Next Article in Journal
Association between IRF6, TP63, GREM1 Gene Polymorphisms and Non-Syndromic Orofacial Cleft Phenotypes in Vietnamese Population: A Case–Control and Family-Based Study
Next Article in Special Issue
Heterochromatin Is Not the Only Place for satDNAs: The High Diversity of satDNAs in the Euchromatin of the Beetle Chrysolina americana (Coleoptera, Chrysomelidae)
Previous Article in Journal
Editorial on Genetic Diversity of Plant Tolerance to Environmental Restraints
Previous Article in Special Issue
Optical Genome Mapping: Integrating Structural Variations for Precise Homologous Recombination Deficiency Score Calculation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection

1
Plant Breeding Institute, School of Life and Environmental Sciences, Faculty of Science, The University of Sydney, 107 Cobbitty Road, Cobbitty, NSW 2570, Australia
2
AgriBioCentre, Department of Environment and Primary Industries, La Trobe Research and Development Park, Bundoora, VIC 3082, Australia
3
School of Science, Western Sydney University, Bourke Road, Richmond, NSW 2753, Australia
*
Authors to whom correspondence should be addressed.
Genes 2023, 14(11), 1993; https://doi.org/10.3390/genes14111993
Submission received: 3 October 2023 / Revised: 19 October 2023 / Accepted: 23 October 2023 / Published: 25 October 2023
(This article belongs to the Special Issue Commemorating the Launch of the Section "Cytogenomics")

Abstract

:
Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is among the major threats to global wheat production. The common wheat landraces AUS27506 and AUS27894 displayed stripe rust resistance against several commercially prevailing Pst pathotypes. These genotypes were crossed with a stripe-rust-susceptible landrace AUS27229 to understand the inheritance of resistance and to determine the genomic location(s) of underlying gene(s). F3 generations of crosses AUS27506/AUS27229 and AUS27894/AUS27229 showed monogenic segregation for stripe rust resistance under greenhouse conditions. The absence of segregation for stripe rust response among the AUS27506/AUS27894-derived F3 population suggested that both genotypes carry the same gene. The stripe rust resistance gene carried by AUS27506 and AUS27894 was tentatively named YrAW4. A bulked segregant analysis placed YrAW4 in the long arm of chromosome 2B. The AUS27506/AUS27229 F3 population was enhanced to develop an F6 recombinant inbred line (RIL) population for detailed mapping of chromosome 2BL. DArT-based SSR, STS and SNP markers were employed to enrich the 2BL map. DArT-based STS markers sun481 and SNP marker IWB12294 flanked YrAW4 proximally (1.8 cM) and distally (1.2 cM), respectively. Deletion mapping placed sun481 in the deletion bin 2BL-5. All stripe rust resistance genes, previously located on chromosome 2BL, neither express an infection type like YrAW4, nor are they mapped in the deletion bin 2BL-5. Hence, YrAW4 represented a new locus and was formally named Yr72. The usefulness of the markers IWB12294 and sun481 in marker-assisted selection was demonstrated by the amplification of alleles that are different to that linked with Yr72 in 19 common wheat and two durum wheat cultivars.

1. Introduction

Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most destructive diseases of wheat worldwide [1,2]. The first stripe rust incursion in eastern Australia occurred in 1979 [3] and in western Australia in 2002 [4]. Subsequently, it caused several epidemics with devastating impacts on the agricultural industry, and an approximate yield reduction of 84% in certain areas [5]. Now, the stripe rust pathogen has a history of 44 years in Australia, and it still remains a major constraint for wheat production, with an estimated average annual loss of AUD 127 m [6].
Although more than 80 loci for stripe rust resistance have been characterized and formally named (https://wheat.pw.usda.gov/GG3/wgc; accessed on 21 July 2023), most of these belong to the race-specific category. Resistance genes that condition high level of resistance often succumb to the acquisition of virulence in pathogen populations. Wellings and McIntosh [7] summarized the evolution of virulence in the Australian Pst population and demonstrated the stepwise attainment in virulence for stripe rust resistance genes YrA, Yr6 and Yr7 individually and in different combinations. The other commercially important event included the detection of virulence for Yr17 in 1999. All derivatives of the 1979 introduction (104 E137A−) were virulent on genotypes carrying Yr3 and Yr4. In contrast, the 2002 introduction (134 E16A+) and all its current derivatives are avirulent on Yr3 and Yr4. In addition, this group carried virulence for resistance genes Yr8 and Yr9 that have not been deployed widely in Australian wheat cultivars. Stripe rust resistance genes Yr6, Yr7, Yr9, Yr17 and Yr27 have been postulated in spring wheat cultivars grown worldwide. Pathotypes carrying virulence for these resistance genes have been reported in many countries, including Australia.
All-stage resistance (ASR) and adult plant resistance (APR) are two main categories of resistance to rust diseases in wheat. ASR genes protect plants throughout all growth stages, while APR genes provide post-seedling resistance. To achieve long-lasting control, it is essential to combine ASR and APR genes in a single cultivar, which is now possible through the advancement in molecular technologies. This technological advancement has enabled the efficient mapping of resistance genes and identification of closely linked markers via whole genome scanning [8] using different high-throughput platforms such as diversity arrays technology (DArT) [9,10], genotyping-by-sequencing (GBS) [8], selective genotyping (SG) [11], and SNP-genotyping arrays [12]. The development of an ordered draft sequence of the 17-gb with more than 75,000 genes positioned along 21 chromosomes of wheat [13] adds further impetus to mapping and marker development research.
To achieve durable resistance to stripe rust, the discovery and characterization of diverse sources of resistance is essential. The Watkins Collection of common wheat landraces [14] was screened [H.S. Bariana unpublished results] to identify genotypes for detailed genetic analysis. Daetwyler et al. [15] conducted genomic prediction for rust resistance among 247 common wheat landraces from the Watkins Collection and predicted the presence of some uncharacterized rust resistance loci. The stripe rust resistance genes Yr47 (AUS28183 and AUS28187), Yr63 (AUS27955), Yr81 (AUS 27430) and Yr82 (AUS27969) were mapped in chromosomes 5B, 7B, 6A and 3B, respectively, and the leaf rust resistance genes Lr52 (AUS28183), Lr79 (AUS26582; durum landrace) and Lr82 (AUS27352) were mapped in chromosomes 5B, 3B and 2B, respectively (https://wheat.pw.usda.gov/GG3/wgc; accessed on 21 July 2023). Two landraces, AUS27506 and AUS27894, exhibited seedling resistance against a range of Pst pathotypes in Australia. This study covers the molecular mapping of stripe rust resistance carried by these genotypes and identification of resistance-linked markers for marker assisted selection.

2. Materials and Methods

2.1. Plant Material

Arthur Watkins, an English botanist, collected wheat genotypes from more than 30 locations worldwide during the 1920s to 1930s [14]. A purified version of around 830 common wheat landraces is stored at the Australian Grains GeneBank, Horsham, VIC, Australia (previously known as Australian Winter Cereal Collection, Tamworth, NSW, Australia). Seed of these accessions was kindly provided by staff of the Australian Winter Cereal Collection, Tamworth, NSW, Australia. These accessions were screened under field and greenhouse conditions to identify stripe-rust-resistant accessions. Stripe-rust-resistant accessions AUS27506 and AUS27894, collected from France and Spain, respectively, were crossed with a susceptible landrace AUS27229. F3 populations comprising 99 and 77 families were developed from AUS27506/AUS27229 and AUS27894/AUS27229 crosses. Only AUS27506/AUS27229 F3 was advanced to generate an F6 recombinant inbred line (RIL) population for further analysis. AUS27894 and AUS27506 were crossed to determine the allelic relationship of the gene(s) carried by these genotypes. Nineteen Australian common wheat cultivars and two durum wheats were used to validate markers closely linked with the resistance gene identified in this study. These cultivars represented all three wheat belts of Australia (eastern, southern and western).

2.2. Greenhouse Tests

Twenty seeds of each AUS27506/AUS27229 F3 line and 8 to 10 seeds of each RIL were sown in 9 cm plastic pots filled with mixture of pine bark and river sand (2:1 ratio) and fertilized with 20 g of complete fertilizer Aquasol dissolved in 10 L of water. Parental genotypes and the susceptible control Morocco were sown in each experiment. AUS27894/AUS27506 F3 families and AUS27506/AUS27229 F6 RIL population were evaluated against Pst pathotype 134 E16A+17+27+ (Plant Breeding Institute, Cobbitty culture no. 617). This pathotype is virulent on stripe rust resistance genes YrA (Yr73+Yr74), Yr6, Yr7, Yr8, Yr9, Yr17 and Yr27. It is avirulent on Yr72. Material was kept in rust-free temperature-controlled room maintained at 20 °C after sowing and watered daily. One-week-old seedlings were fertilized with 20 g of Urea dissolved in 10 L of water. Inoculations were made at the 2-leaf stage (10–12 days after sowing) using purified Pst inoculum (134 E16A+17+27+) stored in liquid Nitrogen at the Plant Breeding Institute, Cobbitty, NSW, Australia. The collection and storage procedure of inoculum is described in McIntosh et al. [16]. Stripe rust inoculations were performed according to the procedure described in Randhawa et al. [17]. Inoculated material was incubated on water-filled still trays covered with polythene hoods at 9 to 12 °C for 24 h and was then moved to temperature- and irrigation-controlled rooms maintained at 17 ± 2 °C [17]. Seedling stripe rust responses were recorded using the 0 to 4 infection type (IT) scale after 14 to 16 days after inoculation [16]. The ITs 0, 1, 2 and 3 represented resistance, whereas ITs 3+ and 4 represented susceptibility. Some laboratories use 0 to 9 scale for scoring seedling stripe rust responses described in McNeale et al. [18]. Correspondence of these two scales is provided in McIntosh et al. [16].

2.3. Isolation of Genomic DNA

Leaf tissue was collected from 12-day-old seedlings in 2 mL Eppendorf tubes and was dried on silica gel for 72 h prior to DNA isolation. Genomic DNA was extracted using the modified CTAB method [19] and quantified using Nano Drop spectrophotometer (NanoDrop® ND1000; Thermo Fisher Scientific Inc., Waltham, MA, USA). One µg DNA for each RIL, artificial F1 and both parents were sent for high-throughput genotyping and working dilutions of 30 ng/µL were made for in-house use.

2.4. Bulked Segregant Analysis

Bulked segregant analysis (BSA) was performed on resistant and susceptible bulks prepared by pooling equal amounts of DNA from 20 homozygous resistant (HR) and 20 homozygous susceptible (HS) F3 lines, respectively. The F1 artificial bulk was prepared by combining an equal amount of DNA from the rest of the population. DNA of bulks and F1 were sent to Diversity Arrays Technology for BSA using high-density DArT array wheat PstI (TaqI) 3 (http://www.diversityarrays.com; accessed on 21 July 2023).

2.5. Sequence Tagged Site (STS) and Simple Sequence Repeat (SSR) Genotyping

Sequences of resistance-linked DArT clones (kindly provided Dr A. Kilian) were used to develop STS markers using the Primer3 program [20]. In addition, 52 SSR markers previously mapped on chromosome 2BL (http://wheat.pw.usda.gov; accessed on 21 July 2023) were also genotyped to enrich the genetic map [21]. PCRs were carried out in 10 µL reaction volume containing 2 µL of 30 ng/µL DNA, 1 µL of 1X PCR buffer containing MgCl2, 0.75 µL of dNTPs, 0.4 µL of forward (1.25 mM) and reverse (5.0 mM) M13 tagged primers, 0.1 µL (0.5 mM) of M13 fluorescent tag and 0.04 µL of Taq DNA polymerase. PCR amplification conditions described in Randhawa et al. [17] were used. Markers that were polymorphic on parents and showed strong linkage among HR and HS lines were evaluated on the entire AUS27506/AUS27229 RIL population. Electrophoresis of PCR products was carried out on 2.5–3% agarose (Amresco Inc., Solon, OH, USA) gel stained with GelRed™ (Biotium Inc., Fremont, CA, USA). PCR products were visualized using UV gel documentation system. Markers which could not be differentiated on agarose gel were separated on polyacrylamide gel using Analyzer Gene ReadIR 4300, Li-COR sequencing system (Li-COR Bio-sciences, Lincoln, NE, USA) after denaturing PCR product at 95 °C for five minutes.

2.6. SNP Genotyping

Twenty-seven SNPs showed strong linkage with the stripe rust resistance gene in AUS27506 AUS27894. Closely linked SNPs (IWA5694, IWA5839, IWA6130, IWA6334, IWA6417, IWA7265, IWB10417, IWB10455, IWB12294, IWB20875, IWB21638, IWB23209, IWB24984, IWB25015, IWB28191, IWB31823, IWB33668, IWB43166, IWB45530, IWB45652, IWB49793, IWB49793, IWB62498, IWB62757, IWB62762, IWB69000 and IWB79078) were used to design competitive allele-specific PCR assays (KASP) with two allele-specific and one common primer. These markers were genotyped on the parents and the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) was used for comparing KASP amplifications among different genotypes following the protocol given in KASP genotyping manual (https://biosearch-cdn.azureedge.net/assetsv6/KASP-genotyping-chemistry-Use; accessed on 21 July 2023).

2.7. Deletion Bin Mapping of Linked Markers

The DNA samples of chromosome 2BL deletion stocks (del2BL-9, del2BL-3, del2BL-7, del2BL-5 and del2BL-6 [22]), kindly provided by Dr Evans Lagudah, were used to confirm the location of resistance gene. Chinese Spring (CS) was used as control.

2.8. Data Analysis

Goodness of fit of observed segregation data to the expected genetic ratios was tested through Chi-squared analysis. Linkage map was constructed using Mapmaker version 3.0 [23] and recombination fractions were transformed to centi Morgans (cM) using Kosambi mapping function [24]. Final genetic linkage map was constructed using MapChart [25].

3. Results

3.1. Inheritance Studies

The seedling stripe rust responses of AUS27506 and AUS27894 varied from 2C to 3C, when evaluated against Pst pathotype 134 E16A+17+27+. This pathotype was chosen due to its predominance in farmers’ fields in eastern Australia and virulence for stripe rust resistance genes Yr17 and Yr27. The stripe rust screening results of F3 populations derived from crosses AUS27506/AUS27229 and AUS27894/AUS27229 are presented in Table 1. Both populations showed monogenic inheritance of stripe rust resistance. Both parents and homozygous resistant F3 lines produced similar stripe rust responses, suggesting the presence of the same gene. AUS27506 and AUS27894 were crossed, and F3 families were generated. All 80 F3 families produced responses similar to the parents, confirming the presence of the same gene in both genotypes. The resistance locus segregating in both populations was temporarily named YrAW4. The AUS27506/AUS27229-derived population was advanced to generate an F6 RIL population. The segregation for YrAW4 among the RIL population was confirmed (Table 1).

3.2. Molecular Mapping

Twenty homozygous resistant and homozygous susceptible lines, each from the AUS27506/AUS27229 F3 population, were used to construct contrasting bulks. These bulks were subjected to BSA using DArT markers. DArT markers wPt-2397, wPt-665550, wPt-7161, wPt-8916, wPt-1722, wPt-4197, wPt-6542, wPt-9104.2, wPt1650.2, wPt-2185, wPt-0510, wPt-0948, wPt-3632, wPt-7350, wPt-9104.1, wPt-9190 and wPt-9336 showed linkage with YrAW4. All these markers are located in chromosome 2BL. Linked DArT clones were converted to STS markers and tested on the AUS27506/AUS27229 RIL population. The STS primers were named “sun” (Sydney University). Three STS markers (Table 2), sun481 (wPt-665550), sun482 (wPt-7161) and sun483 (wPt-2397), showed polymorphism between parents and were genotyped on the entire RIL population. The markers sun481 and sun482 flanked YrAW4 at genetic distances of 1.8 cM (proximally) and 2.7 cM (distally), respectively (Figure 1). Marker sun483 mapped 5.8 cM distal to sun482.

3.3. Deletion Mapping of Flanking Markers

The YrAW4-linked STS markers sun481 and sun482 were genotyped on DNA of the 2BL deletion stocks del2BL-9, del2BL-3, del2BL-7, del2BL-5 and del2BL-6 to determine their precise genomic locations. Chinese Spring, AUS27506, AUS27894 (resistant parents) and AUS27229 (susceptible parent) were used as controls. The amplicons produced by deletion stocks were compared with Chinese Spring. The marker sun482 amplified the expected product in del 2BL-5, del2BL-6 and CS, whereas sun481 amplified the target band only in del 2BL-5 and CS. These results placed the closest marker sun481 in the deletion bin 2BL-5 (Figure 1b,c).

3.4. Saturation of Chromosome 2BL Using SNP Markers

The AUS27506/AUS27229 RIL population was genotyped using 90K Infinium SNP wheat array. Twenty-one SNP markers on chromosome 2BL mapped close to YrAW4 and spanned from the 759 to 784 Mbp region in the physical map of Chinese Spring (IWGSC RefSeq_V2.0). These were converted into KASP assays, and those showing parental polymorphisms were genotyped on the entire population (Figure 1). Eight KASP markers were incorporated into the AUS27506/AUS27229 chromosome 2BL map (Table 3, Figure 1). The final map included 1 SSR, 3 STS and 8 KASP markers (Figure 1c). The SNP marker IWB12294 mapped 1.2 cM distal to YrAW4 and 1.5 proximal to sun482 (Figure 1). Sequences of the primers for markers included in the final map are given in Table 2 and Table 3.

3.5. Validation of YrAW4-Linked Markers

A set of 19 Australian common wheat and two durum wheat cultivars was tested with the flanking markers IWB12294 and sun481. IWB12294 produced the SNP allele “G” in the resistant parent AUS27506 and allele “T” in the susceptible parent AUS27229 (Table 4 and Figure 2). The STS marker amplified the YrAW4-linked sun481240bp and sun481100bp alleles in the resistant and susceptible parents, respectively (Table 4). Amplification of the “T” allele of the SNP marker IWB12294 and the sun481100bp allele of the STS marker in all test cultivars confirmed the usefulness of these markers in marker-assisted selection of YrAW4 in breeding programs.

4. Discussion

This study identified a new stripe rust resistance locus in landraces AUS27506 and AUS27894. Different genomic resources were used to determine the chromosomal location of YrAW4 and to identify closely linked markers for marker-assisted selection of this gene. The absence of segregation among the AUS27894/AUS27506 F3 population demonstrated the presence of the same gene in both genotypes. The resistance locus was temporarily named YrAW4. DArT-based BSA indicated the location of YrAW4 in the long arm of chromosome 2B, and deletion mapping of flanking DArT markers refined the location of YrAW4 in the deletion bin 2BL-5. Markers sun481 and sun482 mapped 1.8 cM proximal and 2.7 cM distal to YrAW4, respectively. The target genomic region was enriched by converting YrAW4-linked SNP markers to KASP assays. Marker IWB12294 mapped 1.2 cM distal to YrAW4 and 1.5 cM proximal to sun482 (Figure 1c).
Seedling stripe rust resistance genes Yr5, Yr7, YrSp, Yr43, Yr44 and Yr53 were previously reported in the long arm of chromosome 2B (https://wheat.pw.usda.gov/GG3/wgc; accessed on 21 July 2023). Yr5 and Yr7 were mapped 21cM away from the centromere. Yr7 was proved to be an allele of Yr5 [27]. Yr5 produces ITs from 0 to hypersensitive fleck (;) against the Australian Pst pathotype 134 E16A+ and its derivatives, and Yr7 is not effective against this group of pathotypes; hence, YrAW4 cannot be either of these genes. Moreover, the Yr5-linked marker Yr5STS7/8 [28] segregated independently of YrAW4 (data not presented). Digenic segregation among the YrAW4/YrSp F2 population (H.S. Bariana unpublished results) also excluded the possibility of YrAW4 being YrSp.
Yr43 [29], Yr44 [29] and Yr53 [26] produce IT 2 on a 0 to 9 scale, which is much lower than the IT 2C-3C (on a 0 to 4 scale) produced by YrAW4. Xu et al. [26] placed flanking markers for Yr43, Yr44 and Yr53 in the chromosomal deletion bin 2BL-3, which is next to the centromeric deletion bin 2BL-9 (Figure 1a,b). The YrAW4-linked marker sun481 was mapped in the deletion bin 2BL-5. Based on infection type and deletion bin location, we believe that YrAW4 is a unique locus, and therefore, YrAW4 was formally named Yr72. Baranwal et al. [30] also located a seedling stripe rust resistance gene YrAW12 in chromosome 2B of the Tunisian landrace AUS26670. Based on the susceptible responses of AUS27506 (Yr72) and AUS26670 (YrAW12) against the Pst pathotype 239 E237A-17+33+ and their location in the long arm of chromosome 2B, these genes were concluded to represent the same locus.
The usefulness of markers closely linked with the resistance gene requires validation across potential backgrounds in which the target gene has to be transferred. The presence of the resistance-linked allele in genotypes carrying the target gene is referred to as “positive validation” and the absence/amplification of an alternate allele in cultivars lacking the target locus is called “negative validation”. Since YrAW4 has not yet been deployed in modern cultivars, “negative validation” was performed. The markers sun481 and IWB12294 were negatively validated among a set of Australian common wheat and durum wheat cultivars (Table 4 and Figure 2). These robust markers can be used (Table 2 and Table 3) for marker-assisted selection of Yr72 against these backgrounds. Parental polymorphisms need to be checked prior to the use of sun481 and IWB12294 for marker-assisted selection of Yr72 in breeding programs.
Markers linked with ASR genes (https://wheat.pw.usda.gov/GG3/node/657; accessed on 21 July 2023) that are effective against currently predominant Pst pathotypes and race-non-specific APR genes Yr18 [31], Yr36 [32] and Yr46 [33] are available to deploy different combinations of these genes in future wheat cultivars. SNP markers linked with economic traits are preferred by breeding companies for their amenability for high-throughput testing. The YrAW4-linked SNP marker IWB12294 offers this opportunity (Table 3) for marker-assisted selection and marker-assisted pyramiding of this gene with other ASR and APR genes. YrAW4 is currently being transferred to Australian cultivars through marker-assisted selection.
Both AUS27506 and AUS27894 carry a high level of resistance to stripe rust against all Australian Pst pathotypes, except the pathotype 239 E237A-17+33+. AUS27506 was scored moderately resistant against the predominant pathotypes of P. graminis f. sp. tritici (Pgt) and P. triticina (Pt), the causal agents of stem rust and leaf rust of wheat (H.S. Bariana unpublished results). In contrast, AUS27894 produced moderately resistant and moderately susceptible responses against Australian Pgt and Pt pathotypes, respectively. Leaf rust in Aus27506 was controlled via two APR loci, one each located on chromosomes 1B and 2D [34]. Therefore, the use of AUS27506 as a donor source in wheat breeding programs will offer an opportunity for selection of triple rust resistance.

5. Conclusions

The presence of a single stripe rust resistance gene in the long arm of chromosome 2B of landraces AUS27506 and AUS27894 was demonstrated by using bi-parental mapping populations. Comparison of genomic locations and seedling responses of stripe rust resistance genes previously located in chromosome 2BL (Yr5, Yr7, Yr43, Yr44, Yr53 and YrSp) demonstrated the uniqueness of stripe rust resistance carried by AUS27506 and AUS27894. This locus was permanently named Yr72. The markers sun481 and 1WB12294 flanked Yr72 at 1.8 cM and 1.2 cM at the proximal and distal sides. The absence of Yr72-linked marker alleles of both markers in 19 Australian common wheat and two durum wheat cultivars demonstrated the usefulness of these markers in marker-assisted selection/pyramiding of Yr72 in wheat improvement programs. The marker sun481 is a sequence-tagged site type and will be suitable for use in wheat improvement programs where on-gel-based detection systems may not be available, whereas IWB12294 is a single nucleotide polymorphism-based marker and is suitable for high-throughput systems. The moderately resistant responses of AUS27506 to predominant Australian Pgt and Pt pathotypes would facilitate the transfer of triple rust resistance in future wheat cultivars if this accession is used as a donor source of Yr72.

Author Contributions

This study was planned by H.B. and U.B., and H.B., U.B. and H.M. generated F3 and F6 mapping populations. H.B. and M.C. tested the mapping populations in the greenhouse. M.C. isolated DNA, and U.B. sent it for genotyping to DArT Privately Limited, Canberra, Australia and Agribio, Bundoora, Victoria, Australia. M.H. and D.W. conducted 90K infium SNP array genotyping. U.B. and M.C. developed a sequence-tagged site and competitive allele-specific markers and mapped those on the RIL population. M.C. and U.B. conducted molecular mapping. The manuscript was drafted by M.C., U.B. and H.B. All authors have read and agreed to the published version of the manuscript.

Funding

Financial support from the Australian Government via the Department of Foreign Affairs and Trade’s Australia Awards Fellowship Program, University of Sydney (for research facilities), and the Grains Research and Development Corporation (GRDC) Australia (for salaries of supervisors) is gratefully acknowledged.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable as this study did not involve humans.

Data Availability Statement

All data are included in this publication.

Acknowledgments

The first author acknowledges the Royal Government of Bhutan, Ministry of Agriculture and Forestry (MoAF), for granting study leave and the Australian Government for the Australian Leadership Award to pursue a PhD program at the University of Sydney.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wellings, C.R. Global status of stripe rust: A review of historical and current threats. Euphytica 2011, 179, 129–141. [Google Scholar] [CrossRef]
  2. Stubbs, R.W. Stripe rust. In The Cereal Rusts Vol Il; Roelfs, A.P., Bushnell, W.R., Eds.; Academic Press: Orlando, FL, USA, 1985; pp. 61–101. [Google Scholar]
  3. O’Brien, L.; Brown, J.S.; Young, R.M.; Pascoe, I. Occurrence and Distribution of Wheat Stripe Rust in Victoria and Susceptibility of Commercial Wheat Cultivars. Australas. Plant Pathol. 1980, 9, 14. [Google Scholar] [CrossRef]
  4. Wellings, C.R.; Wright, D.G.; Keiper, F.; Loughman, R. First detection of wheat stripe rust in Western Australia: Evidence for a foreign incursion. Australas. Plant Pathol. 2003, 32, 321–322. [Google Scholar] [CrossRef]
  5. Murray, G.M.; Ellison, P.J.; Watson, A. Effects of stripe rust on the wheat plant. Australas. Plant Pathol. 1995, 24, 261–270. [Google Scholar] [CrossRef]
  6. Murray, G.M.; Brennan, J.P. Estimating disease losses to the Australian wheat industry. Australas. Plant Pathol. 2009, 38, 558–570. [Google Scholar] [CrossRef]
  7. Wellings, C.R.; McIntosh, R.A. Puccinia striiformis f.sp. tritici in Australasia: Pathogenic changes during the first 10 years. Plant Pathol. 1990, 39, 316–325. [Google Scholar] [CrossRef]
  8. Edae, E.A.; Olivera, P.D.; Jin, Y.; Poland, J.A.; Rouse, M.N. Genotype-by-sequencing facilitates genetic mapping of a stem rust resistance locus in Aegilops umbellulata, a wild relative of cultivated wheat. BMC Genom. 2016, 17, 1039. [Google Scholar] [CrossRef] [PubMed]
  9. Akbari, M.; Wenzl, P.; Caig, V.; Carling, J.; Xia, L.; Yang, S.; Uszynski, G.; Mohler, V.; Lehmensiek, A.; Kuchel, H.; et al. Diversity arrays technology (DArT) for high-throughput profiling of the hexaploid wheat genome. Theor. Appl. Genet. 2006, 113, 1409–1420. [Google Scholar] [CrossRef]
  10. Jaccoud, D.; Peng, K.; Feinstein, D.; Kilian, A. Diversity arrays: A solid state technology for sequence information independent genotyping. Nucleic Acids Res. 2001, 29, E25. [Google Scholar] [CrossRef] [PubMed]
  11. Sun, Y.; Wang, J.; Crouch, J.H.; Xu, Y. Efficiency of selective genotyping for genetic analysis of complex traits and potential applications in crop imporvement. Mol. Breed. 2010, 26, 493–511. [Google Scholar] [CrossRef]
  12. Sun, C.; Dong, Z.; Zhao, L.; Ren, Y.; Zhang, N.; Chen, F. The Wheat 660K SNP array demonstrates great potential for marker-assisted selection in polyploid wheat. Plant Biotechnol. J. 2020, 18, 1354–1360. [Google Scholar] [CrossRef] [PubMed]
  13. Eversole, K.; Feuillet, C.; Mayer, K.F.; Rogers, J. Slicing the wheat genome. Introduction. Science 2014, 345, 285–287. [Google Scholar] [CrossRef]
  14. Miller, T.; Reader, S.; Ambrose, M. The Watkins wheat collection. Annu. Wheat Newsl. 2000, 46, 172. [Google Scholar]
  15. Daetwyler, H.D.; Bansal, U.K.; Bariana, H.S.; Hayden, M.J.; Hayes, B.J. Genomic prediction for rust resistance in diverse wheat landraces. Theor. Appl. Genet. 2014, 127, 1795–1803. [Google Scholar] [CrossRef]
  16. McIntosh, R.A.; Park, R.F.; Wellings, C.R. Wheat Rusts—An Atlas of Resistance Genes; CSIRO Publishing: Collingwood, Australia, 1995; pp. 9–12. [Google Scholar]
  17. Randhawa, M.; Bansal, U.; Valarik, M.; Klocova, B.; Dolezel, J.; Bariana, H. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat. Theor. Appl. Genet. 2014, 127, 317–324. [Google Scholar] [CrossRef] [PubMed]
  18. McNeale, F.H.; Konzak, C.F.; Smith, E.P.; Tate, W.S.; Russell, T.S. A Uniform for System for Recording and Processing Ceral Rust Research Data; Agricultural Research Service Bulletin, United States Department of Agriculture: Washington, DC, USA, 1971; pp. 34–121. [Google Scholar]
  19. Bansal, U.K.; Kazi, A.G.; Singh, B.; Hare, R.A.; Bariana, H.S. Mapping of durable stripe rust resistance in a durum wheat cultivar Wollaroi. Mol. Breed. 2014, 33, 51–59. [Google Scholar] [CrossRef]
  20. Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S., Eds.; Methods in Molecular Biology™; Humana Press: Totowa, NJ, USA, 1999; Volume 132, pp. 365–386. [Google Scholar]
  21. Somers, D.J.; Isaac, P.; Edwards, K. A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 2004, 109, 1105–1114. [Google Scholar] [CrossRef] [PubMed]
  22. Endo, T.R.; Gill, B.S. The deletion stocks of common wheat. J. Hered. 1996, 87, 295–307. [Google Scholar] [CrossRef]
  23. Manly, K.F.; Cudmore, R.H., Jr.; Meer, J.M. Map Manager QTX, cross-platform software for genetic mapping. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 2001, 12, 930–932. [Google Scholar] [CrossRef]
  24. Kosambi, D.D. The estimation of map distances from recombination values. Ann. Eugen. 1944, 12, 172–175. [Google Scholar] [CrossRef]
  25. Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
  26. Xu, L.S.; Wang, M.N.; Cheng, P.; Kang, Z.S.; Hulbert, S.H.; Chen, X.M. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat. Theor. Appl. Genet. 2013, 126, 523–533. [Google Scholar] [CrossRef]
  27. Zhang, P.; McIntosh, R.A.; Hoxha, S.; Dong, C. Wheat stripe rust resistance genes Yr5 and Yr7 are allelic. Theor. Appl. Genet. 2009, 120, 25–29. [Google Scholar] [CrossRef]
  28. Chen, X.M.; Soria, M.A.; Yan, G.P.; Sun, J.; Dubcovsky, J. Development of sequence tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust resistance gene Yr5. Crop Sci. 2003, 43, 2058–2064. [Google Scholar] [CrossRef]
  29. Cheng, P.; Chen, X.M. Molecular mapping of a gene for stripe rust resistance in spring wheat cultivar IDO377s. Theor. Appl. Genet. 2010, 121, 195–204. [Google Scholar] [CrossRef] [PubMed]
  30. Baranwal, D.; Bariana, H.; Bansal, U. Dissection of stripe rust resistance in a Tunisian wheat landrace Aus26670. Mol. Breed. 2021, 41, 54. [Google Scholar] [CrossRef] [PubMed]
  31. Lagudah, E.S.; Krattinger, S.G.; Herrera-Foessel, S.; Singh, R.P.; Huerta-Espino, J.; Spielmeyer, W.; Brown-Guedira, G.; Selter, L.L.; Keller, B. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor. Appl. Genet. 2009, 119, 889–898. [Google Scholar] [CrossRef]
  32. Uauy, C.; Brevis, J.C.; Chen, X.; Khan, I.; Jackson, L.; Chicaiza, O.; Distelfeld, A.; Fahima, T.; Dubcovsky, J. High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein content locus Gpc-B1. Theor. Appl. Genet. 2005, 112, 97–105. [Google Scholar] [CrossRef]
  33. Herrera-Foessel, S.A.; Singh, R.P.; Lillemo, M.; Huerta-Espino, J.; Bhavani, S.; Singh, S.; Lan, C.; Calvo-Salazar, V.; Lagudah, E.S. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat. Theor. Appl. Genet. 2014, 127, 781–789. [Google Scholar] [CrossRef]
  34. Pakeerathan, K.; Chhetri, M.; Hayden, M.; Ayliffe, M.; Bariana, H.; Bansal, U. Mapping of adult plant leaf rust resistance in Aus27506 and validation of underlying loci by in-planta fungal biomass accummulation. Agronomy 2020, 10, 943. [Google Scholar] [CrossRef]
Figure 1. Diagrammatic representation of (a) stripe rust resistance genes Yr5/Yr7, Yr44, Yr53 and Yr43 as given in Xu et al. [26]; (b) deletion bins; (c) genetic linkage map of AUS27506/AUS27229 RIL population showing the location of YrAW4. Genetic distances in (a,c) are in centiMorgan (cM).
Figure 1. Diagrammatic representation of (a) stripe rust resistance genes Yr5/Yr7, Yr44, Yr53 and Yr43 as given in Xu et al. [26]; (b) deletion bins; (c) genetic linkage map of AUS27506/AUS27229 RIL population showing the location of YrAW4. Genetic distances in (a,c) are in centiMorgan (cM).
Genes 14 01993 g001
Figure 2. Allelic discrimination plot of SNP marker IWB12294 using KASP assay. Allele 2 (blue) represents AUS27506 carrying YrAW4 and Allele 1 (orange dots) represents Australian cultivars and susceptible parent AUS27229.
Figure 2. Allelic discrimination plot of SNP marker IWB12294 using KASP assay. Allele 2 (blue) represents AUS27506 carrying YrAW4 and Allele 1 (orange dots) represents Australian cultivars and susceptible parent AUS27229.
Genes 14 01993 g002
Table 1. Distribution of F3 families and RIL lines when tested with Pst pathotype 134 E16A+17+27+.
Table 1. Distribution of F3 families and RIL lines when tested with Pst pathotype 134 E16A+17+27+.
Stripe Rust ResponseInfection Type Number of Linesχ² (1:2:1) or (1:1)
ObservedExpected
F3 AUS27506/AUS27229
Homozygous Resistant23C to 3C2424.750.00
Segregating 23C-3C, 3+5849.501.50
Homozygous Susceptible3+1724.752.40
Total 9999.003.90 *
F3 AUS27894/AUS27229
Homozygous Resistant23C to 3C1919.250.00
Segregating 23C-3C, 3+4438.500.80
Homozygous Susceptible3+1419.251.40
Total 7777.002.20 *
AUS27506/AUS27229 RIL population
Homozygous Resistant 5351.00.08
Homozygous Susceptible 4951.00.08
Total 102102.00.16 *
* Table values of χ² at p = 0.05 is 3.84 and 5.99 at 1 and 2 d.f.
Table 2. Primer sequences of sequence tagged site markers derived from DArT- markers spanning the YrAW4 region.
Table 2. Primer sequences of sequence tagged site markers derived from DArT- markers spanning the YrAW4 region.
STS MarkersDArT- MarkersForward aReverse
sun481wPt-665550GGCCAAGGTATGTTGATCGTTCCAAATGAAACCAGGAAGG
sun482wPt-7161GCTCCTCTCGTTGATTGAGGATGCAAAGGGAGAAAGCTG
sun483wPt-2397CAGTAGCATCCAACCCACTGGGACGGATGATGAGACAGA
a CACGACGTTGTAAAACGAC represents M13 sequence.
Table 3. Primer sequences of kompetitive allele-specific polymerase chain reaction (KASP) markers designed from SNPs spanning the YrAW4 region.
Table 3. Primer sequences of kompetitive allele-specific polymerase chain reaction (KASP) markers designed from SNPs spanning the YrAW4 region.
SNPAllele 1 aAllele 2 bCommon Primer
IWB49793CCATGTTCAAGGGTCTCAATTACCATGTTCAAGGGTCTCAATTCTCGCCTGATATATTCACAACCTTT
IWB56941AGGAGGAATGGAAGTTTGATACTAGGAGGAATGGAAGTTTGATACGTGCAGAAAATGACAGCCTGA
IWB20875AGAGTAGCATGCGAGTCTTAGAGTAGCATGCGAGTCTCCAAGCACTTTACAGGTTTCCG
IWB12294TCCTCCGGCATTCCTCTTCCTCCGGCATTCCTCGAGCGTGCTGTACTTCGCC
IWB69000TGTTCTAGCTAACCAGGCAACTGTTCTAGCTAACCAGGCAGCGAGCCAGAGTCTGAGACCA
IWB45530GAAACCAGCCGCAGAGTATTGAAACCAGCCGCAGAGTACGCAGTCAAGTTTTGGAACTGG
IWB56941AAGGAGGAATGGAAGTTTGATACTAAGGAGGAATGGAAGTTTGATACGTGCAGAAAATGACAGCCTGA
IWB10417TTTTCTTGTAGGAGGCAAAGATTTCAATTCTTGTAGGAGGCAAAGATTTCACTGATAATGTAAGCAGGAGTGTGCAATGTA
a Allele 1 labeled with FAM: GAAGGTGACCAAGTTCATGCT; b Allele 2 labeled with HEX: GAAGGTCGGAGTCAACGGATT.
Table 4. Validation of closely linked STS marker sun481 and KASP marker IWB12294 on Australian cultivars known to lack Yr72.
Table 4. Validation of closely linked STS marker sun481 and KASP marker IWB12294 on Australian cultivars known to lack Yr72.
Cultivar and RILsun481 (bp)IWB12294 (G:T)
AUS27506 and HR RIL 240G
AUS27229 and HS RIL100T
Calingiri100T
Carnamah250 + 120 + 100T
Derrimut120 + 100T
DiamondBird250 + 100T
EGA Bellaroi (durum)120 + 100T
EGA BonnieRock130 + 120 + 100T
EGA Gregory250 + 130 + 100T
EmuRock250 + 120 + 100T
Espada250 + 120T
Forrest250 + 120 + 100T
Giles255 + 100T
Gladius250 + 120 + 100T
Hyperno (durum)250 + 100T
Magenta250 + 120 + 100T
Merlin250 + 120 + 100T
O’rion250 + 120 + 100T
Scout120 + 100T
Spitfire250 + 120 + 100T
Sunvale255 + 250 + 100T
Ventura100T
Wyalkatchem250 + 100T
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chhetri, M.; Miah, H.; Wong, D.; Hayden, M.; Bansal, U.; Bariana, H. Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection. Genes 2023, 14, 1993. https://doi.org/10.3390/genes14111993

AMA Style

Chhetri M, Miah H, Wong D, Hayden M, Bansal U, Bariana H. Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection. Genes. 2023; 14(11):1993. https://doi.org/10.3390/genes14111993

Chicago/Turabian Style

Chhetri, Mumta, Hanif Miah, Debbie Wong, Matthew Hayden, Urmil Bansal, and Harbans Bariana. 2023. "Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection" Genes 14, no. 11: 1993. https://doi.org/10.3390/genes14111993

APA Style

Chhetri, M., Miah, H., Wong, D., Hayden, M., Bansal, U., & Bariana, H. (2023). Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection. Genes, 14(11), 1993. https://doi.org/10.3390/genes14111993

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop