bCNN-Methylpred: Feature-Based Prediction of RNA Sequence Modification Using Branch Convolutional Neural Network †
Abstract
:1. Introduction
2. Related Studies
- (1).
- bCNN-Methylpred, a novel branch CNN: This network combines the features from different encoding schemes and accurately predicts m6A sites in different RNA sequences.
- (2).
- A novel encoding scheme: We propose a novel circular encoding scheme that considers every possible combination of the four nucleotide bases in the RNA sequence, namely, adenine (A), cytosine (C), guanine (G), and uracil (U). The proposed encoding schemes further improves the accuracy of predicting m6A sites in different RNA sequences.
- (3).
- Feature fusion: The proposed approach uses the individual encoded RNA sequences using three encoding schemes and then combines their features. Subsequently, the combined features are used to identify m6A sites in different RNA sequences.
- (4).
- Biological interpretation of the proposed model: We investigate the proposed model from a biological perspective by interpreting the trained model based on a well-established interpretation procedure, i.e., in silico mutagenesis.
3. Materials and Methods
3.1. Encoding Schemes
3.1.1. Algorithm of Circular Encoding
- Select a Sequence;
- Replicate the first nucleotide base at the end of the sequence;
- Make pairs of the nucleotides bases in the given sequence;
- Assign unique binary code to each pair (Code assignment is shown in Figure 1b);
- The generated code is used as input to the network.
3.1.2. Example of Circular Encoding
- Given a sequence as:′CCUUUUCUAAGUGCUUACAGACUCUCUGUUUAAUAAUCCAU′;
- Replicate the first base at the end;
- The modified sequence is:′CCUUUUCUAAGUGCUUACAGACUCUCUGUUUAAUAAUCCAUC′;
- Make pairs of bases:′(CC), (UU), (UU), (CU), (AA), (GU), (GC), (UU), (AC), (AG), (AC), (UC), (UC), (UG), (UU), (UA), (AU), (AA), (UC), (CA), (UC)′;
- Assign binary code to each pair as shown in Figure 1b.
3.2. Proposed Approach
Network Architecture and Training
3.3. Benchmark Datasets
3.3.1. Four Benchmark Datasets
3.3.2. miCLIP-Seq Datasets
3.4. Performance Evaluation
3.4.1. Performance Evaluation Metrics
3.4.2. Prediction on Four Benchmark Datasets
3.4.3. Prediction on miCLIP-Seq Datasets
3.5. Discussion
3.6. Deep Learning Models
3.7. Biological Interpretation of Proposed Model
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef] [PubMed]
- Roost, C.; Lynch, S.R.; Batista, P.J.; Qu, K.; Chang, H.Y.; Kool, E.T. Structure and thermodynamics of N6-methyladenosine in RNA: A spring-loaded base modification. J. Am. Chem. Soc. 2015, 137, 2107–2115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, N.; Dai, Q.; Zheng, G.; He, C.; Parisien, M.; Pan, T. N6-methyladenosine-dependent RNA structural switches regulate RNA–protein interactions. Nature 2015, 518, 560–564. [Google Scholar] [CrossRef] [Green Version]
- Alarcón, C.R.; Lee, H.; Goodarzi, H.; Halberg, N.; Tavazoie, S.F. N6-methyladenosine marks primary microRNAs for processing. Nature 2015, 519, 482–485. [Google Scholar] [CrossRef]
- Chen, T.; Hao, Y.-J.; Zhang, Y.; Li, M.-M.; Wang, M.; Han, W.; Wu, Y.; Lv, Y.; Hao, J.; Wang, L.; et al. m6A RNA methylation is regulated by microRNAs and promotes reprogramming to pluripotency. Cell Stem Cell 2015, 16, 289–301. [Google Scholar] [CrossRef] [Green Version]
- Geula, S.; Moshitch-Moshkovitz, S.; Dominissini, D.; Mansour, A.A.; Kol, N.; Salmon-Divon, M.; Hershkovitz, V.; Peer, E.; Mor, N.; Manor, Y.S.; et al. m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 2015, 347, 1002–1006. [Google Scholar] [CrossRef] [PubMed]
- Jia, G.; Fu, Y.; Zhao, X.; Dai, Q.; Zheng, G.; Yang, Y.; Yi, C.; Lindahl, T.; Pan, T.; Yang, Y.-G.; et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 2011, 7, 885–887. [Google Scholar] [CrossRef]
- Bansal, H.; Yihua, Q.; Iyer, S.P.; Ganapathy, S.; Proia, D.; Penalva, L.; Uren, P.; Suresh, U.; Carew, J.; Karnad, A.B.; et al. WTAP is a novel oncogenic protein in acute myeloid leukemia. Leukemia 2014, 28, 1171–1174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lichinchi, G.; Zhao, B.S.; Wu, Y.; Lu, Z.; Qin, Y.; He, C.; Rana, T.M. Dynamics of human and viral RNA methylation during Zika virus infection. Cell Host Microbe 2016, 20, 666–673. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, T.; Rao, S.; Wu, L.; Ye, N.; Liu, Z.; Hu, H.; Xiu, J.; Shen, Y.; Xu, Q. An association study of the m6A genes with major depressive disorder in Chinese Han population. J. Affect. Disord. 2015, 183, 279–286. [Google Scholar] [CrossRef]
- Metodiev, M.D.; Thompson, K.; Alston, C.L.; Morris, A.A.; He, L.; Assouline, Z.; Rio, M.; Bahi-Buisson, N.; Pyle, A.; Griffin, H.R.; et al. Recessive mutations in TRMT10C cause defects in mitochondrial RNA processing and multiple respiratory chain deficiencies. Am. J. Hum. Genet. 2016, 98, 993–1000. [Google Scholar] [CrossRef] [Green Version]
- Falk, M.J.; Gai, X.; Shigematsu, M.; Vilardo, E.; Takase, R.; McCormick, E.; Christian, T.; Place, E.; Pierce, E.A.; Consugar, M.; et al. A novel HSD17B10 mutation impairing the activities of the mitochondrial RNase P complex causes X-linked intractable epilepsy and neurodevelopmental regression. RNA Biol. 2016, 13, 477–485. [Google Scholar] [CrossRef]
- Han, L.; Diao, L.; Yu, S.; Xu, X.; Li, J.; Zhang, R.; Yang, Y.; Werner, H.M.; Eterovic, A.K.; Yuan, Y.; et al. The genomic landscape and clinical relevance of A-to-I RNA editing in human cancers. Cancer Cell 2015, 28, 515–528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paz, N.; Levanon, E.Y.; Amariglio, N.; Heimberger, A.B.; Ram, Z.; Constantini, S.; Barbash, Z.S.; Adamsky, K.; Safran, M.; Hirschberg, A.; et al. Altered adenosine-to-inosine RNA editing in human cancer. Genome Res. 2007, 17, 1586–1595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sasaki, S.; Yamashita, T.; Shin, K. Autophagy in spinal motor neurons of conditional ADAR2-knockout mice: An implication for a role of calcium in increased autophagy flux in ALS. Neurosci. Lett. 2015, 598, 79–84. [Google Scholar] [CrossRef]
- Yi, J.; Gao, R.; Chen, Y.; Yang, Z.; Han, P.; Zhang, H.; Dou, Y.; Liu, W.; Wang, W.; Du, G.; et al. Overexpression of NSUN2 by DNA hypomethylation is associated with metastatic progression in human breast cancer. Oncotarget 2017, 8, 20751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abbasi-Moheb, L.; Mertel, S.; Gonsior, M.; Nouri-Vahid, L.; Kahrizi, K.; Cirak, S.; Wieczorek, D.; Motazacker, M.M.; Esmaeeli-Nieh, S.; Cremer, K.; et al. Mutations in NSUN2 cause autosomal-recessive intellectual disability. Am. J. Hum. Genet. 2012, 90, 847–855. [Google Scholar] [CrossRef] [Green Version]
- Khan, M.A.; Rafiq, M.A.; Noor, A.; Hussain, S.; Flores, J.V.; Rupp, V.; Vincent, A.K.; Malli, R.; Ali, G.; Khan, F.S.; et al. Mutation in NSUN2, which encodes an RNA methyltransferase, causes autosomal-recessive intellectual disability. Am. J. Hum. Genet. 2012, 90, 856–863. [Google Scholar] [CrossRef] [Green Version]
- Jonkhout, N.; Tran, J.; Smith, M.A.; Schonrock, N.; Mattick, J.S.; Novoa, E.M. The RNA modification landscape in human disease. Rna 2017, 23, 1754–1769. [Google Scholar] [CrossRef] [Green Version]
- Siraj, A.; Chantsalnyam, T.; Tayara, H.; Chong, K.T. Recsno: Prediction of protein s-nitrosylation sites using a recurrent neural network. IEEE Access 2021, 9, 6674–6682. [Google Scholar] [CrossRef]
- Meyer, K.D.; Saletore, Y.; Zumbo, P.; Elemento, O.; Mason, C.E.; Jaffrey, S.R. Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell 2012, 149, 1635–1646. [Google Scholar] [CrossRef] [Green Version]
- Dominissini, D.; Moshitch-Moshkovitz, S.; Schwartz, S.; Salmon-Divon, M.; Ungar, L.; Osenberg, S.; Cesarkas, K.; Jacob-Hirsch, J.; Amariglio, N.; Kupiec, M.; et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012, 485, 201–206. [Google Scholar] [CrossRef]
- Chen, W.; Feng, P.; Ding, H.; Lin, H. Identifying N 6-methyladenosine sites in the Arabidopsis thaliana transcriptome. Mol. Genet. Genom. 2016, 291, 2225–2229. [Google Scholar] [CrossRef]
- Chen, W.; Feng, P.; Ding, H.; Lin, H.; Chou, K.-C. iRNA-Methyl: Identifying N6-methyladenosine sites using pseudo nucleotide composition. Anal. Biochem. 2015, 490, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xiao, X.; Yu, D.-J.; Jia, J.; Qiu, W.-R.; Chou, K.-C. pRNAm-PC: Predicting N6-methyladenosine sites in RNA sequences via physical–chemical properties. Anal. Biochem. 2016, 497, 60–67. [Google Scholar] [CrossRef] [PubMed]
- Jia, C.-Z.; Zhang, J.-J.; Gu, W.-Z. RNA-MethylPred: A high-accuracy predictor to identify N6-methyladenosine in RNA. Anal. Biochem. 2016, 510, 72–75. [Google Scholar] [CrossRef] [PubMed]
- Xiang, S.; Yan, Z.; Liu, K.; Zhang, Y.; Sun, Z. AthMethPre: A web server for the prediction and query of mRNA m6A sites in Arabidopsis thaliana. Mol. Biosyst. 2016, 12, 3333–3337. [Google Scholar] [CrossRef]
- Zhou, Y.; Zeng, P.; Li, Y.-H.; Zhang, Z.; Cui, Q. SRAMP: Prediction of mammalian N6-methyladenosine (m6A) sites based on sequence-derived features. Nucleic Acids Res. 2016, 44, e91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiang, S.; Liu, K.; Yan, Z.; Zhang, Y.; Sun, Z. RNAMethPre: A web server for the prediction and query of mRNA m6A sites. PLoS ONE 2016, 11, e0162707. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, L.; Su, R.; Wang, B.; Li, X.; Zou, Q.; Gao, X. Integration of deep feature representations and handcrafted features to improve the prediction of N6-methyladenosine sites. Neurocomputing 2019, 324, 3–9. [Google Scholar] [CrossRef]
- Qiang, X.; Chen, H.; Ye, X.; Su, R.; Wei, L. M6AMRFS: Robust prediction of N6-methyladenosine sites with sequence-based features in multiple species. Front. Genet. 2018, 9, 495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, L.; Chen, H.; Su, R. M6APred-EL: A sequence-based predictor for identifying N6-methyladenosine sites using ensemble learning. Mol. Ther. Nucleic Acids 2018, 12, 635–644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, L.; Luan, S.; Nagai, L.A.E.; Su, R.; Zou, Q. Exploring sequence-based features for the improved prediction of DNA N4-methylcytosine sites in multiple species. Bioinformatics 2019, 35, 1326–1333. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Zhou, C.; Chen, H.; Song, J.; Su, R. ACPred-FL: A sequence-based predictor using effective feature representation to improve the prediction of anti-cancer peptides. Bioinformatics 2018, 34, 4007–4016. [Google Scholar] [CrossRef] [PubMed]
- Nazari, I.; Tahir, M.; Tayara, H.; Chong, K.T. iN6-Methyl (5-step): Identifying RNA N6-methyladenosine sites using deep learning mode via Chou’s 5-step rules and Chou’s general PseKNC. Chemom. Intell. Lab. Syst. 2019, 193, 103811. [Google Scholar] [CrossRef]
- Alam, W.; Ali, S.D.; Tayara, H.; Chong, K.T. A CNN-Based RNA N6-Methyladenosine Site Predictor for Multiple Species Using Heterogeneous Features Representation. IEEE Access 2020, 8, 138203–138209. [Google Scholar] [CrossRef]
- Wu, Y.; He, K. Group normalization. In Proceedings of the European Conference on Computer Vision (ECCV), Munich, Germany, 8–14 September 2018; pp. 3–19. [Google Scholar]
- Chen, W.; Tang, H.; Lin, H. MethyRNA: A web server for identification of N6-methyladenosine sites. J. Biomol. Struct. Dyn. 2017, 35, 683–687. [Google Scholar] [CrossRef]
- Chen, W.; Tran, H.; Liang, Z.; Lin, H.; Zhang, L. Identification and analysis of the N6-methyladenosine in the Saccharomyces cerevisiae transcriptome. Sci. Rep. 2015, 5, 13859. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Yan, R. RFAthM6A: A new tool for predicting m6A sites in Arabidopsis thaliana. Plant Mol. Biol. 2018, 96, 327–337. [Google Scholar] [CrossRef]
- Linder, B.; Grozhik, A.V.; Olarerin-George, A.O.; Meydan, C.; Mason, C.E.; Jaffrey, S.R. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. Nat. Methods 2015, 12, 767–772. [Google Scholar] [CrossRef]
- Ke, S.; Alemu, E.A.; Mertens, C.; Gantman, E.C.; Fak, J.J.; Mele, A.; Haripal, B.; Zucker-Scharff, I.; Moore, M.J.; Park, C.Y.; et al. A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation. Genes Dev. 2015, 29, 2037–2053. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Hamada, M. DeepM6ASeq: Prediction and characterization of m6A-containing sequences using deep learning. BMC Bioinform. 2018, 19, 524. [Google Scholar] [CrossRef]
- Liu, K.; Chen, W. iMRM: A platform for simultaneously identifying multiple kinds of RNA modifications. Bioinformatics 2020, 36, 3336–3342. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; He, N.; Chen, Y.; Chen, Z.; Li, L. BERMP: A cross-species classifier for predicting m6A sites by integrating a deep learning algorithm and a random forest approach. Int. J. Biol. Sci. 2018, 14, 1669–1677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, J.; Troyanskaya, O.G. Predicting effects of noncoding variants with deep learning–based sequence model. Nat. Methods 2015, 12, 931–934. [Google Scholar] [CrossRef] [Green Version]
- Quang, D.; Xie, X. DanQ: A hybrid convolutional and recurrent deep neural network for quantifying the function of DNA sequences. Nucleic Acids Res. 2016, 44, e107. [Google Scholar] [CrossRef] [Green Version]
- Simonyan, K.; Vedaldi, A.; Zisserman, A. Deep inside convolutional networks: Visualising image classification models and saliency maps. arXiv 2013, arXiv:Preprint/1312.6034. [Google Scholar]
- Zou, J.; Huss, M.; Abid, A.; Mohammadi, P.; Torkamani, A.; Telenti, A. A primer on deep learning in genomics. Nat. Genet. 2019, 51, 12–18. [Google Scholar] [CrossRef]
- McCafferty, C.L.; Sergeev, Y.V. Global computational mutagenesis provides a critical stability framework in protein structures. PLoS ONE 2017, 12, e0189064. [Google Scholar] [CrossRef] [Green Version]




| Hyperparameters | Choices | 
|---|---|
| L2 Kernel Regularization | 1 × 10−3, 1 × 10−3, 1 × 10−3 | 
| L2 bias Regularization | 1 × 10−4, 1 × 10−4, 1 × 10−4 | 
| Group Normalization | 4, 4, 4 | 
| Drop-out | 0.5, 0.5, 0.5 | 
| Filters | (32, 16) (32, 16) (32, 16) | 
| FC Neurons | (24, 1), (24, 1), (24, 1) | 
| Learning rate | 0.001 | 
| Learning rate reduction factor | 0.01 | 
| Scheme | Positive Sequences | Negative Sequences | Total Samples | Sequence Length | 
|---|---|---|---|---|
| H. sapiens | 1130 | 1130 | 2260 | 41 nt | 
| M. musculus | 725 | 725 | 1450 | 41 nt | 
| S. cerevisiae | 1307 | 1307 | 2614 | 51 nt | 
| A. thaliana | 2100 | 2100 | 4200 | 101 nt | 
| Scheme | Training Samples | Testing Samples | Validation Samples | Total Samples | Sequence length | 
|---|---|---|---|---|---|
| Human | 36,998 | 12,331 | 12,332 | 61,661 | 101 nt | 
| Mouse | 28,271 | 9422 | 9424 | 47,117 | 101 nt | 
| Species | Concatenation | Accuracy | Sensitivity | Specificity | MCC | 
|---|---|---|---|---|---|
| H. sapiens | Concatenation in input space Concatenation in feature space | 0.9341 0.9491 | 0.8858 0.9274 | 0.9823 0.9708 | 0.8732 0.8996 | 
| M. musculus | Concatenation in input space | 0.9317 0.9428 | 0.8896 0.9256 | 0.9737 0.9610 | 0.8668 0.8865 | 
| Concatenation in feature space | |||||
| S. cerevisiae | Concatenation in input space Concatenation in feature space | 0.8570 0.8846 | 0.8623 0.8754 | 0.8518 0.8937 | 0.7154 0.7701 | 
| A. thaliana | Concatenation in input space Concatenation in feature space | 0.9333 0.9480 | 0.9400 0.9457 | 0.9267 0.9505 | 0.8673 0.8963 | 
| Approaches | Accuracy | Sensitivity | Specificity | MCC | AUC | 
|---|---|---|---|---|---|
| One-hot+NCP | 0.9496 | 0.9366 | 0.9626 | 0.9007 | 0.9726 | 
| One-hot+Circular | 0.9498 | 0.9353 | 0.9642 | 0.9012 | 0.9794 | 
| Circular+NCP | 0.9538 | 0.9380 | 0.9696 | 0.9093 | 0.9788 | 
| Approaches | Accuracy | Sensitivity | Specificity | MCC | 
|---|---|---|---|---|
| One-hot | 0.935 | 0.893 | 0.976 | 0.874 | 
| NCP | 0.928 | 0.895 | 0.961 | 0.859 | 
| Circular | 0.942 | 0.920 | 0.965 | 0.887 | 
| Approaches | Accuracy | Sensitivity | Specificity | MCC | AUC | 
|---|---|---|---|---|---|
| M6AMRFS [31] | 0.910 | 0.820 | 1.000 | 0.833 | - | 
| iN6-Methyl [35] | 0.911 | 0.788 | 1.000 | 0.835 | 0.903 | 
| iMRM [44] | 0.910 | 0.824 | 0.995 | 0.820 | 0.940 | 
| pm6A-CNN [36] | 0.936 | 0.886 | 0.986 | 0.878 | 0.960 | 
| bCNN-Methylpred | 0.941 | 0.929 | 0.953 | 0.883 | 0.979 | 
| Approaches. | Accuracy | Sensitivity | Specificity | MCC | AUC | 
|---|---|---|---|---|---|
| M6AMRFS [31] | 0.793 | 0.898 | 0.828 | 0.758 | - | 
| iN6-Methyl [35] | 0.895 | 0.821 | 1.000 | 0.807 | 0.913 | 
| iMRM [44] | 0.889 | 0.783 | 0.995 | 0.779 | 0.820 | 
| pm6A-CNN [36] | 0.938 | 0.904 | 0.972 | 0.88 | 0.970 | 
| bCNN-Methylpred | 0.945 | 0.937 | 0.953 | 0.891 | 0.942 | 
| Approaches | Accuracy | Sensitivity | Specificity | MCC | AUC | 
|---|---|---|---|---|---|
| BERMP [45] | 0.686 | 0.471 | 0.901 | 0.412 | 0.800 | 
| M6AMRFS [31] | 0.742 | 0.752 | 0.733 | 0.480 | - | 
| iN6-Methyl [35] | 0.753 | 0.761 | 0.746 | 0.507 | 0.803 | 
| iMRM [44] | 0.777 | 0.770 | 0.780 | 0.555 | 0.850 | 
| pm6A-CNN [36] | 0.850 | 0.846 | 0.855 | 0.703 | 0.920 | 
| bCNN-Methylpred | 0.889 | 0.890 | 0.888 | 0.779 | 0.943 | 
| Approaches | Accuracy | Sensitivity | Specificity | MCC | AUC | 
|---|---|---|---|---|---|
| BERMP [45] | 0.860 | 0.818 | 0.901 | 0.722 | 0.927 | 
| M6AMRFS [31] | 0.854 | 0.873 | 0.835 | 0.709 | - | 
| RFAthM6A [40] | 0.810 | 0.806 | 0.814 | 0.621 | 0.926 | 
| iN6-Methyl [35] | - | - | - | - | - | 
| iMRM [44] | - | - | - | - | - | 
| pm6A-CNN [36] | 0.925 | 0.923 | 0.926 | 0.850 | 0.970 | 
| bCNN-Methylpred | 0.942 | 0.944 | 0.941 | 0.885 | 0.977 | 
| Approaches | Species | Accuracy | F1-score | MCC | AUC | 
|---|---|---|---|---|---|
| DeepM6ASeq [43] | Human+Mouse | 0.764 | 0.762 | 0.528 | 0.844 | 
| Random forest | Human+Mouse | 0.747 | 0.756 | 0.494 | 0.826 | 
| Logistic regression | Human+Mouse | 0.743 | 0.736 | 0.487 | 0.824 | 
| Support vector machine | Human+Mouse | 0.736 | 0.732 | 0.472 | 0.818 | 
| bCNN-Methylpred | Human+Mouse | 0.801 | 0.809 | 0.604 | 0.876 | 
| bCNN-Methylpred | Human | 0.825 | 0.828 | 0.652 | 0.892 | 
| bCNN-Methylpred | Mouse | 0.824 | 0.826 | 0.648 | 0.896 | 
| Approaches | Species | Accuracy | F1-Score | MCC | AUC | 
|---|---|---|---|---|---|
| bCNN-Methylpred (CNN) | Human+Mouse | 0.801 | 0.809 | 0.604 | 0.876 | 
| Logistic regression (ML) | Human+Mouse | 0.743 | 0.736 | 0.487 | 0.824 | 
| Random forest (ML) | Human+Mouse | 0.747 | 0.756 | 0.494 | 0.826 | 
| Support vector machine (ML) | Human+Mouse | 0.736 | 0.732 | 0.472 | 0.818 | 
| Hyperparameters | bCNN-Methylpred | iN6-Methyl (34) | pm6A-CNN (35) | 
|---|---|---|---|
| Filters Arrangements in Convolutional Layers | (32,16) | (32,32) | (5,8,10,16) | 
| Filter size | (5,3) | (5,5) | (3,5,7) | 
| Stride | (1,1) | (1,2) | (2,3,4) | 
| Drop-out | 0.5, 0.5, 0.5 | 0.2, 0.2 | 0.2, 0.3, 0.4, 0.5 | 
| FC Neurons | (24,1) | (128,1) | (1,5,8,10,16) | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, N.; Park, J. bCNN-Methylpred: Feature-Based Prediction of RNA Sequence Modification Using Branch Convolutional Neural Network. Genes 2021, 12, 1155. https://doi.org/10.3390/genes12081155
Islam N, Park J. bCNN-Methylpred: Feature-Based Prediction of RNA Sequence Modification Using Branch Convolutional Neural Network. Genes. 2021; 12(8):1155. https://doi.org/10.3390/genes12081155
Chicago/Turabian StyleIslam, Naeem, and Jaebyung Park. 2021. "bCNN-Methylpred: Feature-Based Prediction of RNA Sequence Modification Using Branch Convolutional Neural Network" Genes 12, no. 8: 1155. https://doi.org/10.3390/genes12081155
APA StyleIslam, N., & Park, J. (2021). bCNN-Methylpred: Feature-Based Prediction of RNA Sequence Modification Using Branch Convolutional Neural Network. Genes, 12(8), 1155. https://doi.org/10.3390/genes12081155
 
         
                                                

 
       