Ribonuclease D Processes a Small RNA Regulator of Multicellular Development in Myxobacteria
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains
2.2. Plasmid and Strain Construction
2.3. Developmental Assays
2.4. Northern Blot
2.5. RNase D Purification
2.6. In Vitro Processing of Pxr by RNase D
3. Results
3.1. The TnE1 Insertion in rnd Restores Developmental Proficiency
3.2. Disruption of rnd Is Sufficient to Rescue Development
3.3. Complementation of Defective rnd Prevents Development
3.4. Complementation of rnd Restores Pxr-L and Pxr-S Accumulation
3.5. RNase D Processes Pxr-XL to Pxr-L In Vitro
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Wagner, E.G.H.; Romby, P. Small RNAs in Bacteria and Archaea Who They Are, What They Do, and How They Do It. Adv. Genet. 2015, 90, 133–208. [Google Scholar] [PubMed]
- Jahn, N.; Preis, H.; Wiedemann, C.; Brantl, S. BsrG/SR4 from Bacillus subtilis—The first temperature-dependent type I toxin–antitoxin system. Mol. Microbiol. 2012, 83, 579–598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gottesman, S.; Storz, G. Bacterial Small RNA Regulators: Versatile Roles and Rapidly Evolving Variations. Cold Spring Harb. Perspect. Biol. 2010, 3, a003798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, L.S.; Storz, G. Regulatory RNAs in bacteria. Cell 2009, 136, 615–628. [Google Scholar] [CrossRef] [Scilit]
- Vogel, J.; Luisi, B.F. Hfq and its constellation of RNA. Nat. Rev. Microbiol. 2011, 9, 578–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lenz, D.H.; Miller, M.B.; Zhu, J.; Kulkarni, R.V.; Bassler, B.L. CsrA and three redundant small RNAs regulate quorum sensing in Vibrio cholerae. Mol. Microbiol. 2005, 58, 1186–1202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romeo, T.; Vakulskas, C.A.; Babitzke, P. Posttranscriptional regulation on a global scale: Form and function of Csr/Rsm systems. Environ. Microbiol. 2013, 15, 313–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fröhlich, K.S.; Papenfort, K.; Fekete, A.; Vogel, J. A small RNA activates CFA synthase by isoform-specific mRNA stabilization. EMBO J. 2013, 32, 2963–2979. [Google Scholar] [CrossRef] [Scilit]
- Morfeldt, E.; Taylor, D.; Gabain, A.; Arvidson, S. Activation of α-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. EMBO J. 1995, 14, 4569–4577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beisel, C.L.; Storz, G. Base pairing small RNAs and their roles in global regulatory networks. FEMS Microbiol. Rev. 2010, 34, 866–882. [Google Scholar] [CrossRef] [Scilit]
- Storz, G.; Vogel, J.; Wassarman, K.M. Regulation by Small RNAs in Bacteria: Expanding Frontiers. Mol. Cell 2011, 43, 880–891. [Google Scholar] [CrossRef] [Scilit]
- Delihas, N.; Forst, S. MicF: An antisense RNA gene involved in response of Escherichia coli to global stress factors. J. Mol. Biol. 2001, 313, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altuvia, S.; Weinstein-Fischer, D.; Zhang, A.; Postow, L.; Storz, G. A small, stable RNA induced by oxidative stress: Role as a pleiotropic regulator and antimutator. Cell 1997, 90, 43–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masse, E.; Gottesman, S. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 2002, 99, 4620–4625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomason, M.K.; Fontaine, F.; Lay, N.D.; Storz, G. A small RNA that regulates motility and biofilm formation in response to changes in nutrient availability in Escherichia coli. Mol. Microbiol. 2012, 84, 17–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmqvist, E.; Wagner, E.G.H. Impact of bacterial sRNAs in stress responses. Biochem. Soc. Trans. 2017, 45, 1203–1212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sonnleitner, E.; Gonzalez, N.; Sorger-Domenigg, T.; Heeb, S.; Richter, A.S.; Backofen, R.; Williams, P.; Hüttenhofer, A.; Haas, D.; Bläsi, U. The small RNA PhrS stimulates synthesis of the Pseudomonas aeruginosa quinolone signal. Mol. Microbiol. 2011, 80, 868–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lay, N.D.; Gottesman, S. The Crp-Activated Small Noncoding Regulatory RNA CyaR (RyeE) Links Nutritional Status to Group Behavior. J. Bacteriol. 2009, 191, 461–476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lenz, D.H.; Mok, K.C.; Lilley, B.N.; Kulkarni, R.V.; Wingreen, N.S.; Bassler, B.L. The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell 2004, 118, 69–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shao, Y.; Bassler, B.L. Quorum-sensing non-coding small RNAs use unique pairing regions to differentially control mRNA targets. Mol. Microbiol. 2012, 83, 599–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmqvist, E.; Reimegård, J.; Sterk, M.; Grantcharova, N.; Römling, U.; Wagner, E.G.H. Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis. EMBO J. 2010, 29, 1840–1850. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.T.N.; Yuan, X.; Velicer, G.J. Adaptive evolution of an sRNA that controls Myxococcus development. Science 2010, 328, 993. [Google Scholar] [CrossRef] [Scilit]
- Kaiser, D. Signaling in myxobacteria. Annu. Rev. Microbiol. 2004, 58, 75–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.T.N.; Kleiner, M.; Velicer, G.J. Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria. J. Bacteriol. 2016, 198, 3142–3151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Velicer, G.J.; Kroos, L.; Lenski, R.E. Loss of social behaviors by Myxococcus xanthus during evolution in an unstructured habitat. Proc. Natl. Acad. Sci. USA 1998, 95, 12376–12380. [Google Scholar] [CrossRef] [Scilit]
- Chen, I.C.K.; Satinsky, B.M.; Velicer, G.J.; Yu, Y.T.N. sRNA-pathway genes regulating myxobacterial development exhibit clade-specific evolution. Evol. Dev. 2019, 21, 82–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Deutscher, M.P. The role of individual exoribonucleases in processing at the 3′ end of Escherichia coli tRNA precursors. J. Biol. Chem. 1994, 269, 6064–6071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Pandit, S.; Deutscher, M.P. 3′ Exoribonucleolytic trimming is a common feature of the maturation of small, stable RNAs in Escherichia coli. Proc. Natl. Acad. Sci. USA 1998, 95, 2856–2861. [Google Scholar] [CrossRef] [Scilit]
- Kaiser, D. Social gliding is correlated with the presence of pili in Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 1979, 76, 5952–5956. [Google Scholar] [CrossRef] [Scilit]
- Velicer, G.J.; Raddatz, G.; Keller, H.; Deiss, S.; Lanz, C.; Dinkelacker, I.; Schuster, S.C. Comprehensive mutation identification in an evolved bacterial cooperator and its cheating ancestor. Proc. Natl. Acad. Sci. USA 2006, 103, 8107–8112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iniesta, A.A.; García-Heras, F.; Abellón-Ruiz, J.; Gallego-García, A.; Elías-Arnanz, M. Two Systems for Conditional Gene Expression in Myxococcus xanthus Inducible by Isopropyl-β-D-Thiogalactopyranoside or Vanillate. J. Bacteriol. 2012, 194, 5875–5885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bretscher, A.P.; Kaiser, D. Nutrition of Myxococcus xanthus, a fruiting myxobacterium. J. Bacteriol. 1978, 133, 763–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gebert, L.F.R.; MacRae, I.J. Regulation of microRNA function in animals. Nat. Rev. Mol. Cell Biol. 2018, 20, 21–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faubladier, M.; Cam, K.; Bouché, J.P. Escherichia coli cell division inhibitor DicF-RNA of the dicB operon: Evidence for its generation in vivo by transcription termination and by RNase III and RNase E-dependent processing. J. Mol. Biol. 1990, 212, 461–471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, B.M.; Waldor, M.K. RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA. Mol. Microbiol. 2007, 65, 373–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.M.; Shin, J.H.; Cho, Y.B.; Roe, J.H. Inverse regulation of Fe- and Ni-containing SOD genes by a Fur family regulator Nur through small RNA processed from 3′UTR of the sodF mRNA. Nucleic Acids Res. 2013, 42, 2003–2014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyakoshi, M.; Chao, Y.; Vogel, J. Cross talk between ABC transporter mRNAs via a target mRNA-derived sponge of the GcvB small RNA. EMBO J. 2015, 34, 1478–1492. [Google Scholar] [CrossRef] [Scilit]
- Miyakoshi, M.; Chao, Y.; Vogel, J. Regulatory small RNAs from the 3′ regions of bacterial mRNAs. Curr. Opin. Microbiol. 2015, 24, 132–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lund, E.; Güttinger, S.; Calado, A.; Dahlberg, J.E.; Kutay, U. Nuclear Export of MicroRNA Precursors. Science 2004, 303, 95–98. [Google Scholar] [CrossRef] [Scilit]
- Miyakoshi, M.; Matera, G.; Maki, K.; Sone, Y.; Vogel, J. Functional expansion of a TCA cycle operon mRNA by a 3′ end-derived small RNA. Nucleic Acids Res. 2018, 47, 2075–2088. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Argaman, L.; Hershberg, R.; Vogel, J.; Bejerano, G.; Wagner, E.G.H.; Margalit, H.; Altuvia, S. Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr. Biol. 2001, 11, 941–950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tse, H.; Gill, R.E. Bypass of A- and B-Signaling Requirements for Myxococcus xanthus Development by Mutations in spdR. J. Bacteriol. 2002, 184, 1455–1457. [Google Scholar] [CrossRef] [Scilit]
- Hager, E.; Tse, H.; Gill, R.E. Identification and characterization of spdR mutations that bypass the BsgA protease-dependent regulation of developmental gene expression in Myxococcus xanthus. Mol. Microbiol. 2001, 39, 765–780. [Google Scholar] [CrossRef] [Scilit]
- Bretl, D.J.; Kirby, J.R. Molecular Mechanisms of Signaling in Myxococcus xanthus Development. J. Mol. Biol. 2016, 428, 3805–3830. [Google Scholar] [CrossRef] [Scilit]
- Baier, F.; Hong, N.; Yang, G.; Pabis, A.; Miton, C.M.; Barrozo, A.; Carr, P.D.; Kamerlin, S.C.; Jackson, C.J.; Tokuriki, N. Cryptic genetic variation shapes the adaptive evolutionary potential of enzymes. eLife 2019, 8, e40789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khanal, A.; McLoughlin, S.Y.; Kershner, J.P.; Copley, S.D. Differential Effects of a Mutation on the Normal and Promiscuous Activities of Orthologs: Implications for Natural and Directed Evolution. Mol. Biol. Evol. 2015, 32, 100–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khersonsky, O.; Tawfik, D.S. Enzyme Promiscuity: A Mechanistic and Evolutionary Perspective. Annu. Rev. Biochem. 2010, 79, 471–505. [Google Scholar]
- Velicer, G.J.; Mendes-Soares, H.; Wielgoss, S. Whence comes Social Diversity? Ecological and Evolutionary Analysis of the Myxobacteria. In Myxobacteria: Genomics, Cellular and Molecular Biology; Yang, Z., Higgs, P.I., Eds.; Caister Academic Press: Norfolk, UK, 2014. [Google Scholar]





| Strain/Primer/Plasmid | Description | Reference |
|---|---|---|
| OC, also known as GVB207.3 | Developmentally defective descendent of GJV1 | [30] |
| OC::TnE1 | MXAN_5981 transposon-insertion mutant of OC, developmentally proficient | [26] |
| OC::TnE1-r | Reconstructed OC::TnE1 transposon mutant | This study |
| OC∆pxr | pxr deletion mutant of OC | [22] |
| GJV1∆pxr | pxr deletion mutant of GJV1 | [22] |
| OC::TnE1pMR3629rnd | OC::TnE1 containing MXAN_5981 under a vanillate-inducible promotor. | This study |
| OC::MXAN_5982 | MXAN_5982 plasmid-interruption mutant | This study |
| GJV1 | Laboratory wild-type, developmentally proficient, evolutionary ancestor of OC | [30] |
| GJV1::TnE1 | Reconstructed GJV1 transposon-insertion mutant | This study |
| M13 | 5′GCCAGGGTTTTCCCAGTCACGA3′ | |
| M13r | 5′GAGCGGATAACAATTTCACACAGG3′ | |
| GV545 | 5′CCCGGTCCGCTAGCCTGCCTCCC3′ | This study |
| GV619 | 5′;TACACGATGACCCAGTTCCA3′ | This study |
| GV620 | 5′GACTCGTTGAGCCAGAGGTC3′ | This study |
| GV700 | 5′GGTACGCGTAACGTTCGAATTC3′ | This study |
| GV713 | 5′TTTTCATATGCCGACCTACCCGCAAGGTGCCG3 | This study |
| GV714 | 5′TGCCGGCCCCACCTTCACTTCAGGCG3 | This study |
| GV716 | 5′TCTCGAGACATCATCATCATCATCATATGCCGACCTACCCGC3′ | This study |
| pCR-rnd | pCR-Blunt containing the rnd insertion sequence | This study |
| pMR3629-rnd | pMR3629 containing the rnd insertion sequence | This study |
| pCR-5982 | pCR-Blunt containing the MXAN_5982 insertion sequence | This study |
| pBAD-his-rnd | Overexpression plasmid for histidine-tagged rnd | This study |
| pMR3629 | Plasmid containing a vanillate-inducible promotor and oxytetracycline resistance | [31] |
| pCR-Blunt | Invitrogen cloning vector | Invitrogen |
| pBAD-Myc-HisA | Invitrogen protein expression vector | Invitrogen |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cossey, S.M.; Velicer, G.J.; Yu, Y.-T.N. Ribonuclease D Processes a Small RNA Regulator of Multicellular Development in Myxobacteria. Genes 2023, 14, 1061. https://doi.org/10.3390/genes14051061
Cossey SM, Velicer GJ, Yu Y-TN. Ribonuclease D Processes a Small RNA Regulator of Multicellular Development in Myxobacteria. Genes. 2023; 14(5):1061. https://doi.org/10.3390/genes14051061
Chicago/Turabian StyleCossey, Sarah M., Gregory J. Velicer, and Yuen-Tsu Nicco Yu. 2023. "Ribonuclease D Processes a Small RNA Regulator of Multicellular Development in Myxobacteria" Genes 14, no. 5: 1061. https://doi.org/10.3390/genes14051061
APA StyleCossey, S. M., Velicer, G. J., & Yu, Y.-T. N. (2023). Ribonuclease D Processes a Small RNA Regulator of Multicellular Development in Myxobacteria. Genes, 14(5), 1061. https://doi.org/10.3390/genes14051061

