Microsatellite Characteristics of Silver Carp (Hypophthalmichthysmolitrix) Genome and Genetic Diversity Analysis in Four Cultured Populations
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collections and DNA Extraction
2.2. Identification of Genome-Wide SSRs
2.3. Primer Design for Genome-Wide SSRs
2.4. Verification of SSRs Using PCR Amplification
2.5. Genetic Analysis
3. Results
3.1. Identification of SSRs in the H. molitrix Genome
3.2. The Distributions of Copy Numbers in Different SSR Repeat Types in H. molitrix Genome
3.3. Distribution of SSRs on Chromosomes
3.4. Screening of Polymorphic SSR Sites
3.5. Population Genetic Diversity Analysis
3.6. Genetic Differentiation in Four Populations
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sha, H.; Luo, X.Z.; Wang, D.; Zou, G.W.; Liang, H.W. New insights to protection and utilization of silver carp (Hypophthalmichthys molitrix) in Yangtze River based on microsatellite analysis. Fish. Res. 2021, 241, 105997. [Google Scholar] [CrossRef]
- Liang, H.W.; Li, Z.; Luo, X.Z.; Pan, G.B.; Zou, G.W. Morphological differences and discriminant analysis between Changfeng and Yangtze river silver carp. Acta Hydrobiol. Sin. 2015, 39, 6. [Google Scholar]
- Fang, D.A.; Luo, Y.T.; Xu, D.P.; Yang, X.W.; Wang, X.H. Relationship between genetic risk and stock enhancement of the silver carp (Hypophthalmichthys molitrix) in the Yangtze River. Fish. Res. 2021, 235, 105829. [Google Scholar] [CrossRef]
- Toth, G. Microsatellites in Different Eukaryotic Genomes: Survey and Analysis. Genome Res. 2000, 10, 967. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.; Chen, F.; Huang, C.; Zheng, W.; Zhou, R. Genome-wide mapping and characterization of microsatellites in the swamp eel genome. Sci. Rep. 2017, 7, 3157. [Google Scholar] [CrossRef]
- Zane; Nelson; Jones; Avise. Microsatellite assessment of multiple paternity in natural populations of a live-bearing fish, Gambusia holbrooki. J. Evol. Biol. 2010, 12, 61–69. [Google Scholar] [CrossRef] [Green Version]
- Nikolic, N.; Fve, K.; Chevalet, C.; Hyheim, B.; Riquet, J. A set of 37 microsatellite DNA markers for genetic diversity and structure analysis of Atlantic salmon Salmo salar populations. J. Fish Biol. 2009, 74, 458–466. [Google Scholar] [CrossRef]
- Chen, S.L.; Ji, X.S.; Shao, C.W.; Li, W.L.; Yang, J.F.; Liang, Z.; Liao, X.L.; Xu, G.B.; Xu, Y.; Song, W.T. Induction of Mitogynogenetic Diploids and Identification of WW Super-female Using Sex-Specific SSR Markers in Half-Smooth Tongue Sole (Cynoglossus semilaevis). Mar. Biotechnol. 2012, 14, 120–128. [Google Scholar] [CrossRef]
- Mastrochirico-Filho, V.A.; Pazo, F.D.; Hata, M.E.; Villanova, G.V.; Hashimoto, D.T. Assessing Genetic Diversity for a Pre-Breeding Program in Piaractus mesopotamicus by SNPs and SSRs. Genes 2019, 10, 668. [Google Scholar] [CrossRef] [Green Version]
- Shen, X.; Yang, G.; Liu, Y.; Liao, M.; Wang, X.; Zhu, M.; Song, W.; Zou, G.; Wei, Q.; Wang, D. Construction of genetic linkage maps of guppy (Poecilia reticulata) based on AFLP and microsatellite DNA markers. Aquaculture 2007, 271, 178–187. [Google Scholar] [CrossRef]
- Alcivar-Warren, A.; Meehan-Meola, D.; Won, S.; Xu, Z.; Zuniga, G. ShrimpMap: A low-density, microsatellite-based linkage map of the pacific whiteleg shrimp, Litopenaeus vannamei: Identification of sex-linked markers in linkage group 4. J. Shellfish Res. 2017, 26, 1259–1277. [Google Scholar] [CrossRef]
- Yu, F.; Wang, B.H.; Feng, S.P.; Wang, J.Y.; Wu, L. Development, characterization, and cross-species/genera transferability of SSR markers for rubber tree (Hevea brasiliensis). Plant Cell Rep. 2011, 30, 335–344. [Google Scholar] [CrossRef]
- Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; Mccown, B.; Harbut, R.; Simon, P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef] [Green Version]
- Feng, X.; Yu, X.; Fu, B.; He, S.; Tong, J.; Feng, X.; Yu, X.; Fu, B.; He, S.; Tong, J. Development of 159 transcript-associated microsatellite markers in silver carp (Hypophthalmichthys molitrix). Conserv. Genet. Resour. 2014, 6, 111–113. [Google Scholar] [CrossRef] [Green Version]
- Guo, W.; Yu, X.; Tong, J.; Guo, W.; Yu, X.; Tong, J. Development of 134 novel polynucleotide-repeat microsatellite markers in silver carp (Hypophthalmichthys molitrix). Conserv. Genet. Resour. 2013, 5, 525–528. [Google Scholar] [CrossRef]
- Aljanabi, S.M.; Martinez, I. Universal and rapid salt-extraction of high quality gnomic DNA for PCR-based techniques. Nucleic Acids Res. 1997, 25, 4692–4693. [Google Scholar] [CrossRef]
- Yeh, C.; Boule, T. POPGENE-1.32: A Free Program for the Analysis of Genetic Variation among and within Populations Using Co-Dominant and Dominant Markers; Department of Renewable Resources at the University of Alberta: Edmonton, AB, Canada, 2000. [Google Scholar]
- Marshall, T.C.; Slate, J.; Kruuk, L.; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 1998, 7, 639–655. [Google Scholar] [CrossRef] [Green Version]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 2011, 28, 2731. [Google Scholar] [CrossRef] [Green Version]
- Smouse, P.E.; Peakall, R. Spatial autocorrelation analysis of individual multiallele and multilocus genetic structure. Heredity 1999, 82, 561–573. [Google Scholar] [CrossRef] [Green Version]
- Rosenberg, J. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar]
- Rosenberg, N.A. distruct: A program for the graphical display of population structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef]
- Xu, J.J.; Zheng, X.; Zhang, X.Y.; Wang, T.; Yin, S.W. Analysis of Distribution Characteristics of Microsatellites in Four Genomes of Puffer Fish. Genom. Appl. Biol. 2021, 40, 1441–1451. [Google Scholar]
- Gan, L.P.; Tian, H.T.; Heng, L.H. Distribution Regularities of SSR in the Whole Genomes of the Six Lepi-doptera Insects. Genom. Appl. Biol. 2021, 40, 1022–1030. [Google Scholar]
- Yan, Y.F.; Yue, B.S.; Huang, J.; Jian, Z.Y.; Li, W.J. Genome-wide distribution and organization of microsatellites in six species of birds. Biochem. Syst. Ecol. 2016, 67, 95–102. [Google Scholar]
- Subramanian, S.; Mishra, R.K.; Singh, L. Genome-wide analysis of microsatellite repeats in humans: Their abundance and density in specific genomic regions. Genome Biol. 2003, 4, R13. [Google Scholar] [CrossRef] [Green Version]
- Qi, W.; Jiang, X.; Du, L.; Xiao, G. Distribution regularities and comparative analysis of microsatellite in the whole genomes of yak and water buffalo. Genom. Appl. Biol. 2015, 34, 1406–1412. [Google Scholar]
- Liu, S.; Hou, W.; Sun, T.; Xu, Y.; Li, P.; Yue, B.; Fan, Z.; Li, J. Genome-wide mining and comparative analysis of microsatellites in three macaque species. Mol. Genet. Genom. 2017, 292, 537–550. [Google Scholar] [CrossRef]
- Lei, Y.; Zhou, Y.; Price, M.; Song, Z. Genome-wide characterization of microsatellite DNA in fishes: Survey and analysis of their abundance and frequency in genome-specific regions. BMC Genom. 2021, 22, 421. [Google Scholar] [CrossRef]
- Fan, S.A.; Huang, H.; Liu, Y.; Wang, P.A.; Zhao, C.A.; Yan, L.A.; Qiao, X.C.; Qiu, L. Genome-wide identification of microsatellite and development of polymorphic SSR markers for spotted sea bass (Lateolabrax maculatus). Aquacult. Rep. 2021, 20, 100677. [Google Scholar]
- Huang, W.J.; Guo, X.Z.; Zhang, Z.H.; Dong, Q.; Xiong, X.M.; Gao, Z.X. Analysis of microsatellite in the entire grass carp (Ctenopharyngodon idella) M genome and the application in parentage identification. J. Fish. China 2022, 46, 161–172. [Google Scholar]
- Tian, H.F.; Hu, Q.M.; Li, Z. Genome-wide identification of simple sequence repeats and development of polymorphic SSR markers in swamp eel (Monopterus albus). Sci. Prog. 2021, 104, 368504211035597. [Google Scholar] [CrossRef]
- Dreisigacker, S.; Zhang, P.; Warburton, M.L.; Ginkel, M.V.; Hoisington, D.; Bohn, M.; Melchinger, A.E. SSR and Pedigree Analyses of Genetic Diversity among CIMMYT Wheat Lines Targeted to Different Megaenvironments. Crop Sci. 2004, 44, 381–388. [Google Scholar] [CrossRef]
- Xu, J.J.; Zheng, X.; Li, J.; Yi, S.W.; Wang, T. Distribution Characteristics of Whole Genome Microsatellite of Pelteobagrus fulvidraco. Genom. Appl. Biol. 2020, 39, 5488–5498. [Google Scholar]
- Zhou, Y.L.; Wu, J.J.; Wang, Z.W.; Li, G.H.; Gui, J.F. Microsatellite polymorphism and genetic differentiation of different populations screened from genome survey sequencing in red-tail catfish (Hemibagrus wyckioides). Aquacult. Rep. 2021, 19, 100614. [Google Scholar] [CrossRef]
- Chistiakov, D.A.; Hellemans, B.; Volckaert, F. Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture 2006, 255, 1–29. [Google Scholar] [CrossRef]
- Ji, P.; Zhang, Y.; Chao, L.; Zhao, Z.; Sun, X. High Throughput Mining and Characterization of Microsatellites from Common Carp Genome. Int. J. Mol. Sci. 2012, 13, 9798–9807. [Google Scholar] [CrossRef] [Green Version]
- Huang, G.; Cao, J.; Chen, C.; Wang, M.; Liu, Z.; Gao, F.; Yi, M.; Chen, G.; Lu, M. Genome survey of Misgurnus anguillicaudatus to identify genomic information, simple sequence repeat (SSR) markers, and mitochondrial genome. Mol. Biol. Rep. 2022, 49, 2185–2196. [Google Scholar] [CrossRef]
- Gartler, S. Analysis of CpG Suppression in Methylated and Nonmethylated Species. Proc. Natl. Acad. Sci. USA 1992, 89, 957–961. [Google Scholar]
- Christian, S.; Diethard, T. Slippage synthesis of simple sequence DNA. Nucleic Acids Res. 1992, 2, 211–215. [Google Scholar]
- Wierdl, M.; Dominska, M. Microsatellite Instability in Yeast: Dependence on the Length of the Microsatellite. Genetics 1997, 146, 769. [Google Scholar] [CrossRef]
- Hancock, J.M. Simple sequences and the expanding genome. BioEssays 1996, 18, 421–425. [Google Scholar] [CrossRef] [PubMed]
- Shete, S.; Tiwari, H.; Elston, R.C. On Estimating the Heterozygosity and Polymorphism Information Content Value. Theor. Popul. Biol. 2000, 57, 265–271. [Google Scholar] [CrossRef]
- Beardmore, J.A.; Mair, G.C.; Lewis, R.I. Biodiversity in aquatic systems in relation to aquaculture. Aquac. Res. 1997, 28, 829–839. [Google Scholar] [CrossRef]
- Ye, X.; Wei, L.; Liang, K.; Zhang, S.; Teng, Z.Z. Genetic diversity analysis in changfeng silver carp and guangxi local silver carp. Genom. Appl. Biol. 2019, 38, 100–108. [Google Scholar]
- Wright, S. Evolution and Genetics of Populations; University of Chicago Press: Chicago, IL, USA, 1978; pp. 439–459. [Google Scholar]
- Balloux, F.; Lugon-Moulin, N. The estimation of population differentiation with microsatellite markers. Mol. Ecol. 2002, 11, 55–65. [Google Scholar] [CrossRef] [Green Version]
Population | Location | Coordinates | Sampling Time | Number |
---|---|---|---|---|
SS | Shishou, Hubei Province, China | 112°48′E,29°83′N | 2021 | 30 |
WH | Wuhan, Hubei Province, China | 114°48′E,30°77′N | 2021 | 30 |
XC | Xiaochang, Hubei Province, China | 113°59′E,30°76′N | 2021 | 30 |
YW | Yaowan, Hubei Province, China | 112°31′E,30°26′N | 2021 | 30 |
Locus | Motif | Primer (5′–3′) | Tm/°C | Size/Bp |
---|---|---|---|---|
P020 | (AATA)5 | F: CTGCTCACCTCAGCTCATCC R: ACATCACGGGAGCACAGAT | 60 | 152~176 |
P021 | (ATAG)4 | F: GCGAGCGCATGTTTGATCAA R: GCGAGCGCATGTTTGATCAA | 60 | 130~140 |
P030 | (AAC)5 | F: GGTATCTGCTCGCTGGATCC R: AATGCGCAGTTTCACAACG | 60 | 201~213 |
P034 | (ATA)11 | F: GGGCGATGATCCCTGAATCC R: TGGGCGTTCTGGCACAATAT | 60 | 199~221 |
P036 | (ATT)5 | F: GCTTGCTCAAGGGCACAATG R: TGCAGCAAGGACATTAGCGA | 60 | 230~243 |
P037 | (ATTAT)4 | F: AGAGCACGTTCACCTCACTG R: CCGGCAATGCACAGTACAAG | 60 | 230~273 |
P041 | (TAG)8 | F: AGAGGGAGACACGGCTACAT R: GAATGAGCGACCTCTAGCGG | 60 | 212~240 |
P043 | (ACA)9 | F: TCACATCCTGCAACAGGGTC R: GTGTTCTGCCACCTTCCAGT | 60 | 231~250 |
P054 | (TAA)6 | F: TTGTTCGCTCCTTGGAAGGT R: AAGATGGCTCAGGTTCACGG | 60 | 241~278 |
P056 | (TATC)6 | F: CGACCTGCTAGCCCAAACAT R: GAAACGGAGACCTCTGGTGG | 60 | 280~296 |
P058 | (GTTT)6 | F: AACTGTCTATGCGATGCCGT R: AATTTCATCCCGCAGTGCTG | 60 | 280~293 |
P062 | (TGTTT)37 | F: ATGCTGGCGATATGTGGCAA R: ATACTCAGACCAGCCCGTCT | 60 | 296~305 |
P086 | (TAA)5 | F: TATTGCAGTGGTCGGACACA R: ATACTGGGTTGCGCAGACTG | 60 | 322~364 |
SSR Types | Total Counts | Total Length (bp) | Average Length (bp) | Frequency (loci/Mb) | Density (bp/Mb) | Percent (%) |
---|---|---|---|---|---|---|
Di- | 204,873 | 4,911,266 | 23.97 | 243.31 | 5832.79 | 55.59 |
Tri- | 38,048 | 468,878 | 12.32 | 45.19 | 556.86 | 10.32 |
Tetra- | 70,012 | 712,888 | 10.18 | 83.15 | 846.65 | 19.00 |
Penta- | 44,921 | 330,472 | 7.36 | 53.35 | 392.48 | 12.19 |
Hexa- | 10,718 | 68,572 | 30.83 | 12.73 | 84.38 | 2.90 |
Total | 368,572 | 6,492,076 | 84.66 | 437.73 | 7713.16 | 100.00 |
Motif | Categories | Number | Frequency (loci/Mb) | Density (bp/Mb) | Length (bp) |
---|---|---|---|---|---|
Di- | AC | 89,924 | 106.80 | 2111.18 | 1,777,632 |
AT | 83,122 | 98.72 | 3045.83 | 2,564,620 | |
AG | 31,602 | 37.53 | 672.34 | 566,120 | |
CG | 225 | 0.27 | 3.44 | 2894 | |
Tri- | AAT | 24,409 | 28.99 | 365.86 | 308,054 |
AAC | 4696 | 5.58 | 63.67 | 53,608 | |
ATC | 2572 | 3.05 | 37.90 | 31,910 | |
AAG | 2038 | 2.42 | 29.29 | 24,660 | |
Tetra- | AAAT | 16,819 | 19.97 | 178.24 | 150,084 |
AGAT | 14,755 | 17.52 | 208.83 | 175,838 | |
Penta- | AAAAT | 12,660 | 15.04 | 111.11 | 93,554 |
Hexa- | AAAAAT | 3384 | 4.02 | 24.32 | 20,474 |
Locus | Na | Ne | Ho | He | I | PIC |
---|---|---|---|---|---|---|
P020 | 2 | 1.363 | 0.250 | 0.267 | 0.437 | 0.231 |
P021 | 2 | 1.342 | 0.267 | 0.255 | 0.423 | 0.222 |
P030 | 5 | 1.941 | 0.517 | 0.485 | 0.954 | 0.449 |
P034 | 3 | 2.044 | 0.450 | 0.511 | 0.819 | 0.442 |
P036 | 3 | 1.482 | 0.317 | 0.325 | 0.606 | 0.298 |
P037 | 3 | 1.052 | 0.017 | 0.049 | 0.133 | 0.048 |
P041 | 5 | 2.636 | 0.467 | 0.621 | 1.221 | 0.581 |
P043 | 7 | 3.084 | 0.600 | 0.676 | 1.446 | 0.643 |
P054 | 2 | 1.654 | 0.217 | 0.395 | 0.584 | 0.319 |
P056 | 7 | 4.332 | 0.683 | 0.769 | 1.639 | 0.735 |
P058 | 6 | 2.092 | 0.583 | 0.520 | 1.083 | 0.487 |
P062 | 4 | 2.332 | 0.283 | 0.571 | 1.047 | 0.520 |
P086 | 7 | 4.765 | 0.450 | 0.800 | 1.747 | 0.768 |
Mean | 4.308 | 2.317 | 0.392 | 0.479 | 0.934 | 0.442 |
St. Dev | 1.974 | 1.140 | 0.186 | 0.216 | 0.494 | 0.213 |
Population | N | Na | Ne | Ho | He | I | Fst |
---|---|---|---|---|---|---|---|
SS | 30 | 4.385 ± 0.583 | 2.387 ± 0.335 | 0.421 ± 0.071 | 0.469 ± 0.068 | 0.912 ± 0.520 | 0.084 ± 0.066 |
WH | 30 | 4.077 ± 0.487 | 2.461 ± 0.330 | 0.450 ± 0.006 | 0.504 ± 0.063 | 0.954 ± 0.482 | 0.100 ± 0.068 |
XC | 30 | 4.462 ± 0.489 | 2.334 ± 0.352 | 0.392 ± 0.075 | 0.451 ± 0.072 | 0.879 ± 0.525 | 0.103 ± 0.069 |
YW | 30 | 3.538 ± 0.368 | 2.045 ± 0.386 | 0.392 ± 0.103 | 0.402 ± 0.067 | 0.900 ± 0.455 | 0.178 ± 0.132 |
Source of Variation | df | Sun of Squares | Variance Components | Percentage of Variation/% | Fixation Index |
---|---|---|---|---|---|
Among populations | 3 | 29.704 | 0.12299 | 4.65 | |
Within populations | 236 | 595.217 | 2.5221 | 95.35 | Fst = 0.04650 |
Total variation | 239 | 623.921 | 2.64509 | 100 |
SS | WH | XC | YW | |
---|---|---|---|---|
SS | 0.02718 | 0.00714 | 0.05402 | |
WH | 0.0328 | 0.03796 | 0.08709 | |
XC | 0.0157 | 0.0382 | 0.06319 | |
YW | 0.0673 | 0.1092 | 0.0823 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Sha, H.; Li, X.; Zhou, T.; Luo, X.; Zou, G.; Chai, Y.; Liang, H. Microsatellite Characteristics of Silver Carp (Hypophthalmichthysmolitrix) Genome and Genetic Diversity Analysis in Four Cultured Populations. Genes 2022, 13, 1267. https://doi.org/10.3390/genes13071267
Wang Y, Sha H, Li X, Zhou T, Luo X, Zou G, Chai Y, Liang H. Microsatellite Characteristics of Silver Carp (Hypophthalmichthysmolitrix) Genome and Genetic Diversity Analysis in Four Cultured Populations. Genes. 2022; 13(7):1267. https://doi.org/10.3390/genes13071267
Chicago/Turabian StyleWang, Yajun, Hang Sha, Xiaohui Li, Tong Zhou, Xiangzhong Luo, Guiwei Zou, Yi Chai, and Hongwei Liang. 2022. "Microsatellite Characteristics of Silver Carp (Hypophthalmichthysmolitrix) Genome and Genetic Diversity Analysis in Four Cultured Populations" Genes 13, no. 7: 1267. https://doi.org/10.3390/genes13071267