Cloning and Analysis of Expression of Genes Related to Carotenoid Metabolism in Different Fruit Color Mutants of Pepper (Capsicum annuum L.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Extraction and Reverse Transcription of DNA and RNA
2.3. Cloning of Carotenoid-Related Genes
2.4. Bioinformatics Analysis Process
2.5. qRT-PCR Analysis Process
3. Results and Analyses
3.1. Cloning and Sequence Analysis of Genes Related to Carotenoid Metabolism
3.2. Bioinformatics Analysis of Genes Related to Carotenoid Biosynthesis
3.3. Evolutionary Analysis
3.4. Homology Analysis
3.5. qRT-PCR Analysis
4. Discussion
5. Conclusions
- (1)
- In both wild-type XHB and its orange mutant H0809, we were able to amplify the complete Ccs gene. However, the level of Ccs expression remained at a low level in mutant H0809, and the difference in expression was significant compared with that of the wild-type XHB, indicating that the formation of fruit color of the orange mutant H0809 could be closely related to the different regulatory patterns of expression of Ccs.
- (2)
- Compared with H0809, we could not amplify the complete Ccs gene in mutants SP02 and PC02, and at the same time, we could not detect the transcript product of the Ccs gene in SP02, but the transcript product could be detected in PC02, indicating that the formation of mutant SP02 may be related to deletion of the Ccs gene, and there may be a homolog of the Ccs gene in PC02.
- (3)
- We were able to amplify the complete Ggps, Psy, Lcyb, Crtz, and Zep genes in three different pairs of wild-type and mutant materials, but their expression patterns were inconsistent across the different developmental stages of different materials. Overall, the expression levels of Psy and Crtz genes in different materials were relatively high, and the expression levels of Ccs genes in red wild type were generally higher than those in mutant materials.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lightbourn, G.J.; Griesbach, R.J.; Novotny, J.A.; Clevidence, B.A.; Rao, D.D.; Stommel, J.R. Effects of anthocyanin and carotenoid combinations on foliage and immature fruit color of Capsicum annuum L. J. Hered. 2008, 99, 105–111. [Google Scholar] [CrossRef]
- Paran, I.; Van Der Knaap, E. Genetic and molecular regulation of fruit and plant domestication traits in tomato and pepper. J. Exp. Bot. 2007, 58, 3841–3852. [Google Scholar] [CrossRef]
- Borovsky, Y.; Paran, I. Chlorophyll breakdown during pepper fruit ripening in the chlorophyll retainer mutation is impaired at the homolog of the senescence-inducible stay-green gene. Theor. Appl. Genet. 2008, 117, 235–240. [Google Scholar] [CrossRef]
- Ha, S.H.; Kim, J.B.; Park, J.S.; Lee, S.W.; Cho, K.J. A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: Deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper. J. Exp. Bot. 2007, 58, 3135–3144. [Google Scholar] [CrossRef]
- Guzman, I.; Hamby, S.; Romero, J.; Bosland, P.W.; O’Connell, M.A. Variability of Carotenoid Biosynthesis in Orange Colored Capsicum spp. Plant Sci. 2010, 179, 49–59. [Google Scholar] [CrossRef]
- Marín, A.; Ferreres, F.; Tomás-Barberán, F.A.; Gil, M.I. Characterization and quantitation of antioxidant constituents of sweet pepper (Capsicum annuum L.). J. Agric. Food Chem. 2004, 52, 3861–3869. [Google Scholar] [CrossRef]
- Wahyuni, Y.; Ballester, A.R.; Sudarmonowati, E.; Bino, R.J.; Bovy, A.G. Metabolite biodiversity in pepper (Capsicum) fruits of thirty-two diverse accessions: Variation in health-related compounds and implications for breeding. Phytochemistry 2011, 72, 1358–1370. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.S.; An, C.G.; Park, J.S.; Lim, Y.P.; Kim, S. Carotenoid profiling from 27 types of paprika (Capsicum annuum L.) with different colors, shapes, and cultivation methods. Food Chem. 2016, 201, 64–71. [Google Scholar] [CrossRef] [PubMed]
- Peterson, P.A. Linkage of Fruit Shape and Color Genes in Capsicum. Genetics 1959, 44, 407–419. [Google Scholar] [CrossRef]
- Silveira Agostini-Costa, T.; da Silva Gomes, I.; de Melo, L.A.M.P.; Reifschneider, F.J.B.; da Costa Ribeiro, C.S. Carotenoid and total vitamin C content of peppers from selected Brazilian cultivars. J. Food Compos. Anal. 2017, 57, 73–79. [Google Scholar] [CrossRef]
- Borovsky, Y.; Oren-Shamir, M.; Ovadia, R.; Walter, D.J.; Paran, I. The A locus that controls anthocyanin accumulation in pepper encodes a MYB transcription factor homologous to Anthocyanin2 of Petunia. Theor. Appl. Genet. 2004, 109, 23–29. [Google Scholar] [CrossRef]
- Wang, D.Y.; Bosland, P. The Genes of Capsicum. HortScience 2006, 41, 1169–1187. [Google Scholar] [CrossRef]
- Pan, Y.; Bradley, G.; Pyke, K.; Ball, G.; Lu, C.G.; Fray, R.; Marshall, A.; Jayasuta, S.; Baxter, C.; Wijk, R.V.; et al. Network inference analysis identifies an APRR2-like gene linked to pigment accumulation in tomato and pepper fruits. Plant Physiol. 2013, 161, 1476–1485. [Google Scholar] [CrossRef] [PubMed]
- Brand, A.; Borovsky, Y.; Hill, T.; Rahman, K.A.A.; Bellalou, A.; Deynze, A.V.; Paran, I. CaGLK2 regulates natural variation of chlorophyll content and fruit color in pepper fruit. Theor. Appl. Genet. 2014, 127, 2139–2148. [Google Scholar] [CrossRef] [PubMed]
- Borovsky, Y.; Monsonego, N.; Mohan, V.; Shabtai, S.; Kamara, I.; Faigenboim, A.; Hill, T.; Chen, S.Y.; Stoffel, K.; Van Deynze, A.; et al. The zinc-finger transcription factor CcLOL1 controls chloroplast development and immature pepper fruit color in Capsicum chinense and its function is conserved in tomato. Plant J. 2019, 99, 41–55. [Google Scholar] [CrossRef] [PubMed]
- Hurtado-Hernandez, H.; Smith, P.G. Inheritance of mature fruit color in Capsicum annuum L. J. Hered. 1985, 76, 211–213. [Google Scholar] [CrossRef]
- Popovsky, S.; Paran, I. Molecular genetics of the y locus in pepper: Its relation to capsanthin-capsorubin synthase and to fruit color. Theor. Appl. Genet. 2000, 101, 86–89. [Google Scholar] [CrossRef]
- Lefebvre, V.; Kuntz, M.; Camara, B.; Palloix, A. The capsanthin-capsorubin synthase gene: A candidate gene for the y locus controlling the red fruit colour in pepper. Plant Mol. Biol. 1998, 36, 785–789. [Google Scholar] [CrossRef]
- Thorup, T.A.; Tanyolac, B.; Livingstone, K.D.; Popovsky, S.; Paran, I.; Jahn, M. Candidate gene analysis of organ pigmentation loci in the Solanaceae. Proc. Natl. Acad. Sci. USA 2000, 97, 11192–11197. [Google Scholar] [CrossRef]
- Huh, J.H.; Kang, B.C.; Nahm, S.H.; Kim, S.; Ha, K.S.; Lee, M.H.; Kim, B.D. A candidate gene approach identified phytoene synthase as the locus for mature fruit color in red pepper (Capsicum spp.). Theor. Appl. Genet. 2001, 102, 524–530. [Google Scholar] [CrossRef]
- Barry, C.S.; McQuinn, R.P.; Chung, M.Y.; Besuden, A.; Giovannoni, J.J. Amino acid substitutions in homologs of the STAY-GREEN protein are responsible for the green-flesh and chlorophyll retainer mutations of tomato and pepper. Plant Physiol. 2008, 147, 179–187. [Google Scholar] [CrossRef]
- Kim, O.R.; Cho, M.C.; Kim, B.D.; Huh, J.H. A splicing mutation in the gene encoding phytoene synthase causes orange coloration in Habanero pepper fruits. Mol. Cells 2010, 30, 569–574. [Google Scholar] [CrossRef] [PubMed]
- Borovsky, Y.; Tadmor, Y.; Bar, E.; Meir, A.; Lewinsohn, E.; Paran, I. Induced mutation in β-CAROTENE HYDROXYLASE results in accumulation of β-carotene and conversion of red to orange color in pepper fruit. Theor. Appl. Genet. 2013, 126, 557–565. [Google Scholar] [CrossRef]
- Ha, S.H. Competitive activity as a constitutive promoter in the 5′-proximal regulatory region of the Capsicum capsanthin–capsorubin synthase gene. Plant Biotechnol. Rep. 2015, 9, 259–267. [Google Scholar] [CrossRef]
- Kilcrease, J.; Rodriguez-Uribe, L.; Richins, R.D.; Arcos, J.M.; Victorino, J.; O’Connell, M.A. Correlations of carotenoid content and transcript abundances for fibrillin and carotenogenic enzymes in Capsicum annum fruit pericarp. Plant Sci. 2015, 232, 57–66. [Google Scholar] [CrossRef]
- Tian, S.L.; Li, L.; Chai, W.G.; Shah SN, M.; Gong, Z.H. Effects of silencing key genes in the capsanthin biosynthetic pathway on fruit color of detached pepper fruits. BMC Plant Biol. 2014, 14, 314. [Google Scholar] [CrossRef] [PubMed]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef] [PubMed]
- Wan, H.J.; Yuan, W.; Ruan, M.Y.; Ye, Q.J.; Wang, R.Q.; Li, Z.M.; Zhou, G.Z.; Yao, Z.P.; Zhao, J.; Liu, S.J.; et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophys. Res. Commun. 2011, 416, 24–30. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Breithaupt, D.E.; Schwack, W. Determination of free and bound carotenoids in paprika (Capsicum annuum L.) by LC/MS. Eur. Food Res. Technol. 2000, 211, 52–55. [Google Scholar] [CrossRef]
- Delgado-Vargas, F.; Paredes-López, O. Natural Colorants for Food and Nutraceutical Uses. In Natural Colorants for Food & Nutraceutical Uses; CRC Press: Boca Raton, FL, USA, 2002. [Google Scholar] [CrossRef]
- Cervantes-Paz, B.; Yahia, E.M.; de Jesús Ornelas-Paz, J.; Victoria-Campos, C.I.; Ibarra-Junquera, V.; Pérez-Martínez, J.D.; Escalante-Minakata, P. Antioxidant activity and content of chlorophylls and carotenoids in raw and heat-processed Jalapeño peppers at intermediate stages of ripening. Food Chem. 2014, 146, 188–196. [Google Scholar] [CrossRef] [PubMed]
- Giuffrida, D.; Dugo, P.; Torre, G.; Bignardi, C.; Cavazza, A.; Corradini, C.; Dugo, G. Characterization of 12 Capsicum varieties by evaluation of their carotenoid profile and pungency determination. Food Chem. 2013, 140, 794–802. [Google Scholar] [CrossRef] [PubMed]
- Moehs, C.P.; Tian, L.; Osteryoung, K.W.; Dellapenna, D. Analysis of carotenoid biosynthetic gene expression during marigold petal development. Plant Mol. Biol. 2001, 45, 281–293. [Google Scholar] [CrossRef] [PubMed]
- Ronen, G.; Carmel-Goren, L.; Zamir, D.; Hirschberg, J. An alternative pathway to β-carotene formation in plant chromoplasts discovered by map-based cloning of β and old-gold color mutations in tomato. Proc. Natl. Acad. Sci. USA 2000, 97, 11102–11107. [Google Scholar] [CrossRef]
- Cazzonelli, C.I.; Pogson, B.J. Source to sink: Regulation of carotenoid biosynthesis in plants. Trends Plant Sci. 2010, 15, 266–274. [Google Scholar] [CrossRef] [PubMed]
- Burkhardt, P.K.; Beyer, P.; Wünn, J.; Klöti, A.; Armstrong, G.A.; Schledz, M.; Lintig, J.V.; Potrykus, I. Transgenic rice (Oryza sativa) endosperm expressing daffodil (Narcissus pseudonarcissus) phytoene synthase accumulates phytoene, a key intermediate of provitamin A biosynthesis. Plant J. 1997, 11, 1071–1078. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.E.; Lv, P.; Gu, H.H. Studies on carotenoids in watermelon flesh. Agric. Sci. 2013, 4, 13–20. [Google Scholar] [CrossRef]
- Ukibe, K.; Hashida, K.; Yoshida, N.; Takagi, H. Metabolic engineering of Saccharomyces cerevisiae for astaxanthin production and oxidative stress tolerance. Appl. Environ. Microbiol. 2009, 75, 7205–7211. [Google Scholar] [CrossRef]
- Breitenbach, J.; Visser, H.; Verdoes, J.C.; Ooyen AJ, J.V.; Sandmann, G. Engineering of geranylgeranyl pyrophosphate synthase levels and physiological conditions for enhanced carotenoid and astaxanthin synthesis in Xanthophyllomyces dendrorhous. Biotechnol. Lett. 2011, 33, 755–761. [Google Scholar] [CrossRef]
- Csernetics, A.; Nagy, G.; Iturriaga, E.A.; Szekeres, A.; Eslava, A.P.; Vágvölgyi, C.; Papp, T. Expression of three isoprenoid biosynthesis genes and their effects on the carotenoid production of the zygomycete Mucor circinelloides. Fungal Genet. Biol. 2011, 48, 696–703. [Google Scholar] [CrossRef]
- Lücker, J.; Bouwmeester, H.J.; Schwab, W.; Blaas, J.; Van Der Plas, L.H.; Verhoeven, H.A. Expression of Clarkia S-linalool synthase in transgenic petunia plants results in the accumulation of S-linalyl-β-D-glucopyranoside. Plant J. 2001, 27, 315–324. [Google Scholar] [CrossRef] [PubMed]
- Kuntz, M.; Römer, S.; Suire, C.; Hugueney, P.; Weil, J.H.; Schantz, R.; Camara, B. Identification of a cDNA for the plastid-located geranylgeranyl pyrophosphate synthase from Capsicum annuum: Correlative increase in enzyme activity and transcript level during fruit ripening. Plant J. 1992, 2, 25–34. [Google Scholar] [CrossRef]
- Dyachenko, E.A.; Filyushin, M.A.; Efremov, G.I.; Dzhos, E.A.; Shchennikova, A.V.; Kochieva, E.Z. Structural and functional features of phytoene synthase isoforms PSY1 and PSY2 in pepper Capsicum annuum L. cultivars. Vavilovskii Zhurnal Genet Selektsii. 2020, 24, 687–696. [Google Scholar] [CrossRef]
- Jang, S.J.; Jeong, H.B.; Jung, A.; Kang, M.Y.; Kim, S.; Ha, S.H.; Kwon, J.K.; Kang, B.C. Phytoene synthase 2 can compensate for the absence of PSY1 in the control of color in Capsicum fruit. J. Exp. Bot. 2020, 71, 3417–3427. [Google Scholar] [CrossRef] [PubMed]
- Peguero-Pina, J.J.; Gil-Pelegrín, E.; Morales, F. Three pools of zeaxanthin in Quercus coccifera leaves during light transitions with different roles in rapidly reversible photoprotective energy dissipation and photoprotection. J. Exp. Bot. 2013, 64, 1649–1661. [Google Scholar] [CrossRef] [PubMed]
- Pogson, B.J.; Rissler, H.M. Genetic manipulation of carotenoid biosynthesis and photoprotection. Philos. Trans. R. Soc. B Biol. Sci. 2000, 355, 1395–1403. [Google Scholar] [CrossRef]
- Tian, L.; Magallanes-Lundback, M.; Musetti, V.; DellaPenna, D. Functional analysis of β- and epsilon-ring carotenoid hydroxylases in Arabidopsis. Plant Cell 2003, 15, 1320–1332. [Google Scholar] [CrossRef]
- Liu, Y.H.; Lv, J.H.; Liu, Z.B.; Wang, J.; Yang, B.Z.; Chen, W.C.; Ou, L.J.; Dai, X.Z.; Zhang, Z.Q.; Zou, X.X. Integrative analysis of metabolome and transcriptome reveals the mechanism of color formation in pepper fruit (Capsicum annuum L.). Food Chem. 2020, 306, 125629. [Google Scholar] [CrossRef]
- Wang, Q.; Cao, T.J.; Zheng, H.; Zhou, C.F.; Wang, Z.; Wang, R.; Lu, S. Manipulation of Carotenoid Metabolic Flux by Lycopene Cyclization in Ripening Red Pepper (Capsicum annuum var. conoides) Fruits. J. Agric. Food Chem. 2019, 67, 4300–4310. [Google Scholar] [CrossRef]
- Blas, A.L.; Ming, R.; Liu, Z.Y.; Veatch, O.J.; Paull, R.E.; Moore, P.H.; Yu, Q.Y. Cloning of the papaya chromoplast-specific lycopene β-cyclase, Cpcyc-b, controlling fruit flesh color reveals conserved microsynteny and a recombination hot spot. Plant Physiol. 2010, 152, 2013–2022. [Google Scholar] [CrossRef]
- Ahrazem, O.; Rubio-Moraga, A.; López, R.C.; Gómez-Gómez, L. The expression of a chromoplast-specific lycopene beta cyclase gene is involved in the high production of saffron’s apocarotenoid precursors. J. Exp. Bot. 2010, 61, 105–119. [Google Scholar] [CrossRef]
- Bouvier, F.; Hugueney, P.; d’Harlingue, A.; Kuntz, M.; Camara, B. Xanthophyll biosynthesis in chromoplasts: Isolation and molecular cloning of an enzyme catalyzing the conversion of 5,6-epoxycarotenoid into ketocarotenoid. Plant J. 1994, 6, 45–54. [Google Scholar] [CrossRef]
- Suematsu, K.; Tanaka, M.; Kurata, R.; Kai, Y.M. Comparative transcriptome analysis implied a ZEP paralog was a key gene involved in carotenoid accumulation in yellow-fleshed sweetpotato. Sci. Rep. 2020, 10, 20607. [Google Scholar] [CrossRef]
- Tian, S.L.; Li, Z.; Li, L.; Shah SN, M.; Gong, Z.H. Analysis of tandem repeat units of the promoter of Capsanthin/capsorubin synthase (Ccs) gene in pepper fruit. Physiol. Mol. Biol. Plants 2017, 23, 685–691. [Google Scholar] [CrossRef] [PubMed]
- Lang, Y.Q.; Yanagawa, S.; Sasanuma, T.; Sasakuma, T. Orange Fruit Color in Capsicum due to deletion of capsanthin-capsorubin synthesis gene. Breed. Sci. 2004, 54, 33–39. [Google Scholar] [CrossRef]
- Li, Z.; Wang, S.; Gui, X.L.; Chang, X.B.; Gong, Z.H. A further analysis of the relationship between yellow ripe-fruit color and the capsanthin-capsorubin synthase gene in pepper (Capsicum sp.) indicated a new mutant variant in C. annuum and a tandem repeat structure in promoter region. PLoS ONE 2013, 8, e61996. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′-3′) | Purpose | Product Size (bp) | Tm (°C) |
---|---|---|---|---|
Ggps-F/R | GAACCTTGTTGATTTATGGGC CCAACATAAGCACACTGAAAG | PCR amplification | 1110 | 57 |
Psy-F/R | ATGTCTGTTGCCTTGTTATGG CCTGATTTCATGTTCTTGTAGAAGG | PCR amplification | 2844 | 58 |
Lcyb-F/R | ATGGATACGCTCTTGAGAACCCCAAAC TCATTCTTTATCCTGTAACAAATTGTT | PCR amplification | 1497 | 58 |
CRTY-F/R | ATGGCTGCTGAAATTTCAATCTCCG CATAATCTCTTCGAACTTTTAATTC | PCR amplification | 2024 | 58 |
Zep-F/R | ATGAAGCAATTTGTGCTAAGTTTGG TCACTTTTGACATAATTTTCCGCAA | PCR amplification | 510 | 57.5 |
Ccs-F/R | TCTCTAATGGAAACCCTTCTAAAGCC TCAAAGGCTCTCTATTGCTAGATTGC | PCR amplification | 1497 | 58 |
RT-Ggps-F/R | CATTGTCAACTCCACGGC CCGTAGATTTTGTGGTTGGT | qRT-PCR | 158 | 60 |
RT-Psy-F/R | ACAGGCAGGTCTATCCGACGAAG ACAACAGCAGAGATGCCAACACAG | qRT-PCR | 164 | 60 |
RT-Lcyb-F/R | GTTGTTGGAATTGGTGGCACAGC ATGGCATTGGCAACGACAGGAG | qRT-PCR | 182 | 60 |
RT-CRTY-F/R | GCACGAGTCACACCATAGACCAAG CGTGAACGAACATGTAGGCCATCC | qRT-PCR | 155 | 60 |
RT-Zep-F/R | TGCACTTCATCCAATGACACCT GCCTCTGAAATGCACCTTGC | qRT-PCR | 164 | 60 |
RT-Ccs-F/R | AGCACCCACATCAAAGCCAG GTGGTGAAGGGTCAACGCAA | qRT-PCR | 145 | 60 |
Ubi3-F/R | TGTCCATCTGCTCTCTGTTG CACCCCAAGCACAATAAGAC | Internal reference | 155 | 60 |
Gene Name | Total Amino Acids | Molecular Weight of the Protein | Molecular Formula | Isoelectric Point | Coefficient of Instability | Positively Charged Amino Acids | Negatively Charged Amino Acids | Total Hydrophilicity Value |
---|---|---|---|---|---|---|---|---|
Ggps | 369 | 40,173.41 | C1780H2889N485O536S16 | 6.12 | 37.01 | 43 | 47 | −0.012 |
Psy | 419 | 47,066.05 | C2083H3320N588O614S20 | 9.01 | 53.5 | 60 | 52 | −0.242 |
Lcyb | 498 | 55,626.23 | C2498H3930N668O719S25 | 6.34 | 37.73 | 54 | 58 | −0.073 |
Crtz | 315 | 35,317.91 | C1612H2475N431O434S15 | 8.52 | 54.43 | 35 | 32 | 0.012 |
Zep | 169 | 18,995.24 | C842H1371N227O246S12 | 8.95 | 38.15 | 24 | 18 | −0.073 |
Ccs | 498 | 56,658.66 | C2549H4007N689O718S27 | 8.77 | 44.15 | 66 | 58 | −0.216 |
Protein Name | α-Helix | Extension | Β-Turn | Random Coil |
---|---|---|---|---|
Ggps | 54.74% | 6.5% | 5.15% | 33.6% |
Psy | 51.79% | 12.17% | 3.82% | 32.22% |
Lcyb | 39.56% | 16.87% | 6.02% | 37.55% |
Crtz | 45.08% | 15.24% | 5.4% | 34.29% |
Zep | 56.21% | 5.92% | 4.73% | 33.14% |
Ccs | 34.54% | 17.27% | 4.02% | 44.18% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, P.; Wang, Y.; Wen, J.; Ren, Y.; Zhong, Q.; Li, Q. Cloning and Analysis of Expression of Genes Related to Carotenoid Metabolism in Different Fruit Color Mutants of Pepper (Capsicum annuum L.). Genes 2024, 15, 315. https://doi.org/10.3390/genes15030315
Feng P, Wang Y, Wen J, Ren Y, Zhong Q, Li Q. Cloning and Analysis of Expression of Genes Related to Carotenoid Metabolism in Different Fruit Color Mutants of Pepper (Capsicum annuum L.). Genes. 2024; 15(3):315. https://doi.org/10.3390/genes15030315
Chicago/Turabian StyleFeng, Penglong, Yayi Wang, Junqin Wen, Yanjing Ren, Qiwen Zhong, and Quanhui Li. 2024. "Cloning and Analysis of Expression of Genes Related to Carotenoid Metabolism in Different Fruit Color Mutants of Pepper (Capsicum annuum L.)" Genes 15, no. 3: 315. https://doi.org/10.3390/genes15030315
APA StyleFeng, P., Wang, Y., Wen, J., Ren, Y., Zhong, Q., & Li, Q. (2024). Cloning and Analysis of Expression of Genes Related to Carotenoid Metabolism in Different Fruit Color Mutants of Pepper (Capsicum annuum L.). Genes, 15(3), 315. https://doi.org/10.3390/genes15030315