viable Cochlodinium polykrikoides (Dinophyceae) cysts in sediment. Harmful Algae 2016, 60, 36–44. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Envrion. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [PubMed]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [Green Version]
- Kamikawa, R.; Asai, J.; Miyahara, T.; Murata, K.; Oyama, K.; Yoshimatsu, S.; Yoshida, T.; Sako, Y. Application of a real-time PCR assay to a comprehensive method of monitoring harmful algae. Microbes Environ. 2006, 21, 163–173. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.C.; Chen, Z.F.; Zhao, J.Y.; Yu, R.C.; Qiu, L.M.; Kong, F.Z.; Wang, Y.F.; Yan, T.; Zhou, M.J. Development of a sensitive qPCR method for the detection of pelagophyte Aureococcus anophagefferens. Limnol. Oceanogr. Methods 2020, 18, 41–51. [Google Scholar] [CrossRef]
- Casper, E.T.; Paul, J.H.; Smith, M.C.; Gray, M. Detection and quantification of the red tide dinoflagellate Karenia brevis by real-time nucleic acid sequence-based amplification. Appl. Environ. Microbiol. 2004, 70, 4727–4732. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, J.; Mi, T.; Zhen, Y.; Yu, Z. Development of a rapid detection and quantification method of Karenia mikimotoi by real-time quantitative PCR. Harmful Algae 2012, 17, 83–91. [Google Scholar] [CrossRef]
- Moorthi, S.D.; Countway, P.D.; Stauffer, B.A.; Caron, D.A. Use of quantitative real-time PCR to investigate the dynamics of the red tide dinoflagellate Lingulodinium polyedrum. Microb. Ecol. 2006, 52, 136–150. [Google Scholar] [CrossRef] [PubMed]
- Hariganeya, N.; Tanimoto, Y.; Yamaguchi, H.; Nishimura, T.; Tawong, W.; Sakanari, H.; Yoshimatsu, T.; Sato, S.; Preston, C.M.; Adachi, M. Quantitative PCR method for enumeration of cells of cryptic species of the toxic marine dinoflagellate Ostreopsis spp. in coastal waters of Japan. PLoS ONE 2013, 8, e57627. [Google Scholar]
- Antonella, P.; Luca, G. The quantitative real-time PCR applications in the monitoring of marine harmful algal bloom (HAB) species. Environ. Sci. Pollut. Res. 2013, 20, 6851–6862. [Google Scholar] [CrossRef] [Green Version]
- Park, T.G.; Kim, J.J.; Song, S.Y. Distributions of East Asia and Philippines ribotypes of Cochlodinium polykrikoides (Dinophyceae) in the South Sea, Korea. The Sea 2019, 24, 422–428. [Google Scholar]
- Park, T.G.; Park, G.H.; Park, Y.T.; Kang, Y.S.; Bae, H.M.; Kim, C.H.; Jeong, H.J.; Lee, Y. Identification of the dinoflagellate community during Cochlodinium polykrikoides (Dinophyceae) blooms using amplified rDNA melting curve analysis and real-time PCR probes. Harmful Algae 2009, 8, 430–440. [Google Scholar] [CrossRef]
- Hosoi-Tanabe, S.; Sako, Y. Species-Specific Detection and Quantification of Toxic Marine Dinoflagellates Alexandrium tamarense and A. catenella byReal-Time PCR Assay. Mar. Biotechnol. 2005, 7, 506–514. [Google Scholar] [CrossRef] [PubMed]
- Galluzzi, L.; Bertozzini, E.; Penna, A.; Perini, F.; Garcés, E.; Magnani, M. Analysis of rRNA gene content in the Mediterranean dinoflagellate Alexandrium catenella and Alexandrium taylori: Implications for the quantitative real-time PCR-based monitoring methods. J. Appl. Phycol. 2010, 22, 1–9. [Google Scholar] [CrossRef]
- Galluzzi, L.; Penna, A.; Bertozzini, E.; Vila, M.; Garcés, E.; Magnani, M. Development of a real-time PCR assay for rapid detection and quantification of Alexandrium minutum (a dinoflagellate). Appl. Environ. Microbiol. 2004, 70, 1199–1206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, F.; Massana, R.; Not, F.; Marie, D.; Vaulot, D. Mapping of picoeucaryotes in marine ecosystems with quantitative PCR of the 18S rRNA gene. FEMS Microbiol. Ecol. 2005, 52, 79–92. [Google Scholar] [CrossRef] [Green Version]
- Hu, J.; Guo, R.; Lu, D.; Dai, X.; Zhu, Y.; Park, B.S.; Wang, P. Detection and Quantification of the Harmful Dinoflagellate Margalefidinium polykrikoides (East Asian Ribotype) in the Coastal Waters of China. Toxins 2022, 14, 95. [Google Scholar] [CrossRef]
- Lu, J.; Struewing, I.; Wymer, L.; Tettenhorst, D.R.; Shoemaker, J.; Allen, J. Use of qPCR and RT-qPCR for monitoring variations of microcystin producers and as an early warning system to predict toxin production in an Ohio inland lake. Water Res. 2020, 170, 115262. [Google Scholar] [CrossRef]
- Suh, Y.-S.; Kim, J.-H.; Kim, H.-G. Relationship between sea surface temperature derived from NOAA satellites and Cochlodinium polykrikoides red tide occurrence in Korean coastal waters. J. Environ. Sci. Int. 2000, 9, 215–221. [Google Scholar]
- Kim, D.I.; Matsuyama, Y.; Nagasoe, S.; Yamaguchi, M.; Yoon, Y.H.; Oshima, Y.; Imada, N.; Honjo, T. Effects of temperature, salinity and irradiance on the growth of the harmful red tide dinoflagellate Cochlodinium polykrikoides Margalef (Dinophyceae). J. Plankton Res. 2004, 26, 61–66. [Google Scholar] [CrossRef]
- Kouzuma, A.; Watanabe, K. Exploring the potential of algae/bacteria interactions. Curr. Opin. Biotechnol. 2015, 33, 125–129. [Google Scholar] [CrossRef] [PubMed]
- Yoon, T.H.; Kang, H.E.; Kang, C.K.; Lee, S.H.; Ahn, D.H.; Park, H.; Kim, H.W. Development of a cost-effective metabarcoding strategy for analysis of the marine phytoplankton community. PeerJ 2016, 4, e2115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia, N.S.; Bonachela, J.A.; Martiny, A.C. Interactions between growth-dependent changes in cell size, nutrient supply and cellular elemental stoichiometry of marine Synechococcus. ISME J. 2016, 10, 2715–2724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hare, C.E.; Demir, E.; Coyne, K.J.; Cary, S.C.; Kirchman, D.L.; Hutchins, D.A. A bacterium that inhibits the growth of Pfiesteria piscicida and other dinoflagellates. Harmful Algae 2005, 4, 221–234. [Google Scholar] [CrossRef]
- Lee, B.-K.; Katano, T.; Kitamura, S.-I.; Oh, M.-J.; Han, M.-S. Monitoring of algicidal bacterium, Alteromonas sp. Strain A14 in its application to natural Cochlodinium polykrikoides blooming seawater using fluorescence in situ hybridization. J. Microbiol. 2008, 46, 274–282. [Google Scholar] [CrossRef]
- Herlemann, D.P.; Lundin, D.; Labrenz, M.; Jürgens, K.; Zheng, Z.; Aspeborg, H.; Andersson, A.F. Metagenomic de novo assembly of an aquatic representative of the verrucomicrobial class Spartobacteria. MBio 2013, 4, e00569-12. [Google Scholar] [CrossRef] [Green Version]
- Hattenrath-Lehmann, T.K.; Jankowiak, J.; Koch, F.; Gobler, C.J. Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries. PLoS ONE 2019, 14, e0223067. [Google Scholar] [CrossRef] [PubMed]
- Jeong, H.J.; Kim, J.S.; Kim, J.H.; Kim, S.T.; Seong, K.A.; Kim, T.H.; Song, J.Y.; Kim, S.K. Feeding and grazing impact of the newly described heterotrophic dinoflagellate Stoeckeria algicida on the harmful alga Heterosigma akashiwo. Mar. Ecol. Prog. Ser. 2005, 295, 69–78. [Google Scholar] [CrossRef]
- Jeong, H.J.; Yoo, Y.D.; Kim, J.S.; Kim, T.H.; Kim, J.H.; Kang, N.S.; Yih, W. Mixotrophy in the phototrophic harmful alga Cochlodinium polykrikoides (Dinophycean): Prey species, the effects of prey concentration, and grazing impact. J. Eukaryot. Microbiol. 2004, 51, 563–569. [Google Scholar] [CrossRef]
- Langille, M.G.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Vega Thurber, R.L.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814. [Google Scholar] [CrossRef]
- Kudela, R.M.; Lane, J.Q.; Cochlan, W.P. The potential role of anthropogenically derived nitrogen in the growth of harmful algae in California, USA. Harmful algae 2008, 8, 103–110. [Google Scholar] [CrossRef]
Primer | Sequences (5′ to 3′) | References |
---|---|---|
16S universal primer F | CCTACGGGNGGCWGCAG | [30] |
16S universal primer R | GACTACHVGGGTATCTAATCC | |
p23S universal primer F | GGACARWAAGACCCTATGMAG | [31] |
p23S universal primer R | AGATYAGCCTGTTATCCCT | |
Nex 16SF | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG | |
Nex 16SR | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC | |
Nex p23SF | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGACARWAAGACCCTATGMAG | |
Nex p23SR | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGATYAGCCTGTTATCCCT | |
CPLSUF | GCCGAGGATACCTGCAAAG | [32] |
CPLSUR | TGTCAGGACCCACGATCA | |
CPLSUP (probe) | FAM-CTCACATGATCAGCGGCCGAGTACTAA–BHQ1 |
Year | Station | Temp. °C | Salinity PSU | NH4-N μΜ | NO2-N μΜ | NO3-N μΜ | DIN μΜ | PO4-P μΜ | SiO2-Si μΜ | Chl-a ug/L |
---|---|---|---|---|---|---|---|---|---|---|
2018 | A | 22.78 | 33.04 | 0.22 | 0.03 | 0.11 | 1.00 | 0.01 | 3.59 | 2.98 |
B | 23.03 | 32.97 | 0.42 | 0.05 | 0.36 | 1.00 | 0.11 | 5.41 | 5.12 | |
C | 26.06 | 32.73 | 0.15 | 0.02 | 0.56 | 1.00 | 0.04 | 11.65 | 2.66 | |
D | 27.39 | 31.66 | 0.11 | 0.03 | 1.00 | 2.00 | 0.03 | 5.32 | 0.22 | |
E | 32.66 | 0.37 | 0.02 | 0.55 | 1.00 | 0.05 | 4.89 | 1.24 | ||
H | 27.52 | 32.46 | 0.00 | 0.02 | 0.56 | 0.58 | 0.12 | 7.90 | 67.47 | |
I | 27.16 | 32.50 | 0.00 | 0.00 | 0.12 | 0.12 | 0.01 | 5.40 | 0.28 | |
J | 26.09 | 32.90 | 0.00 | 0.03 | 0.67 | 0.70 | 0.06 | 9.93 | 2.08 | |
2019 | A | 22.16 | 32.19 | 1.32 | 0.24 | 2.24 | 18.01 | 0.29 | 4.48 | 2.00 |
C | 23.80 | 32.20 | 0.97 | 0.05 | 0.88 | 19.28 | 0.06 | 2.99 | 3.04 | |
D | 22.83 | 30.76 | 0.88 | 0.02 | 1.08 | 17.69 | 0.08 | 2.39 | 1.10 | |
E | 33.46 | 31.71 | 0.85 | 0.01 | 0.85 | 34.39 | 0.00 | 3.33 | 16.24 | |
F | 25.18 | 32.18 | 1.06 | 0.02 | 1.14 | 18.99 | 0.05 | 3.52 | 2.82 | |
G | 33.46 | 31.71 | 0.82 | 0.01 | 1.18 | 17.61 | 0.02 | 3.15 | 1.70 | |
H | 23.72 | 32.19 | 0.40 | 0.27 | 1.03 | 1.69 | 0.43 | 10.97 | 15.97 | |
I | 24.79 | 32.14 | 0.00 | 0.01 | 0.06 | 0.06 | 0.16 | 5.30 | 2.04 | |
J | 25.00 | 32.42 | 0.00 | 0.00 | 0.00 | 0.00 | 0.24 | 4.82 | 4.05 |
Year | Station | Microorganisms (Copies/mL) | Phytoplankton (Copies/mL) | C. polykrikoides (Copies/mL) | C. polykrikoides (Cells/mL) | C. polykrikoides (Copies/Cell) |
---|---|---|---|---|---|---|
2018 | A | 373,039.66 | 75,191.72 | 226,496.55 | 0.00 | - |
B | 410,109.67 | 131,904.62 | 143,526.43 | 0.00 | - | |
C | 693,074.64 | 129,993.01 | 374,770.09 | 7.50 | 49,969.35 | |
D | 214,395.18 | 12,760.27 | 5538.65 | 0.00 | - | |
E | 362,322.25 | 69,390.50 | 1,472,837.75 | 12.00 | 122,736.48 | |
F | 668,274.68 | 98,505.39 | 2,391,768.23 | 26.40 | 90,597.28 | |
H | 28,896.15 | 4428.02 | 6,740,167.32 | 1200.00 | 5616.81 | |
I | 678,086.36 | 114,823.30 | 103,142.69 | 0.10 | 1,031,426.90 | |
J | 1,179,845.14 | 137,809.77 | 5,367,153.82 | 250.00 | 21,468.62 | |
Ave. | 512,004.86 ± 336,315.44 | 86,089.62 ± 50,155.64 | 1,869,489.06 ± 2,522,253.95 | 166.22 ± 396.03 | 220,302.57 ± 399,725.81 | |
2019 | A | 1167,211.57 | 134,914.67 | 867,252.99 | 1.38 | 628,444.20 |
C | 1,082,885.87 | 148,788.00 | 3,089,347.13 | 450.00 | 6865.22 | |
D | 738,466.68 | 82,077.02 | 36,526.34 | 0.00 | - | |
E | 581,862.02 | 70,706.48 | 248,181,801.83 | 1240.00 | 200,146.61 | |
F | 843,365.30 | 106,511.24 | 4,958,103.49 | 7.50 | 661,080.47 | |
G | 463,332.43 | 60,937.70 | 5,726,129.65 | 0.00 | - | |
H | 913,077.22 | 81,334.28 | 9,081,941.97 | 24.00 | 378,414.25 | |
I | 752,222.62 | 64,549.08 | 1,143,482.48 | 0.30 | 3,811,608.27 | |
J | 1,556,795.40 | 87,493.06 | 0.00 | 0.00 | - | |
Ave | 899,913.23 ± 331,554.94 | 93,034.61 ± 30,967.44 | 30,342,731.76 ± 81,746,202.15 | 212.40 ± 443.89 | 947,759.83 ± 1,425,071.09 |
C. polykrikoides | Microorganism | Phytoplankton | Temperature | Salinity | NH4-N | NO2-N | NO3-N | DIN | PO4-P | SiO2-Si | |
---|---|---|---|---|---|---|---|---|---|---|---|
Microorganism | −0.082 | ||||||||||
Phytoplankton | −0.124 | 0.632 ** | |||||||||
Temperature | 0.605 ** | −0.311 | −0.13 | ||||||||
Salinity | −0.247 | 0.013 | 0.296 | −0.261 | |||||||
NH4-N | 0.241 | 0.189 | 0.271 | −0.016 | −0.461 | ||||||
NO2-N | −0.112 | 0.293 | 0.35 | −0.402 | 0.007 | 0.361 | |||||
NO3-N | 0.069 | 0.131 | 0.015 | 0.005 | −0.455 | 0.792 ** | 0.609 ** | ||||
DIN | 0.646 ** | 0.124 | 0.174 | 0.386 | −0.589 * | 0.845 ** | 0.047 | 0.591 * | |||
PO4-P | −0.205 | 0.453 | 0.382 | −0.439 | 0.005 | 0.056 | 0.808 ** | 0.253 | −0.188 | ||
SiO2-Si | −0.187 | 0.054 | 0.176 | −0.089 | 0.443 | −0.53 | 0.309 | −0.129 | −0.562 * | 0.353 | |
Chl-a | 0.752 ** | −0.407 | 0.599 * | 0.195 | 0.065 | −0.205 | 0.024 | −0.055 | −0.075 | 0.158 | 0.266 |
Year | Station | Microorganisms | Phytoplankton | ||||||
---|---|---|---|---|---|---|---|---|---|
Chao1 | Pielou’s Evenness (J’) | Shannon Index (H’) | Simpson Index (1-λ) | Chao1 | Pielou’s Evenness (J’) | Shannon Index (H’) | Simpson Index (1-λ) | ||
2018 | A | 50.2 | 0.6587 | 4.154 | 0.9106 | 11.35 | 0.6733 | 3.256 | 0.917 |
B | 39.18 | 0.6979 | 4.185 | 0.9377 | 8.139 | 0.6003 | 2.694 | 0.8495 | |
C | 36.9 | 0.6757 | 4.019 | 0.9228 | 10.37 | 0.611 | 2.92 | 0.8904 | |
D | 27.93 | 0.5303 | 3.021 | 0.7385 | 8.166 | 0.6651 | 2.939 | 0.8485 | |
E | 35.33 | 0.6375 | 3.758 | 0.8977 | 9.675 | 0.542 | 2.538 | 0.7612 | |
F | 42.78 | 0.6559 | 4.044 | 0.9177 | 8.69 | 0.5656 | 2.575 | 0.822 | |
H | 38.79 | 0.5546 | 3.381 | 0.8673 | 10.77 | 0.5123 | 2.444 | 0.733 | |
I | 41.44 | 0.5689 | 3.51 | 0.8759 | 9.885 | 0.4516 | 2.114 | 0.6819 | |
J | 43.79 | 0.6404 | 3.978 | 0.9086 | 7.445 | 0.379 | 1.675 | 0.5861 | |
2019 | A | 39.13 | 0.5584 | 3.379 | 0.8041 | 10.72 | 0.732 | 3.467 | 0.9392 |
C | 34.66 | 0.5391 | 3.203 | 0.8265 | 10.78 | 0.5934 | 2.8 | 0.8068 | |
D | 34.76 | 0.5233 | 3.09 | 0.7703 | 11.89 | 0.6461 | 3.13 | 0.881 | |
E | 38.43 | 0.4983 | 3.02 | 0.8101 | 9.294 | 0.5108 | 2.331 | 0.6994 | |
F | 42.12 | 0.5048 | 3.113 | 0.7995 | 9.043 | 0.5999 | 2.738 | 0.8439 | |
G | 22.71 | 0.5229 | 2.889 | 0.8293 | 8.107 | 0.4168 | 1.852 | 0.6464 | |
H | 46.58 | 0.5956 | 3.73 | 0.8427 | 10.27 | 0.6942 | 3.257 | 0.9148 | |
I | 47.23 | 0.5318 | 3.332 | 0.7915 | 9.808 | 0.6582 | 3.038 | 0.868 | |
J | 41.5 | 0.4656 | 2.85 | 0.688 | 10.87 | 0.6673 | 3.166 | 0.9135 |
Microbial Community | Phytoplankton Community | |||
---|---|---|---|---|
ANOSIM (Global R) | PERMANOVA (Pseudo-F) | ANOSIM (Global R) | PERMANOVA (Pseudo-F) | |
2018 VS. 2019 | 0.350 | 3.730 | 0.392 | 4.776 |
R2 | 0.001 | 0.015 | 0.001 | 0.005 |
A, B, C, D, E, F, G, H, I, J | 0.109 | 1.621 | 0.134 | 1.649 |
R2 | 0.245 | 0.011 | 0.216 | 0.006 |
Year | OTU | Correlation Coefficient | p | Description | Accession | Identify (%) | Phylum | Regression Equation | R2 |
---|---|---|---|---|---|---|---|---|---|
2018 | 16SOTU19 | 0.688 | <0.05 | Cyanobacterium | KC687149 | 100 | Cyanobacteria | y = (2 × 10−8)x + 0.0092 | 0.4733 |
16SOTU29 | 0.698 | <0.01 | Gamma proteobacterium | MH077347 | 100 | Proteobacteria | y = (1 × 10−7)x + 0.338 | 0.4869 | |
16SOTU92 | 0.713 | <0.05 | Rhodobacteraceae bacterium | MK603708 | 100 | Proteobacteria | y = (4 × 10−7)x − 0.003 | 0.5078 | |
2019 | 16SOTU29 | 0.707 | <0.05 | Gamma proteobacterium | MH077347 | 100 | Proteobacteria | y = (9 × 10−10)x + 0.0859 | 0.4997 |
16SOTU70 | 0.678 | <0.05 | Gamma proteobacterium | HM057639 | 99.84 | Proteobacteria | y =(2 × 10−9)x + 0.1066 | 0.4594 | |
16SOTU102 | 0.999 | <0.01 | Alpha proteobacterium | DQ436547 | 99.83 | Proteobacteria | y = (8 × 10−10)x − 0.0026 | 0.9986 | |
16SOTU123 | 0.841 | <0.01 | Flavobacteriales bacterium | LC314467 | 99.68 | Bacteroidetes | y = (7 × 10−10)x + 0.0117 | 0.7074 | |
16SOTU125 | 0.984 | <0.01 | Verrucomicrobia bacterium | HQ675288 | 99.21 | Verrucomicrobia | y = (3 × 10−8)x + 0.2271 | 0.9685 | |
16SOTU146 | 0.999 | <0.01 | Alpha proteobacterium | DQ187753 | 99.59 | Proteobacteria | y = (5 × 10−10)x − 0.0014 | 0.9986 | |
16SOTU153 | 0.864 | <0.01 | Alpha proteobacterium | JX528177 | 99.59 | Proteobacteria | y = (1 × 10−8)x + 0.1774 | 0.7462 | |
16SOTU211 | 0.999 | <0.01 | Gamma proteobacterium | LC018880 | 99.06 | Proteobacteria | y = (4 × 10−10)x − 0.0014 | 0.9986 | |
16SOTU223 | 0.999 | <0.01 | Flavobacterium sp. | GU230428 | 99.05 | Bacteroidetes | y = (1 × 10−9)x − 0.003 | 0.9986 | |
16SOTU265 | 0.701 | <0.05 | Gamma proteobacterium | AY580810 | 99.61 | Proteobacteria | y = (5 × 10−10)x + 0.0128 | 0.4914 | |
16SOTU274 | 0.841 | <0.01 | Gamma sp. | EF414148 | 94.33 | Proteobacteria | y = (5 × 10−9)x + 0.0816 | 0.7079 | |
16SOTU308 | 0.999 | <0.01 | Pelagibacteraceae bacterium | MH077429 | 99.75 | Proteobacteria | y = (6 × 10−9)x − 0.0195 | 0.9986 | |
16SOTU338 | 0.973 | <0.01 | Flavobacteriales bacterium | KF786847 | 99.61 | Bacteroidetes | y = (2 × 10−9)x + 0.0109 | 0.9468 | |
16SOTU350 | 0.999 | <0.01 | Planctomycete sp. | JN233020 | 97.42 | Planctomycetes | y = (1 × 10−9)x − 0.0033 | 0.9986 | |
16SOTU351 | 0.999 | <0.01 | Alpha proteobacterium | EF471483 | 99.83 | Proteobacteria | y = (9 × 10−10)x − 0.0029 | 0.9986 | |
2018 | 16SOTU70 | 0.588 | <0.01 | Gamma proteobacterium | HM057639 | 99.84 | Proteobacteria | y = (2 × 10−9)x + 0.1234 | 0.3459 |
And | 16SOTU123 | 0.712 | <0.01 | Flavobacteriales bacterium | LC314467 | 99.68 | Bacteroidetes | y = (7 × 10−10)x + 0.0126 | 0.5068 |
2019 | 16SOTU125 | 0.874 | <0.01 | Verrucomicrobia bacterium | HQ675288 | 99.21 | Verrucomicrobia | y = (3 × 10−8)x + 0.7289 | 0.7645 |
16SOTU153 | 0.76 | <0.01 | Alpha proteobacterium | JX528177 | 99.59 | Proteobacteria | y = (1 × 10−8)x + 0.2024 | 0.5769 |
Year | OTU | Correlation Coefficient | p | Description | Accession | Identify (%) | Phylum | Regression Equation | R2 |
---|---|---|---|---|---|---|---|---|---|
2018 | 23SOTU11 | −0.747 | <0.05 | Teleaulax minuta | KP142642 | 99.73 | Cryptophyta | y = (−6 × 10−8)x + 0.3042 | 0.5574 |
23SOTU16 | 0.895 | <0.01 | Bathycoccus sp. | FO082259 | 96.95 | Chlorophyta | y = (5 × 10−8)x − 0.0296 | 0.8004 | |
23SOTU26 | 0.724 | <0.05 | Micromonas pusilla | L42847 | 98.56 | Chlorophyta | y = (3 × 10−8)x − 0.0193 | 0.5244 | |
23SOTU58 | 0.724 | <0.05 | Attheya sp. | KJ958479 | 97.49 | Bacillariophyta | y =(3 × 10−8)x − 0.0181 | 0.5244 | |
23SOTU59 | 0.724 | <0.05 | Actinocyclus subtilis | KP826904 | 98.11 | Bacillariophyta | y = (3 × 10−8)x − 0.0215 | 0.5244 | |
23SOTU72 | 0.713 | <0.05 | Kryptoperidinium foliaceum | GU591328 | 98.74 | Miozoa | y = (2 × 10−7)x − 0.1419 | 0.5088 | |
23SOTU107 | −0.67 | <0.05 | Emiliania huxleyi | JN022705 | 98.83 | Haptophyta | y = (−5 × 10−8)x + 0.3755 | 0.4485 | |
23SOTU116 | 0.728 | <0.05 | Mallomonas sp. | KM817948 | 92.94 | Ochrophyta | y = (8 × 10−8)x + 0.0021 | 0.5297 | |
23SOTU160 | 0.724 | <0.05 | Thalassiosira oceanica | GU323224 | 99.01 | Bacillariophyta | y = (2 × 10−8)x − 0.011 | 0.5244 | |
23SOTU193 | 0.719 | <0.05 | Synechococcus sp. | CP006882 | 99.01 | Cyanobacteria | y = 0.0859x − 0.2161 | 0.3983 | |
23SOTU211 | 0.724 | <0.05 | Synechococcus sp. | CP006882 | 99.01 | Cyanobacteria | y = (2 × 10−8)x − 0.0134 | 0.5244 | |
23SOTU212 | 0.724 | <0.05 | Synechococcus sp. | CP006882 | 99.28 | Cyanobacteria | y = (2 × 10−8)x − 0.0153 | 0.5244 | |
2019 | 23SOTU11 | 0.73 | <0.05 | Teleaulax minuta | KP142642 | 99.73 | Cryptophyta | y = (1 × 10−9)x + 0.0535 | 0.5322 |
23SOTU116 | 0.668 | <0.05 | Mallomonas sp. | KM817948 | 92.94 | Ochrophyta | y = (6 × 10−10)x + 0.0177 | 0.446 | |
23SOTU125 | 0.745 | <0.05 | Synechococcus sp. | LC455658 | 99.28 | Cyanobacteria | y = (9 × 10−10)x + 0.0215 | 0.5553 | |
23SOTU150 | 0.999 | <0.01 | Mallomonas sp. | KM817983 | 92.73 | Ochrophyta | y = (6 × 10−10)x − 0.0018 | 0.9986 | |
23SOTU171 | 0.999 | <0.01 | Ochromonas sp. | KJ877675 | 92.27 | Ochrophyta | y = (5 × 10−10)x − 0.0015 | 0.9986 | |
23SOTU215 | 0.975 | <0.01 | Synechococcus sp. | CP006882 | 99.01 | Cyanobacteria | y = (5 × 10−9)x + 0.0192 | 0.95 | |
2018 | 23SOTU25 | 0.616 | <0.01 | Prymnesiophyte sp. | HM565909 | 97.84 | Haptophyta | y = (8 × 10−10)x + 0.0123 | 0.3795 |
And | 23SOTU150 | 0.999 | <0.01 | Mallomonas sp. | KM817983 | 92.73 | Ochrophyta | y = (6 × 10−10)x − 0.0014 | 0.9977 |
2019 | 23SOTU171 | 0.999 | <0.01 | Ochromonas sp. | KJ877675 | 92.27 | Ochrophyta | y = (5 × 10−10)x − 0.0012 | 0.9977 |
23SOTU215 | 0.975 | <0.01 | Synechococcus sp. | CP006882 | 99.01 | Cyanobacteria | y = (5 × 10−9)x + 0.0037 | 0.9513 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, H.-E.; Yoon, T.-H.; Park, J.-W.; Lim, W.-A.; Kang, C.-K.; Kim, H.-W. A Study on the Possibility of Early Warning for Cochlodinium polykrikoides Blooms, Using Molecular Methods. Water 2022, 14, 3115. https://doi.org/10.3390/w14193115
Kang H-E, Yoon T-H, Park J-W, Lim W-A, Kang C-K, Kim H-W. A Study on the Possibility of Early Warning for Cochlodinium polykrikoides Blooms, Using Molecular Methods. Water. 2022; 14(19):3115. https://doi.org/10.3390/w14193115
Chicago/Turabian StyleKang, Hye-Eun, Tae-Ho Yoon, Jong-Woo Park, Weol-Ae Lim, Chang-Keun Kang, and Hyun-Woo Kim. 2022. "A Study on the Possibility of Early Warning for Cochlodinium polykrikoides Blooms, Using Molecular Methods" Water 14, no. 19: 3115. https://doi.org/10.3390/w14193115
APA StyleKang, H.-E., Yoon, T.-H., Park, J.-W., Lim, W.-A., Kang, C.-K., & Kim, H.-W. (2022). A Study on the Possibility of Early Warning for Cochlodinium polykrikoides Blooms, Using Molecular Methods. Water, 14(19), 3115. https://doi.org/10.3390/w14193115