Whole-Exome Analysis for Polish Caucasian Patients with Retinal Dystrophies and the Creation of a Reference Genomic Database for the Polish Population
Abstract
1. Introduction
2. Materials and Methods
2.1. IRD Group and Genetic Testing
2.2. POLGENOM Group and Genetic Analysis
2.3. POLGENOM Reference Database
3. Results
3.1. IRD Group
3.2. POLGENOM Group and Database
3.2.1. Statistics
3.2.2. Mitochondrial Data
3.3. Molecular Diagnosis of IRD
3.4. Selected Genetic Diagnosis Cases
3.4.1. Retinitis Pigmentosa Case (Compound Heterozygote in RPE65)
3.4.2. Wagner Syndrome - Family Case (Heterozygote in VCAN)
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- RetNet. The Retinal Information Network. Available online: https://web.sph.uth.edu/RetNet/ (accessed on 2 April 2024).
- Verbakel, S.K.; van Huet, R.A.C.; Boon, C.J.F.; den Hollander, A.I.; Collin, R.W.J.; Klaver, C.C.W.; Hoyng, C.B.; Roepman, R.; Klevering, B.J. Non-syndromic retinitis pigmentosa. Prog. Retin. Eye Res. 2018, 66, 157–186. [Google Scholar] [CrossRef] [PubMed]
- Haim, M. Epidemiology of retinitis pigmentosa in Denmark. Acta Ophthalmol. Scand. 2002, s233, 1–34. [Google Scholar] [CrossRef] [PubMed]
- Tuupanen, S.; Gall, K.; Sistonen, J.; Saarinen, I.; Kämpjärvi, K.; Wells, K.; Merkkiniemi, K.; von Nandelstadh, P.; Sarantaus, L.; Känsäkoski, J.; et al. Prevalence of RPGR-Mediated Retinal Dystrophy in an Unselected Cohort of Over 5000 Patients. Transl. Vis. Sci. Technol. 2022, 11, 6. [Google Scholar] [CrossRef] [PubMed]
- Zeviani, M.; Carelli, V. Mitochondrial Retinopathies. Int. J. Mol. Sci. 2021, 23, 210. [Google Scholar] [CrossRef] [PubMed]
- Weisschuh, N.; Mazzola, P.; Zuleger, T.; Schaeferhoff, K.; Kühlewein, L.; Kortüm, F.; Witt, D.; Liebmann, A.; Falb, R.; Pohl, L.; et al. Diagnostic Genome Sequencing Improves Diagnostic Yield: A Prospective Single-Centre Study in 1000 Patients with Inherited Eye Diseases. J. Med. Genet. 2023, 61, 186–195. [Google Scholar] [CrossRef] [PubMed]
- Karali, M.; Testa, F.; Di Iorio, V.; Torella, A.; Zeuli, R.; Scarpato, M.; Romano, F.; Onore, M.E.; Pizzo, M.; Melillo, P.; et al. Genetic Epidemiology of Inherited Retinal Diseases in a Large Patient Cohort Followed at a Single Center in Italy. Sci. Rep. 2022, 12, 20815. [Google Scholar] [CrossRef] [PubMed]
- Peter, V.G.; Kaminska, K.; Santos, C.; Quinodoz, M.; Cancellieri, F.; Cisarova, K.; Gobert, R.P.; Rodrigues, R.; Custódio, S.; Paris, L.P.; et al. The First Genetic Landscape of Inherited Retinal Dystrophies in Portuguese Patients Identifies Recurrent Homozygous Mutations as a Frequent Cause of Pathogenesis. PNAS Nexus 2023, 2, pgad043. [Google Scholar] [CrossRef] [PubMed]
- Available online: https://www.ema.europa.eu/en/medicines/human/EPAR/luxturna#ema-inpage-item-authorisation-details (accessed on 11 February 2024).
- Fischer, M.D.; Simonelli, F.; Sahni, J.; Holz, F.G.; Maier, R.; Fasser, C.; Suhner, A.; Stiehl, D.P.; Chen, B.; Audo, I.; et al. Real-World Safety and Effectiveness of Voretigene Neparvovec: Results up to 2 Years from the Prospective, Registry-Based PERCEIVE Study. Biomolecules 2024, 14, 122. [Google Scholar] [CrossRef] [PubMed]
- Chew, L.A.; Iannaccone, A. Gene-agnostic approaches to treating inherited retinal degenerations. Front. Cell. Dev. Biol. 2023, 11, 1177838. [Google Scholar] [CrossRef]
- Tracewska, A.M.; Kocyła-Karczmarewicz, B.; Rafalska, A.; Murawska, J.; Jakubaszko-Jablonska, J.; Rydzanicz, M.; Stawiński, P.; Ciara, E.; Khan, M.I.; Henkes, A.; et al. Genetic Spectrum of ABCA4-Associated Retinal Degeneration in Poland. Genes 2019, 10, 959. [Google Scholar] [CrossRef]
- Tracewska, A.M.; Kocyla-Karczmarewicz, B.; Rafalska, A.; Murawska, J.; Jakubaszko-Jablonska, J.; Rydzanicz, M.; Stawinski, P.; Ciara, E.; Lipska-Zitkiewicz, B.S.; Khan, M.I.; et al. Non-Syndromic Inherited Retinal Diseases in Poland: Genes, Mutations, and Phenotypes. Mol. Vis. 2021, 27, 457–465. [Google Scholar]
- Wawrocka, A.; Socha, M.; Walczak-Sztulpa, J.; Koczyk, G.; Skorczyk-Werner, A.; Krawczyński, M.R. Molecular Re-Diagnosis with Whole-Exome Sequencing Increases the Diagnostic Yield in Patients with Non-Syndromic Retinitis Pigmentosa. Diagnostics 2023, 13, 730. [Google Scholar] [CrossRef] [PubMed]
- Nowomiejska, K.; Baltaziak, K.; Całka, P.; Ciesielka, M.; Teresiński, G.; Rejdak, R. Identification of the RPGR Gene Pathogenic Variants in a Cohort of Polish Male Patients with Retinitis Pigmentosa Phenotype. Genes 2023, 14, 1950. [Google Scholar] [CrossRef]
- Skorczyk-Werner, A.; Niedziela, Z.; Stopa, M.; Krawczyński, M.R. Novel Gene Variants in Polish Patients with Leber Congenital Amaurosis (LCA). Orphanet. J. Rare Dis. 2020, 15, 345. [Google Scholar] [CrossRef]
- Skorczyk-Werner, A.; Sowińska-Seidler, A.; Wawrocka, A.; Walczak-Sztulpa, J.; Krawczyński, M.R. Molecular Background of Leber Congenital Amaurosis in a Polish Cohort of Patients—Novel Variants Discovered by NGS. J. Appl. Genet. 2023, 64, 89–104. [Google Scholar] [CrossRef]
- Wawrocka, A.; Skorczyk-Werner, A.; Wicher, K.; Niedziela, Z.; Ploski, R.; Rydzanicz, M.; Sykulski, M.; Kociecki, J.; Weisschuh, N.; Kohl, S.; et al. Novel Variants Identified with Next-Generation Sequencing in Polish Patients with Cone-Rod Dystrophy. Mol. Vis. 2018, 24, 326–339. [Google Scholar]
- Wiącek, M.P.; Gosławski, W.; Grabowicz, A.; Sobuś, A.; Kawa, M.P.; Baumert, B.; Paczkowska, E.; Milczarek, S.; Osȩkowska, B.; Safranow, K.; et al. Long-Term Effects of Adjuvant Intravitreal Treatment with Autologous Bone Marrow-Derived Lineage-Negative Cells in Retinitis Pigmentosa. Stem Cells Int. 2021, 2021, 6631921. [Google Scholar] [CrossRef]
- Ulańczyk, Z.; Grabowicz, A.; Mozolewska-Piotrowska, K.; Safranow, K.; Kawa, M.P.; Pałucha, A.; Krawczyk, M.; Sikora, P.; Matczyńska, E.; Machaliński, B.; et al. Genetic Factors Associated with Age-Related Macular Degeneration: Identification of a Novel PRPH2 Single Nucleotide Polymorphism Associated with Increased Risk of the Disease. Acta Ophthalmol. 2021, 99, 739–749. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Broad Institute. Picard Tools. Available online: http://broadinstitute.github.io/picard (accessed on 2 April 2024).
- Van der Auwera, G.A.; O’Connor, B.D. Genomics in the Cloud: Using Docker, GATK, and WDL in Terra, 1st ed.; O’Reilly Media: Sebastopol, CA, USA, 2020. [Google Scholar]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional Annotation of Genetic Variants from High-Throughput Sequencing Data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef]
- Paila, U.; Chapman, B.A.; Kirchner, R.; Quinlan, A.R. GEMINI: Integrative exploration of genetic variation and genome annotations. PLoS Comput. Biol. 2013, 9, e1003153. [Google Scholar] [CrossRef]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef]
- Ellard, S.; Baple, E.L.; Callaway, A.; Berry, I.; Forrester, N.; Turnbull, C.; Owens, M.; Eccles, D.M.; Abbs, S.; Scott, R.; et al. ACGS Best Practice Guidelines for Variant Classification in Rare Disease 2020. v4.01; Association for Clinical Genomic Science: London, UK, 2020. [Google Scholar]
- 1000 Genomes Project Consortium; Auton, A.; Brooks, L.D.; Durbin, R.M.; Garrison, E.P.; Kang, H.M.; Korbel, J.O.; Marchini, J.L.; McCarthy, S.; McVean, G.A.; et al. A global reference for human genetic variation. Nature 2015, 526, 68–74. [Google Scholar] [CrossRef]
- POLGENOM. Available online: https://polgenom.pl/ (accessed on 2 April 2024).
- Landrum, M.J.; Lee, J.M.; Riley, G.R.; Jang, W.; Rubinstein, W.S.; Church, D.M.; Maglott, D.R. ClinVar: Public Archive of Relationships among Sequence Variation and Human Phenotype. Nucleic Acids Res. 2014, 42, D980–D985. [Google Scholar] [CrossRef]
- Stenson, P.D.; Mort, M.; Ball, E.V.; Howells, K.; Phillips, A.D.; Cooper, D.N.; Thomas, N.S.T. The Human Gene Mutation Database: 2008 Update. Genome Med. 2009, 1, 13. [Google Scholar] [CrossRef]
- Fromer, M.; Purcell, S.M. Using XHMM Software to Detect Copy Number Variation in Whole-Exome Sequencing Data. Curr. Protoc. Hum. Genet. 2014, 81, 7.23.1–7.23.21. [Google Scholar] [CrossRef] [PubMed]
- Babadi, M.; Fu, J.M.; Lee, S.K.; Smirnov, A.N.; Gauthier, L.D.; Walker, M.; Benjamin, D.I.; Zhao, X.; Karczewski, K.J.; Wong, I.; et al. GATK-GCNV Enables the Discovery of Rare Copy Number Variants from Exome Sequencing Data. Nat. Genet. 2023, 55, 1589–1597. [Google Scholar] [CrossRef] [PubMed]
- Skubiszewska, A.; Broczek, K.; Maruniak-Chudek, I.; Oledzka, G.; Jonas, M.I.; Puzianowska-Kuznicka, M.; Mossakowska, M. Frailty and Survivability of Polish Caucasian Nonagenarians and Centenarians. Geriatrics 2024, 9, 14. [Google Scholar] [CrossRef] [PubMed]
- Mossakowska, M.; Barcikowska, M.; Broczek, K.; Grodzicki, T.; Klich-Raczka, A.; Kupisz-Urbanska, M.; Podsiadly-Marczykowska, T.; Sikora, E.; Szybinska, A.; Wieczorowska-Tobis, K.; et al. Polish Centenarians Programme. Multidisciplinary studies of successful ageing: Aims, methods, and preliminary results. Exp. Gerontol. 2008, 43, 238–244. [Google Scholar] [CrossRef]
- Bledowski, P.; Mossakowska, M.; Chudek, J.; Grodzicki, T.; Milewicz, A.; Szybalska, A.; Wieczorowska-Tobis, K.; Wiecek, A.; Bartoszek, A.; Dabrowski, A.; et al. Medical, psychological and socioeconomic aspects of aging in Poland: Assumptions and objectives of the PolSenior project. Exp. Gerontol. 2011, 46, 1003–1009. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.A.; Dykes, D.D.; Polesky, H.F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988, 16, 1215. [Google Scholar] [CrossRef] [PubMed]
- McLaren, W.; Gil, L.; Hunt, S.E.; Riat, H.S.; Ritchie, G.R.S.; Thormann, A.; Flicek, P.; Cunningham, F. The Ensembl Variant Effect Predictor. Genome Biol. 2016, 17, 122. [Google Scholar] [CrossRef] [PubMed]
- Brandon, M.C.; Ruiz-Pesini, E.; Mishmar, D.; Procaccio, V.; Lott, M.T.; Nguyen, K.C.; Spolim, S.; Patil, U.; Baldi, P.; Wallace, D.C. MITOMASTER: A bioinformatics tool for the analysis of mitochondrial DNA sequences. Hum. Mutat. 2009, 30, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Brandon, M.C.; Lott, M.T.; Nguyen, K.C.; Spolim, S.; Navathe, S.B.; Baldi, P.; Wallace, D.C. MITOMAP: A human mitochondrial genome database—2004 update. Nucleic Acids Res. 2005, 33, D611–D613. [Google Scholar] [CrossRef] [PubMed]
- Ingman, M.; Gyllensten, U. mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences. Nucleic Acids Res. 2006, 34, D749–D751. [Google Scholar] [CrossRef] [PubMed]
- Tang, P.H.; Velez, G.; Tsang, S.H.; Bassuk, A.G.; Mahajan, V.B. VCAN Canonical Splice Site Mutation is Associated with Vitreoretinal Degeneration and Disrupts an MMP Proteolytic Site. Investig. Ophthalmol. Vis. Sci. 2019, 60, 282–293. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, T.; Inoue, H.; Sakamoto, Y.; Kudo, E.; Naito, T.; Mikawa, T.; Mikawa, Y.; Isashiki, Y.; Osabe, D.; Shinohara, S.; et al. Identification of a novel splice site mutation of the CSPG2 gene in a Japanese family with Wagner syndrome. Investig. Ophthalmol. Vis. Sci. 2005, 46, 2726–2735. [Google Scholar] [CrossRef] [PubMed]
- Matczyńska, E.; Beć-Gajowniczek, M.; Sivitskaya, L.; Gregorczyk, E.; Łyszkiewicz, P.; Szymańczak, R.; Jędrzejowska, M.; Wylęgała, E.; Krawczyński, M.R.; Teper, S.; et al. Optimised, Broad NGS Panel for Inherited Eye Diseases to Diagnose 1000 Patients in Poland. Biomedicines 2024, 12, 1355. [Google Scholar] [CrossRef]
- Gudbjartsson, D.F.; Helgason, H.; Gudjonsson, S.A.; Zink, F.; Oddson, A.; Gylfason, A.; Besenbacher, S.; Magnusson, G.; Halldorsson, B.V.; Hjartarson, E.; et al. Large-scale whole-genome sequencing of the Icelandic population. Nat. Genet. 2015, 47, 435–444. [Google Scholar] [CrossRef]
- Taliun, D.; Harris, D.N.; Kessler, M.D.; Carlson, J.; Szpiech, Z.A.; Torres, R.; Taliun, S.A.G.; Corvelo, A.; Gogarten, S.; Kang, H.M.; et al. Sequencing of 53,831 diverse genomes from the NHLBI TOPMed Program. Nature 2021, 590, 290–299. [Google Scholar] [CrossRef]
- Halldorsson, B.V.; Eggertsson, H.P.; Moore, K.H.S.; Hauswedell, H.; Eiriksson, O.; Ulfarsson, M.O.; Palsson, G.; Hardarson, M.T.; Oddsson, A.; Jensson, B.O.; et al. The sequences of 150,119 genomes in the UK Biobank. Nature 2022, 607, 732–740. [Google Scholar] [CrossRef] [PubMed]
- Kaja, E.; Lejman, A.; Sielski, D.; Sypniewski, M.; Gambin, T.; Dawidziuk, M.; Suchocki, T.; Golik, P.; Wojtaszewska, M.; Mroczek, M.; et al. The Thousand Polish Genomes-A Database of Polish Variant Allele Frequencies. Int. J. Mol. Sci. 2022, 23, 4532. [Google Scholar] [CrossRef] [PubMed]
- GenSight Biologics. Available online: https://www.gensight-biologics.com/clinical-development-summary (accessed on 2 April 2024).
- Mansouri, V. X-Linked Retinitis Pigmentosa Gene Therapy: Preclinical Aspects. Ophthalmol. Ther. 2022, 12, 7–34. [Google Scholar] [CrossRef] [PubMed]
- Russell, S.R.; Drack, A.V.; Cideciyan, A.V.; Jacobson, S.G.; Leroy, B.P.; Van Cauwenbergh, C.; Ho, A.C.; Dumitrescu, A.V.; Han, I.C.; Martin, M.; et al. Intravitreal Antisense Oligonucleotide Sepofarsen in Leber Congenital Amaurosis Type 10: A Phase 1b/2 Trial. Nat. Med. 2022, 28, 1014–1021. [Google Scholar] [CrossRef]
- Jacobson, S.G.; Cideciyan, A.V.; Ho, A.C.; Roman, A.J.; Wu, V.; Garafalo, A.V.; Sumaroka, A.; Krishnan, A.K.; Swider, M.; Mascio, A.A.; et al. Night Vision Restored in Days after Decades of Congenital Blindness. iScience 2022, 25, 105274. [Google Scholar] [CrossRef]
- Opus Genetics, Inc. NCT05616793. Available online: https://classic.clinicaltrials.gov/ct2/show/study/NCT05616793 (accessed on 11 February 2024).
- Kiora Pharmaceuticals, Inc. NCT05282953. Available online: https://classic.clinicaltrials.gov/ct2/show/NCT05282953 (accessed on 11 February 2024).
- Siles, L.; Ruiz-Nogales, S.; Navinés-Ferrer, A.; Méndez-Vendrell, P.; Pomares, E. Efficient Correction of ABCA4 Variants by CRISPR-Cas9 in HiPSCs Derived from Stargardt Disease Patients. Mol. Ther. Nucleic Acids 2023, 32, 64–79. [Google Scholar] [CrossRef]
- Maeder, M.L.; Stefanidakis, M.; Wilson, C.J.; Baral, R.; Barrera, L.A.; Bounoutas, G.S.; Bumcrot, D.; Chao, H.; Ciulla, D.M.; DaSilva, J.A.; et al. Development of a Gene-Editing Approach to Restore Vision Loss in Leber Congenital Amaurosis Type 10. Nat. Med. 2019, 25, 229–233. [Google Scholar] [CrossRef]
- Pierce, E.A.; Aleman, T.S.; Jayasundera, K.T.; Ashimatey, B.S.; Kim, K.; Rashid, A.; Jaskolka, M.C.; Myers, R.L.; Lam, B.L.; Bailey, S.T.; et al. Gene Editing for CEP290-Associated Retinal Degeneration. N. Engl. J. Med. 2024, 390, 1972–1984. [Google Scholar] [CrossRef]
- Nguyen, D.D.; Luo, L.J.; Yang, C.J.; Lai, J.Y. Highly Retina-Permeating and Long-Acting Resveratrol/Metformin Nanotherapeutics for Enhanced Treatment of Macular Degeneration. ACS Nano 2023, 17, 168–183. [Google Scholar] [CrossRef]



| Initial Indication | Total Cases | Females | Males | Mean Age (SD) | Solved and Likely Solved Cases | New Clinical Diagnosis |
|---|---|---|---|---|---|---|
| RP | 47 | 19 (40.4%) | 28 (59.6%) | 38.26 (SD = 14.55) | 30 (63.8%) | 3 |
| Unspecific IRD | 30 | 15 (50.0%) | 15 (50.0%) | 46.04 (SD = 19.56) | 20 (66.7%) | 5 |
| Total | 77 | 34 | 43 | 40.93 (SD = 16.71) | 50 (64.9%) | 8 |
| Gene | Variant Class | HGVSc | HGVSp | No Patients | No Alleles | POLGENOM Frequency | gnomAD_2.1.1.AF Total | dbSNP | Clinvar ID | Consequence | Novel | P/LP/VUS |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABCA4 | SNV | NM_000350.3:c.214G>A | NP_000341.2:p.Gly72Arg | 1 | 1 | 0.00001 | rs61751412 | 99120 | missense | Pathogenic | ||
| ABCA4 | SNV | NM_000350.3:c.1622T>C | NP_000341.2: p.Leu541Pro | 4 | 5 | - | 0.00016 | rs61751392 | 99067 | missense | Pathogenic | |
| ABCA4 | SNV | NM_000350.3:c.3113C>T | NP_000341.2:p.Ala1038Val | 4 | 5 | - | 0.00175 | rs61751374 | 7894 | missense | Pathogenic | |
| ABCA4 | InDel | NM_000350.3:c.2548dup | NP_000341.2:p.Tyr850LeufsTer9 | 1 | 1 | - | - | - | frameshift | yes | Pathogenic | |
| ABCA4 | SNV | NM_000350.2:c.2588G>C | NP_000341.2:p.Gly863Ala | 2 | 2 | - | 0.00430 | rs76157638 | 7879 | missense | Pathogenic | |
| ABCA4 | SNV | NM_000350.3:c.4234C>T | NP_000341.2:p.Gln1412Ter | 1 | 1 | - | 0.00001 | rs61750137 | 99263 | stop_gained | Pathogenic | |
| ABCA4 | InDel | NM_000350.3:c.4537dup | NP_000341.2:p.Gln1513ProfsTer42 | 1 | 1 | - | 0.00002 | rs281865377 | 99292 | frameshift | Pathogenic | |
| ABCA4 | SNV | NM_000350.3:c.5189G>A | NP_000341.2:p.Trp1730Ter | 1 | 1 | - | 0.00000 | rs886044747 | 236125 | stop_gained | Pathogenic | |
| ABCA4 | SNV | NM_000350.3:c.5318C>T | NP_000341.2:p.Ala1773Val | 1 | 1 | - | 0.00001 | rs760549861 | 236129 | missense | Pathogenic | |
| ABCA4 | SNV | NM_000350.3:c.5603A>T | NP_000341.2:p.Asn1868Ile | 2 | 2 | 0.0635 | 0.04219 | rs1801466 | 99390 | missense | Hypomorphic | |
| ABCA4 | SNV | NM_000350.3:c.5882G>A | NP_000341.2:p.Gly1961Glu | 5 | 5 | 0.0119 | 0.00456 | rs1800553 | 7888 | missense | Pathogenic | |
| AHI1 | SNV | NM_001134831.2:c.1828C>T | NP_001128303.1:p.Arg610Ter | 1 | 1 | - | 0.00001 | rs751734985 | 984718 | stop_gained | Pathogenic | |
| AHI1 | SNV | NM_001134831.2:c.1829G>C | NP_001128303.1:p.Arg610Pro | 1 | 1 | - | - | rs374009466 | 802272 | missense | VUS | |
| CEP290 | SNV | NM_025114.4:c.4882C>T | NP_079390.3:p.Gln1628Ter | 1 | 1 | - | 0.00007 | rs376493409 | 217635 | stop_gained | Pathogenic | |
| CEP290 | SNV | NM_025114.4:c.5254C>T | NP_079390.3:p.Arg1752Trp | 1 | 1 | - | 0.00002 | rs748471942 | 866339 | missense | LP | |
| CFAP410 | InDel | NM_004928.3: | NP_004919.1:p.Ala12SerfsTer60 | 1 | 1 | - | 0.00008 | rs748531024 | 438159 | frameshift | Pathogenic | |
| c.33_34insAGCTGCACAGCGTGCA | ||||||||||||
| CFAP410 | SNV | NM_004928.2:c.218G>C | NP_004919.1:p.Arg73Pro | 1 | 1 | - | 0.00033 | rs140451304 | 428573 | missense | LP | |
| CHM | SNV | NM_000390.4:c.49+2T>A | 1 | 1 | - | - | - | splice_donor | yes | Pathogenic | ||
| CNGB3 | SNV | NM_019098.5:c.1578+1G>A | 1 | 2 | - | 0.00002 | rs372006750 | 189031 | splice_donor | Pathogenic | ||
| CRB1 | SNV | NM_201253.3:c.2042G>A | NP_957705.1:p.Cys681Tyr | 1 | 1 | - | 0.00000 | rs62636266 | 99874 | missense | Pathogenic | |
| CRB1 | SNV | NM_201253.3:c.2171A>G | NP_957705.1:p.Tyr724Cys | 2 | 2 | - | 0.00001 | rs765676754 | 872033 | missense | Pathogenic | |
| CRB1 | SNV | NM_201253.3:c.2843G>A | NP_957705.1:p.Cys948Tyr | 1 | 1 | - | 0.00013 | rs62645748 | 39614 | missense | Pathogenic | |
| CRX | SNV | NM_000554.6:c.766C>T | NP_000545.1:p.Gln256Ter | 1 | 1 | - | - | rs1968173024 | 861103 | missense | LP | |
| EYS | SNV | NM_001142800.2:c.2055T>A | NP_001136272.1:p.Cys685Ter | 1 | 1 | - | - | rs372354156 | 194194 | stop_gained | Pathogenic | |
| EYS | SNV | NM_001142800.2:c.2259+1G>A | 1 | 1 | - | 0.00004 | rs752736741 | 558511 | splice_donor | Pathogenic | ||
| EYS | InDel | NM_001142800.2:c.4350_4356del | NP_001136272.1:pIle1451ProfsTer3 | 1 | 2 | - | 0.00008 | rs761238771 | 195936 | frameshift | Pathogenic | |
| EYS | InDel | NM_001142800.2:c.4462_4469dup | NP_001136272.1:p.Met1491AlafsTer12 | 1 | 1 | - | - | - | frameshift | yes | Pathogenic | |
| EYS | SNV | NM_001142800.2:c.4955C>G | NP_001136272.1:p.Ser1652Ter | 1 | 1 | - | - | rs909730457 | 867110 | stop_gained | Pathogenic | |
| EYS | SNV | NM_001142800.2:c.8816G>A | NP_001136272.1:p.Cys2939Tyr | 1 | 1 | - | - | rs1582139965 | 1039939 | missense | VUS | |
| EYS | InDel | NM_001142800.2:c.9079_9082del | NP_001136272.1:p.Arg3027SerfsTer5 | 1 | 1 | - | - | rs1427770112 | 556940 | frameshift | LP | |
| GUCA1A | SNV | NM_001384910.1:c.320T>C | NP_000400.2:p.Ile107Thr | 2 | 2 | - | - | rs869320710 | 225233 | missense | LP | |
| GUCY2D | InDel | NM_000180.4:c.2944+1del | 1 | 1 | - | 0.00036 | rs61750185 | 98582 | splice_donor | Pathogenic | ||
| IMPDH1 | SNV | NM_000883.4:c.730A>C | NP_000874.2:p.Thr244Pro | 1 | 1 | - | 0.00000 | rs1253235754 | 845744 | missense | VUS | |
| IMPDH1 | SNV | NM_000883.4:c.931G>A | NP_000874.2:p.Asp311Asn | 1 | 1 | - | - | rs121912550 | 14834 | missense | Pathogenic | |
| MERTK | SNV | NM_006343.2:c.79G>T | NP_006334.2:p.Glu27Ter | 1 | 2 | - | - | rs1223798126 | stop_gained | Pathogenic | ||
| NR2E3 | InDel | NM_014249.4:c.481del | NP_055064.1:p.Thr161HisfsTer18 | 1 | 2 | - | 0.00007 | rs759339012 | 636047 | frameshift | Pathogenic | |
| PRPF3 | SNV | NM_004698.2:c.1481C>T | NP_004689.1:p.Thr494Met | 1 | 1 | - | - | rs121434241 | 3352 | missense | Pathogenic | |
| PRPF31 | InDel | NM_015629.4: c.428_430delins22AC- | NP_056444.3: p.Gly143AspfsTer17 | 1 | 1 | - | - | - | frameshift | yes | LP | |
| AAGTGCAAGGCTGTTCTTGC | ||||||||||||
| PRPF31 | InDel | NM_015629.4:c.808dup | NP_056444.3:p.His270ProfsTer9 | 1 | 1 | - | - | rs2073875313 | 865752 | frameshift | LP | |
| PRPF31 | SNV | NM_015629.4:c.831T>A | NP_056444.3:p.Ser277Arg | 1 | 1 | - | - | - | missense | yes | VUS | |
| REEP6 | SNV | NM_138393.4:c.349-1G>T | 1 | 1 | - | - | rs2085005383 | 958464 | splice_acceptor | LP | ||
| REEP6 | SNV | NM_001329556.3:c.367T>C | NP_001316485.1:p.Cys123Arg | 1 | 1 | - | 0.00001 | rs1341620671 | missense | VUS | ||
| RHO | SNV | NM_000539.3:c.560G>A | NP_000530.1:p.Cys187Tyr | 1 | 1 | - | - | rs1578280588 | 812397 | missense | Pathogenic | |
| RHO | SNV | NM_000539.3:c.1040C>T | NP_000530.1:p.Pro347Leu | 1 | 1 | - | 0.00000 | rs29001566 | 13014 | missense | Pathogenic | |
| RP2 | InDel | NM_006915.3:c.14_16del | NP_008846.2:p.Phe5del | 1 | 1 | - | - | rs1556313414 | 437942 | inframe deletion | Pathogenic | |
| RPE65 | SNV | NM_000329.3:c.131G>A | NP_000320.1:p.Arg44Gln | 1 | 1 | - | 0.00004 | rs61751282 | 98840 | missense | Pathogenic | |
| RPE65 | SNV | NM_000329.3:c.709C>T | NP_000320.1:p.Pro237Ser | 1 | 1 | - | - | - | 3028862 | missense | LP | |
| RS1 | SNV | NM_000330.4:c.214G>A | NP_000321.1:p.Glu72Lys | 1 | 1 | - | 0.00001 | rs104894928 | 9888 | missense | Pathogenic | |
| RS1 | SNV | NM_000330.4:c.440G>A | NP_000321.1:p.Trp147Ter | 1 | 1 | - | - | - | missense | yes | LP | |
| RS1 | InDel | NM_000330.4:c.522+1G>T | 1 | 1 | - | - | rs281865348 | 98980 | splice_donor | Pathogenic | ||
| RS1 | SNV | NM_000330.4:c.625C>T | NP_000321.1:p.Arg209Cys | 1 | 1 | - | - | rs281865361 | 99006 | missense | Pathogenic | |
| USH2A | InDel | NM_206933.4:c.775_776del | NP_996816.3:p.Ser259PhefsTer63 | 1 | 1 | - | - | rs2038566220 | 866168 | frameshift | Pathogenic | |
| USH2A | InDel | NM_206933.4:c.1836_1839dup | NP_996816.3:p.Gly614TyrfsTer6 | 1 | 1 | - | - | rs2102610607 | 1075936 | frameshift | Pathogenic | |
| USH2A | SNV | NM_206933.4:c.2276G>T | NP_996816.3:p.Cys759Phe | 1 | 1 | - | 0.00097 | rs80338902 | 2356 | missense | Pathogenic | |
| USH2A | SNV | NM_206933.4:c.4210G>T | NP_996816.3:p.Glu1404Ter | 1 | 1 | - | - | rs2034849647 | 813119 | stop_gained | Pathogenic | |
| USH2A | SNV | NM_206933.4:c.5530C>T | NP_996816.3:p.Gln1844Ter | 1 | 1 | - | - | rs761075303 | 1065688 | stop_gained | Pathogenic | |
| USH2A | InDel | NM_206933.4:c.5865_5866del | NP_996816.3:p.Ser1956CysfsTer16 | 1 | 1 | - | - | rs281865361 | 3028715 | frameshift | LP | |
| USH2A | SNV | NM_206933.4:c.9424G>T | NP_996816.3:p.Gly3142Ter | 1 | 1 | - | 0.000024 | rs397518048 | 48626 | stop_gained | Pathogenic | |
| USH2A | SNV | NM_206933.4:c.10732A>C | NP_996816.3:p.Ser3578Arg | 1 | 1 | - | - | - | missense | yes | LP | |
| USH2A | SNV | NM_206933.4:c.11864G>A | NP_996816.3:p.Trp3955Ter | 2 | 3 | - | 0.00012 | rs111033364 | 2357 | stop_gained | Pathogenic | |
| USH2A | SNV | NM_206933.4:c.12284G>A | NP_996816.2:p.Gly4095Asp | 1 | 1 | - | - | rs759898765 | 378847 | missense | Pathogenic | |
| USH2A | InDel | NM_206933.4: | NP_996816.3: | 2 | 2 | - | - | rs1553252388 | 438013 | inframe_indel | Pathogenic | |
| c.13335_13347delinsCTTG | p.Glu4445_Ser4449delinsAspLeu | |||||||||||
| VCAN | SNV | NM_004385.5:c.4004-2A>G | 2 | 2 | - | - | rs80356555 | 17494 | splice_acceptor | Pathogenic | ||
| Variants in inconclusive results | ||||||||||||
| AIPL1 | SNV | NM_014336.5: c.737A>C | NP_055151.3: p.Tyr246Ser | 2 | 2 | - | 0.00021 | rs138585919 | 324614 | missense | VUS | |
| CAPN5 | SNV | NM_004055.5:c.64C>T | NP_004046.2:p.Arg22Cys | 1 | 1 | 0.00007 | rs781837640 | 1064369 | missense | VUS | ||
| HMCN1 | SNV | NM_031935.3: c.16034A>G | NP_114141.2: pGln5345Arg | 1 | 1 | 0.00071 | rs121434382 | 2205 | missense | VUS/Risk factor | ||
| PRPH2 | SNV | NM_000322.5:c.94A>G | NP_000313.2: p.Ile32Val | 1 | 1 | - | 0.00081 | rs61755767 | 98722 | missense | VUS | |
| RP1 | SNV | NM_006269.2:c.6338C>A | NP_006260.1: p.The2113Asn | 2 | 2 | - | 0.00022 | rs137887415 | 847529 | missense | VUS | |
| SEMA4A | SNV | NM_022367.4:c.241C>G | NP_071762.2: p.Arg81Gly | 1 | 1 | - | - | rs745715951 | missense | VUS | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Matczyńska, E.; Szymańczak, R.; Stradomska, K.; Łyszkiewicz, P.; Jędrzejowska, M.; Kamińska, K.; Beć-Gajowniczek, M.; Suchecka, E.; Zagulski, M.; Wiącek, M.; et al. Whole-Exome Analysis for Polish Caucasian Patients with Retinal Dystrophies and the Creation of a Reference Genomic Database for the Polish Population. Genes 2024, 15, 1011. https://doi.org/10.3390/genes15081011
Matczyńska E, Szymańczak R, Stradomska K, Łyszkiewicz P, Jędrzejowska M, Kamińska K, Beć-Gajowniczek M, Suchecka E, Zagulski M, Wiącek M, et al. Whole-Exome Analysis for Polish Caucasian Patients with Retinal Dystrophies and the Creation of a Reference Genomic Database for the Polish Population. Genes. 2024; 15(8):1011. https://doi.org/10.3390/genes15081011
Chicago/Turabian StyleMatczyńska, Ewa, Robert Szymańczak, Katarzyna Stradomska, Przemysław Łyszkiewicz, Maria Jędrzejowska, Karolina Kamińska, Marta Beć-Gajowniczek, Ewa Suchecka, Marek Zagulski, Marta Wiącek, and et al. 2024. "Whole-Exome Analysis for Polish Caucasian Patients with Retinal Dystrophies and the Creation of a Reference Genomic Database for the Polish Population" Genes 15, no. 8: 1011. https://doi.org/10.3390/genes15081011
APA StyleMatczyńska, E., Szymańczak, R., Stradomska, K., Łyszkiewicz, P., Jędrzejowska, M., Kamińska, K., Beć-Gajowniczek, M., Suchecka, E., Zagulski, M., Wiącek, M., Wylęgała, E., Machalińska, A., Mossakowska, M., Puzianowska-Kuźnicka, M., Teper, S., & Boguszewska-Chachulska, A. (2024). Whole-Exome Analysis for Polish Caucasian Patients with Retinal Dystrophies and the Creation of a Reference Genomic Database for the Polish Population. Genes, 15(8), 1011. https://doi.org/10.3390/genes15081011

