DNA Methylation of Human Choline Kinase Alpha Promoter-Associated CpG Islands in MCF-7 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. In Silico Analysis of ckα Promoter Region for CpG Islands and Transcription Factor Binding Sites
2.2. Cell Culture
2.3. Treatment of Cells with 5-Azacytidine and Budesonide
2.4. Detection and Quantification of DNA Methylation Level
2.5. Construction of ckα Promoter-Luciferase Reporter Plasmids
2.6. Transfection and Luciferase Assay
2.7. In Vitro Methylation of ckα Promoter-Reporter Plasmid
2.8. Electrophoretic Mobility Shift Assay (EMSA)
2.9. Statistical Analysis
3. Results
3.1. Construction of ckα Promoter-Luciferase Reporter Plasmids
3.2. Identification of Regulatory CpG Islands in the ckα Promoter
3.3. Activity of In Vitro Methylated ckα Full-Length and CpG4C Deletion Promoter Constructs
3.4. Identification of the Regulatory Elements in the CpG4C of ckα Promoter
3.5. DNA Methylation Promotes the Binding of Putative MZF1 to ckα Promoter
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Gibellini, F.; Smith, T.K. The Kennedy pathway—de novo synthesis of phosphatidylethanolamine and phosphatidylcholine. IUBMB Life 2010, 62, 414–428. [Google Scholar] [CrossRef] [Scilit]
- Wu, G.; Aoyama, C.; Young, S.G.; Vance, D.E. Early embryonic lethality caused by disruption of the gene for choline kinase α, the first enzyme in phosphatidylcholine biosynthesis. J. Biol. Chem. 2008, 283, 1456–1462. [Google Scholar] [CrossRef] [Scilit]
- Gallego-Ortega, D.; del Pulgar Gómez, T.; Valdés-Mora, F.; Cebrián, A.; Lacal, J.C. Involvement of human choline kinase α and β in carcinogenesis: A different role in lipid metabolism and biological functions. Adv. Enzym. Regul. 2011, 51, 183–194. [Google Scholar] [CrossRef] [Scilit]
- Iorio, E.; Caramujo, M.J.; Cecchetti, S.; Spadaro, F.; Carpinelli, G.; Canese, R.; Podo, F. Key players in choline metabolic reprograming in triple-negative breast cancer. Front. Oncol. 2016, 6, 205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arlauckas, S.P.; Popov, A.V.; Delikatny, E.J. Choline kinase α—Putting the ChoK-hold on tumor metabolism. Prog. Lipid Res. 2016, 63, 28–40. [Google Scholar] [CrossRef] [Scilit]
- Glunde, K.; Penet, M.-F.; Jiang, L.; Jacobs, M.A.; Bhujwalla, Z.M. Choline metabolism-based molecular diagnosis of cancer: An update. Expert Rev. Mol. Diagn. 2015, 15, 735–747. [Google Scholar] [CrossRef] [Scilit]
- Rizzo, A.; Satta, A.; Garrone, G.; Cavalleri, A.; Napoli, A.; Raspagliesi, F.; Figini, M.; De Cecco, L.; Iorio, E.; Tomassetti, A.; et al. Choline kinase α impairment overcomes TRAIL resistance in ovarian cancer cells. J. Exp. Clin. Cancer Res. 2021, 40, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Khalifa, M.; Few, L.L.; See Too, W.C. ChoK-ing the Pathogenic Bacteria: Potential of Human Choline Kinase Inhibitors as Antimicrobial Agents. BioMed Res. Int. 2020, 2020, 1823485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trousil, S.; Kaliszczak, M.; Schug, Z.; Nguyen, Q.-D.; Tomasi, G.; Favicchio, R.; Brickute, D.; Fortt, R.; Twyman, F.J.; Carroll, L.; et al. The novel choline kinase inhibitor ICL-CCIC-0019 reprograms cellular metabolism and inhibits cancer cell growth. Oncotarget 2016, 7, 37103. [Google Scholar] [CrossRef] [Scilit]
- Zimmerman, T.; Ibrahim, S. Choline kinase, a novel drug target for the inhibition of Streptococcus pneumoniae. Antibiotics 2017, 6, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bansal, A.; Harris, R.A.; DeGrado, T.R. Choline phosphorylation and regulation of transcription of choline kinase α in hypoxia. J. Lipid Res. 2012, 53, 149–157. [Google Scholar] [CrossRef] [Scilit]
- Domizi, P.; Aoyama, C.; Banchio, C. Choline kinase α expression during RA-induced neuronal differentiation: Role of C/EBPβ. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2014, 1841, 544–551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Domizi, P.; Malizia, F.; Chazarreta-Cifre, L.; Diacovich, L.; Banchio, C. KDM2B regulates choline kinase expression and neuronal differentiation of neuroblastoma cells. PLoS ONE 2019, 14, e0210207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayub Khan, S.M.; Few, L.L.; See Too, W.C. Downregulation of human choline kinase α gene expression by miR-876-5p. Mol. Med. Rep. 2018, 17, 7442–7450. [Google Scholar] [PubMed]
- Raikundalia, S.; Mohamed Sa’dom, S.A.F.; Few, L.L.; See Too, W.C. MicroRNA-367-3p induces apoptosis and suppresses migration of MCF-7 cells by downregulating the expression of human choline kinase α. Oncol. Lett. 2021, 21, 183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hon, G.C.; Hawkins, R.D.; Caballero, O.L.; Lo, C.; Lister, R.; Pelizzola, M.; Valsesia, A.; Ye, Z.; Kuan, S.; Edsall, L.E.; et al. Global DNA hypomethylation coupled to repressive chromatin domain formation and gene silencing in breast cancer. Genome Res. 2012, 22, 246–258. [Google Scholar] [CrossRef] [Scilit]
- Edwards, J.R.; Yarychkivska, O.; Boulard, M.; Bestor, T.H. DNA methylation and DNA methyltransferases. Epigenet. Chromatin 2017, 10, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Romero-Garcia, S.; Prado-Garcia, H.; Carlos-Reyes, A. Role of DNA methylation in the resistance to therapy in solid tumors. Front. Oncol. 2020, 10, 1152. [Google Scholar] [CrossRef] [Scilit]
- Jin, B.; Li, Y.; Robertson, K.D. DNA methylation: Superior or subordinate in the epigenetic hierarchy? Genes Cancer 2011, 2, 607–617. [Google Scholar] [CrossRef] [Scilit]
- Sasai, N.; Nakao, M.; Defossez, P.A. Sequence-specific recognition of methylated DNA by human zinc-finger proteins. Nucleic Acids Res. 2010, 38, 5015–5022. [Google Scholar] [CrossRef] [Scilit]
- Llinas-Arias, P.; Esteller, M. Epigenetic inactivation of tumour suppressor coding and non-coding genes in human cancer: An update. Open Biol. 2017, 7, 170152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deaton, A.M.; Bird, A. CpG islands and the regulation of transcription. Genes Dev. 2011, 25, 1010–1022. [Google Scholar] [CrossRef] [Scilit]
- Casalino, L.; Verde, P. Multifaceted roles of DNA methylation in neoplastic transformation, from tumor suppressors to EMT and metastasis. Genes 2020, 11, 922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lian, Z.-Q.; Wang, Q.; Li, W.-P.; Zhang, A.-Q.; Wu, L. Screening of significantly hypermethylated genes in breast cancer using microarray-based methylated-CpG island recovery assay and identification of their expression levels. Int. J. Oncol. 2012, 41, 629–638. [Google Scholar] [CrossRef] [Scilit]
- Sa’dom, S.A.F.M.; Azemi, N.F.H.; Umar, M.S.M.; Hiang, Y.Y.; Too, W.C.S.; Few, L.L. DNA Methylation of Human Choline Kinase α Gene. Sains Malays. 2020, 49, 161–168. [Google Scholar]
- Cartharius, K.; Frech, K.; Grote, K.; Klocke, B.; Haltmeier, M.; Klingenhoff, A.; Frisch, M.; Bayerlein, M.; Werner, T. MatInspector and beyond: Promoter analysis based on transcription factor binding sites. Bioinformatics 2005, 21, 2933–2942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farré, D.; Roset, R.; Huerta, M.; Adsuara, J.E.; Roselló, L.; Albà, M.M.; Messeguer, X. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003, 31, 3651–3653. [Google Scholar] [CrossRef] [Scilit]
- Chiba, T.; Yokosuka, O.; Arai, M.; Tada, M.; Fukai, K.; Imazeki, F.; Kato, M.; Seki, N.; Saisho, H. Identification of genes up-regulated by histone deacetylase inhibition with cDNA microarray and exploration of epigenetic alterations on hepatoma cells. J. Hepatol. 2004, 41, 436–445. [Google Scholar] [CrossRef] [Scilit]
- Orta, M.L.; Domínguez, I.; Pastor, N.; Cortés, F.; Mateos, S. The role of the DNA hypermethylating agent Budesonide in the decatenating activity of DNA topoisomerase II. Mutat. Res./Fundam. Mol. Mech. Mutagen. 2010, 694, 45–52. [Google Scholar] [CrossRef] [Scilit]
- Ho, S.N.; Hunt, H.D.; Horton, R.M.; Pullen, J.K.; Pease, L.R. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989, 77, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Kuan, C.S.; Yee, Y.H.; Too, W.C.S.; Few, L.L. Ets and GATA Transcription Factors Play a Critical Role in PMA-Mediated Repression of the ckβ Promoter via the Protein Kinase C Signaling Pathway. PLoS ONE 2014, 9, e113485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, Y.; Yamashita, R.; Nakai, K.; Sugano, S. DBTSS: DataBase of human Transcriptional Start Sites and full-length cDNAs. Nucleic Acids Res. 2002, 30, 328–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antequera, F. Structure, function and evolution of CpG island promoters. Cell. Mol. Life Sci. CMLS 2003, 60, 1647–1658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mendizabal, I.; Yi, S.V. Diversity of human CpG islands. In Handbook of Nutrition, Diet, and Epigenetics; Patel, V.B., Preedy, V.R., Eds.; Springer: Cham, Switzerland, 2019; pp. 265–280. [Google Scholar]
- Hackenberg, M.; Barturen, G.; Carpena, P.; Luque-Escamilla, P.L.; Previti, C.; Oliver, J.L. Prediction of CpG-island function: CpG clustering vs. sliding-window methods. BMC Genom. 2010, 11, 327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smale, S.T.; Kadonaga, J.T. The RNA polymerase II core promoter. Ann. Rev. Biochem. 2003, 72, 449–479. [Google Scholar] [CrossRef] [Scilit]
- Yella, V.R.; Bansal, M. DNA structural features of eukaryotic TATA-containing and TATA-less promoters. FEBS Openbio 2017, 7, 324–334. [Google Scholar] [CrossRef] [Scilit]
- Thakur, D.; Verma, P.; Mathur, R.; Kamthania, M.; Jha, A.K. Reversal of Hypermethylation and Activation of Tumor Suppressor Genes Due to Plant Extracts in Prostate Cancer. Adv. Biotechnol. Microbiol. 2019, 14, 555880. [Google Scholar]
- Zhao, S.; Wu, H.; Cao, M.; Han, D. 5-aza-2′-deoxycytidine, a DNA methylation inhibitor, attenuates hyperoxia-induced lung fibrosis via re-expression of P16 in neonatal rats. Pediatr. Res. 2018, 83, 723–730. [Google Scholar] [CrossRef] [Scilit]
- Ciechomska, M.; Roszkowski, L.; Maslinski, W. DNA methylation as a future therapeutic and diagnostic target in rheumatoid arthritis. Cells 2019, 8, 953. [Google Scholar] [CrossRef] [Scilit]
- Pereira, M.A.; Tao, L.; Liu, Y.; Li, L.; Steele, V.E.; Lubet, R.A. Modulation by budesonide of DNA methylation and mRNA expression in mouse lung tumors. Int. J. Cancer 2007, 120, 1150–1153. [Google Scholar] [CrossRef] [Scilit]
- Héberlé, É.; Bardet, A.F. Sensitivity of transcription factors to DNA methylation. Essays Biochem. 2019, 63, 727–741. [Google Scholar] [CrossRef] [Scilit]
- Rishi, V.; Bhattacharya, P.; Chatterjee, R.; Rozenberg, J.; Zhao, J.; Glass, K.; Fitzgerald, P.; Vinson, C. CpG methylation of half-CRE sequences creates C/EBPα binding sites that activate some tissue-specific genes. Proc. Natl. Acad. Sci. USA 2010, 107, 20311–20316. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Z.; Meng, W.; Liu, P.; Zhu, X.; Liu, Y.; Zou, H. DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding. Clin. Epigenet. 2017, 9, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Yin, Y.; Morgunova, E.; Jolma, A.; Kaasinen, E.; Sahu, B.; Khund-Sayeed, S.; Das, P.K.; Kivioja, T.; Dave, K.; Zhong, F.; et al. Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science 2017, 356, eaaj2239. [Google Scholar] [CrossRef] [Scilit]
- Brix, D.M.; Bundgaard Clemmensen, K.K.; Kallunki, T. Zinc Finger Transcription Factor MZF1—A Specific Regulator of Cancer Invasion. Cells 2020, 9, 223. [Google Scholar] [CrossRef] [Scilit]
- Eguchi, T.; Prince, T.; Wegiel, B.; Calderwood, S.K. Role and regulation of myeloid zinc finger protein 1 in cancer. J. Cell. Biochem. 2015, 116, 2146–2154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caradonna, F.; Cruciata, I.; Schifano, I.; La Rosa, C.; Naselli, F.; Chiarelli, R.; Perrone, A.; Gentile, C. Methylation of cytokines gene promoters in IL-1β-treated human intestinal epithelial cells. Inflamm. Res. 2018, 67, 327–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perrotti, D.; Melotti, P.; Skorski, T.; Casella, I.; Peschle, C.; Calabretta, B. Overexpression of the zinc finger protein MZF1 inhibits hematopoietic development from embryonic stem cells: Correlation with negative regulation of CD34 and c-myb promoter activity. Mol. Cell. Biol. 1995, 15, 6075–6087. [Google Scholar] [CrossRef] [Scilit]
- Pulecio, J.; Verma, N.; Mejía-Ramírez, E.; Huangfu, D.; Raya, A. CRISPR/Cas9-based engineering of the epigenome. Cell Stem Cell 2017, 21, 431–447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.; Tao, Y.; Gao, X.; Zhang, L.; Li, X.; Zou, W.; Ruan, K.; Wang, F.; Xu, G.; Hu, R. A CRISPR-based approach for targeted DNA demethylation. Cell Discov. 2016, 2, 1–12. [Google Scholar] [CrossRef] [Scilit]






| Name | Sequence 5′ to 3′ |
|---|---|
| Methylated-DNA IP (MeDIP) | |
| ckα-CpG1-5′ | TATCCTTAAATAAGACCATTTTGCC |
| ckα-CpG1-3′ | TAGTAGAGACGGGGTTTCAT |
| ckα-CpG2-5′ | AAAATTAGCCAGGCGTCGTG |
| ckα-CpG2-3′ | GAGTTCACAGTCTTCCAGAAGCAA |
| ckα-CpG3-5′ | CGAGCATCCTCAGTACCACGGA |
| ckα-CpG3-3′ | AGCAGCCTCCTCCTGGGGCTCA |
| ckα-CpG4A-5′ | TCCGAGGGGTCCAAGGAAAC |
| ckα-CpG4A-3′ | TGAGCGGGGCCTGGCCGAA |
| ckα-CpG4B-5′ | CCCCTCGACGCCCCGCCCCCTT |
| ckα-CpG4B-3′ | TCGCTCCTCTGCCGCCGCCGCACG |
| ckα-CpG4C-5′ | AGCGCGAGGGCGGGCTGTGAC |
| ckα-CpG4C-3′ | TGCCCGACAGGCGGCCGAGGA |
| CpG island deletion | |
| ckα-∆CpG1-5′ | TAAATAAGACCATTTTGCGTGGAGGCTAACACGATGAAACC |
| ckα-∆CpG1-3′ | GGTTTCATCGTGTTAGCCTCCACGCAAAATGGTCTTATTTA |
| ckα-∆CpG2-5′ | AATTAGCCAGGCGTCGTGCTCAAAAAAAAAACCAAAA AACATTTTTGC |
| ckα-∆CpG2-3′ | GCAAAAATGTTTTTTGGTTTTTTTTTTGAGCACGACGCCT GGCTAATT |
| ckα-∆CpG3-5′ | CTCAGTACCACGGGAGCCCCAGGAGG |
| ckα-∆CpG3-3′ | CCTCCTGGGGCCTCCCGTGGTACTGAG |
| ckα-∆CpG4A-5′ | GGGTCCAAGGAAACTTCGCCCAGGCCCC |
| ckα-∆CpG4A-3′ | GGGGCCTGGGCGAAGTTTCCTTGGACCC |
| ckα-∆CpG4B-5′ | CCCCGCCCCCCGTGCGGCGG |
| ckα-∆CpG4B-3′ | CCGCCGCACGGGGGGCGGGG |
| ckα-∆CpG4C-5′ | GGCCGGCGCTCCTGAGCCTAGTCCTC |
| ckα-∆CpG4C-3′ | GAGGACTAGGCTCAGGAGCGCCGGCC |
| Mutation at transcription factor binding site | |
| ckα-mut(MZF1)-5′ | CCCCCTTTCACGCCGGCCTGCCAGTGA |
| ckα-mut(MZF1)-3′ | CGGCGTGAAAGGGGGCCGCGGCGGTT |
| Names | Sequences |
|---|---|
| Biotin-ckα-MZF1 | 5′-CAGCAGCACATCCCCGCTCCACAGTCGCC-3′-Biotin |
| Biotin-ckα-mut(MZF1) | 5′-CAGCAGCACATtaCtGCTCCACAGTCGCC-3′-Biotin |
| ckα-MZF1 complementary probe | 5′-GTCGTCGTGTAGGGGCGAGGTGTCAGCGG-3′ |
| ckα-mut(MZF1) complementary probe | 5′-GTCGTCGTGTAATGACGAGGTGTCAGCGG-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mohamed Sa’dom, S.A.F.; Raikundalia, S.; Shamsuddin, S.; See Too, W.C.; Few, L.L. DNA Methylation of Human Choline Kinase Alpha Promoter-Associated CpG Islands in MCF-7 Cells. Genes 2021, 12, 853. https://doi.org/10.3390/genes12060853
Mohamed Sa’dom SAF, Raikundalia S, Shamsuddin S, See Too WC, Few LL. DNA Methylation of Human Choline Kinase Alpha Promoter-Associated CpG Islands in MCF-7 Cells. Genes. 2021; 12(6):853. https://doi.org/10.3390/genes12060853
Chicago/Turabian StyleMohamed Sa’dom, Siti Aisyah Faten, Sweta Raikundalia, Shaharum Shamsuddin, Wei Cun See Too, and Ling Ling Few. 2021. "DNA Methylation of Human Choline Kinase Alpha Promoter-Associated CpG Islands in MCF-7 Cells" Genes 12, no. 6: 853. https://doi.org/10.3390/genes12060853
APA StyleMohamed Sa’dom, S. A. F., Raikundalia, S., Shamsuddin, S., See Too, W. C., & Few, L. L. (2021). DNA Methylation of Human Choline Kinase Alpha Promoter-Associated CpG Islands in MCF-7 Cells. Genes, 12(6), 853. https://doi.org/10.3390/genes12060853

