Sequencing of the Complete Mitochondrial Genome of Pingus sinensis (Spirurina: Quimperiidae): Gene Arrangements and Phylogenetic Implications
Abstract
:1. Introduction
2. Materials and Methods
2.1. Specimen Collection
2.2. DNA Extraction and Amplification
2.3. Genome Assembly
2.4. Phylogenetic and Gene Order Analyses
3. Results
3.1. Genome Organization and Nucleotide Composition
3.2. Protein-Coding Genes and Codon Usage
3.3. Transfer RNA and Ribosomal RNA Genes
3.4. Non-Coding Regions
3.5. Phylogeny
3.6. GO Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Golden, A.M. Classification of the genera and higher categories of the order Tylenchida (Nematoda). J. Parasitol. 1970, 56, 191–232. [Google Scholar]
- Poinar, G.O. Nematoda and Nematomorpha. In Ecology and Classification of North American Freshwater Invertebrates; Thorp, J.H., Covich, A.P., Eds.; Academic Press: Cambridge, MA, USA, 2010; Chapter 9; pp. 237–276. [Google Scholar]
- De Ley, P.; Blaxter, M.L. Systematic Position and Phylogeny. In The Biology of Nematodes; Taylor & Francis: London, UK, 2002; pp. 1–30. [Google Scholar]
- Koutsovoulos, G.D. Reconstructing the Phylogenetic Relationships of Nematodes Using Draft Genomes and Transcriptomes: University of Edinburgh. Ph.D. Thesis, University of Edinburgh, Edinburgh, UK, 2015. [Google Scholar]
- Zou, H.; Jakovlić, I.; Chen, R.; Zhang, D.; Zhang, J.; Li, W.-X.; Wang, G.-T. The complete mitochondrial genome of parasitic nematode Camallanus cotti: Extreme discontinuity in the rate of mitogenomic architecture evolution within the Chromadorea class. BMC Genom. 2017, 18, 840. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, J.-K.; Sultana, T.; Lee, S.-H.; Kang, S.; Kim, H.K.; Min, G.-S.; Eom, K.; Nadler, S.A. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genom. 2011, 12, 392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duchêne, S.; Archer, F.I.; Vilstrup, J.; Caballero, S.; Morin, P.A. Mitogenome phylogenetics: The impact of using single regions and partitioning schemes on topology, substitution rate and divergence time estimation. PLoS ONE 2011, 6, e27138. [Google Scholar] [CrossRef] [Green Version]
- Gissi, C.; Iannelli, F.; Pesole, G. Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity 2008, 101, 301–320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boore, J.L. Big trees from little genomes: Mitochondrial gene order as a phylogenetic tool. Curr. Opin. Genet. Dev. 1998, 8, 668–674. [Google Scholar] [CrossRef]
- Fritzsch, G.; Schlegel, M.; Stadler, P.F. Alignments of mitochondrial genome arrangements: Applications to metazoan phylogeny. J. Theor. Biol. 2006, 240, 511–520. [Google Scholar] [CrossRef] [Green Version]
- Avise, J.C.; Arnold, J.; Ball, R.M.; Bermingham, E.; Lamb, T.; Neigel, J.E.; Reeb, C.A.; Saunders, N.C. Intraspecific Phylogeography: The Mitochondrial DNA Bridge Between Population Genetics and Systematics. Annu. Rev. Ecol. Syst. 1987, 18, 489–522. [Google Scholar] [CrossRef]
- Brown, W.M.; George, M.; Wilson, A.C. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 1979, 76, 1967–1971. [Google Scholar] [CrossRef] [Green Version]
- Vawter, L.; Brown, W. Nuclear and mitochondrial DNA comparisons reveal extreme rate variation in the molecular clock. Science 1986, 234, 194–196. [Google Scholar] [CrossRef]
- Rubinoff, D.; Holland, B.S.; Savolainen, V. Between Two Extremes: Mitochondrial DNA is neither the Panacea nor the Nemesis of Phylogenetic and Taxonomic Inference. Syst. Biol. 2005, 54, 952–961. [Google Scholar] [CrossRef]
- Zhang, D.; Zou, H.; Hua, C.J.; Li, W.-X.; Mahboob, S.; Al-Ghanim, K.A.; Al-Misned, F.; Jakovlić, I.; Wang, G.-T. Mitochondrial Architecture Rearrangements Produce Asymmetrical Nonadaptive Mutational Pressures That Subvert the Phylogenetic Reconstruction in Isopoda. Genome Biol. Evol. 2019, 11, 1797–1812. [Google Scholar] [CrossRef] [Green Version]
- Smith, M.J.; Arndt, A.; Gorski, S.; Fajber, E. The phylogeny of echinoderm classes based on mitochondrial gene arrangements. J. Mol. Evol. 1993, 36, 545–554. [Google Scholar] [CrossRef]
- Boore, J.L.; Brown, W.M. Mitochondrial genomes of Galathealinum, Helobdella, and Platynereis: Sequence and gene arrangement comparisons indicate that Pogonophora is not a phylum and Annelida and Arthropoda are not sister taxa. Mol. Biol. Evol. 2000, 17, 87–106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hwang, U.W.; Friedrich, M.; Tautz, D.; Park, C.J.; Kim, W. Mitochondrial protein phylogeny joins myriapods with chelicerates. Nature 2001, 413, 154–157. [Google Scholar] [CrossRef] [PubMed]
- Bret, L.; Simon, D.L.; Kadane, J.B.; Deborah, S. A bayesian analysis of metazoan mitochondrial genome arrangements. Mol. Biol. Evol. 2005, 22, 486–495. [Google Scholar]
- Blaxter, M.L.; De Ley, P.; Garey, J.R.; Liu, L.X.; Scheldeman, P.; Vierstraete, A.; Vanfleteren, J.R.; Mackey, L.Y.; Dorris, M.; Frisse, L.M.; et al. A molecular evolutionary framework for the phylum Nematoda. Nature 1998, 392, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Blaxter, M.L. Nematoda: Genes, genomes and the evolution of parasitism. Adv. Parasitol. 2003, 54, 101–195. [Google Scholar]
- Wijová, M.; Moravec, F.; Horák, A.; Lukes, J. Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rRNA gene sequences. Int. J. Parasitol. 2006, 36, 1067–1075. [Google Scholar] [CrossRef]
- Moravec, F.; Nie, P.; Wang, G.; Moravec, F.; Nie, P.; Wang, G. Some nematodes of fishes from central China, with the redescription of Procamallanus (Spirocamallanus) fulvidraconis (Camallanidae). Folia Parasitol. 2003, 50, 220–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Floyd, R.M.; Rogers, A.D.; Lambshead, P.J.D.; Smith, C.R. Nematode-specific PCR primers for the 18S small subunit rRNA gene. Mol. Ecol. Notes 2005, 5, 611–612. [Google Scholar] [CrossRef]
- Burland, T.G. DNASTAR’s Lasergene sequence analysis software. In Bioinformatics Methods and Protocols; Humana Press: Totowa, NJ, USA, 2000; pp. 71–91. [Google Scholar]
- Zou, H.; Jakovli, I.; Zhang, D.; Hua, C.J.; Wang, G.T. Architectural instability, inverted skews and mitochondrial phylogenomics of Isopoda: Outgroup choice affects the long-branch attraction artefacts. R. Soc. Open Sci. 2020, 7, 191887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, D.; Li, W.X.; Zou, H.; Wu, S.G.; Li, M.; Jakovlić, I.; Zhang, J.; Chen, R.; Wang, G.T. Mitochondrial genomes of two diplectanids (Platyhelminthes: Monogenea) expose paraphyly of the order Dactylogyridea and extensive tRNA gene rearrangements. Parasites Vectors 2018, 11, 601. [Google Scholar] [CrossRef]
- Zhang, D.; Zou, H.; Jakovli, I.; Wu, S.G.; Li, M.; Zhang, J.; Chen, R.; Li, W.X.; Wang, G.T. Mitochondrial Genomes of Two Thaparocleidus Species (Platyhelminthes: Monogenea) Reveal the First rRNA Gene Rearrangement among the Neodermata. Int. J. Mol. Sci. 2019, 20, 4214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, D.; Zou, H.; Wu, S.G.; Li, M.; Li, W.X. Sequencing, characterization and phylogenomics of the complete mitochondrial genome of Dactylogyrus lamellatus (Monogenea: Dactylogyridae). J. Helminthol. 2017, 92, 455–466. [Google Scholar] [CrossRef] [Green Version]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Laslett, D.; Canbäck, B. ARWEN: A program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 2007, 24, 172–175. [Google Scholar] [CrossRef] [Green Version]
- Wyman, S.K.; Jansen, R.K.; Boore, J.L. Automatic annotation of organellar genomes with DOGMA. Bioinformatics 2004, 20, 3252–3255. [Google Scholar] [CrossRef] [Green Version]
- Bernt, M.; Donath, A.; Jühling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Fritzsch, G.; Pütz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenetics Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2019, 20, 348–355. [Google Scholar] [CrossRef]
- Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suyama, M.; Torrents, D.; Bork, P. PAL2NAL: Robust conversion of protein sequence alignments into the corresponding codon alignments. Nucleic Acids Res. 2006, 34, W609–W612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernt, M.; Merkle, D.; Ramsch, K.; Fritzsch, G.; Perseke, M.; Bernhard, D.; Schlegel, M.; Stadler, P.F.; Middendorf, M. CREx: Inferring genomic rearrangements based on common intervals. Bioinformatics 2007, 23, 2957–2958. [Google Scholar] [CrossRef] [Green Version]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol. Biol. Evol. 2016, 34, 772–773. [Google Scholar] [CrossRef] [Green Version]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.; Huelsenbeck, J. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Green Version]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [Green Version]
- Minh, B.Q.; Nguyen, M.A.T.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Hu, F.; Lin, Y.; Tang, J. MLGO: Phylogeny reconstruction and ancestral inference from gene-order data. BMC Bioinform. 2014, 15, 354. [Google Scholar] [CrossRef] [Green Version]
- Lin, Y.; Hu, F.; Tang, J.; Moret, B.M.E. Maximum likelihood phylogenetic reconstruction from high-resolution whole-genome data and a tree of 68 eukaryotes. Biocomputing 2013, 285–296. [Google Scholar] [CrossRef] [Green Version]
- Lavrov, D.V.; Brown, W.M. Trichinella spiralis mtDNA: A nematode mitochondrial genome that encodes a putative ATP8 and normally structured tRNAS and has a gene arrangement relatable to those of coelomate metazoans. Genetics 2001, 157, 621–637. [Google Scholar] [CrossRef]
- Kim, K.H.; Eom, K.S.; Park, J.K. The complete mitochondrial genome of Anisakis simplex (Ascaridida: Nematoda) and phylogenetic implications. Int. J. Parasitol. 2006, 36, 319–328. [Google Scholar] [CrossRef]
- Hu, M.; Chilton, N.B.; Gasser, R.B. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int. J. Parasitol. 2002, 32, 145–158. [Google Scholar] [CrossRef]
- Herbeck, J.; Novembre, J. Codon Usage Patterns in Cytochrome Oxidase I Across Multiple Insect Orders. J. Mol. Evol. 2003, 56, 691–701. [Google Scholar] [CrossRef] [Green Version]
- Hu, M.; Chilton, N.B.; Gasser, R.B. The mitochondrial genome of Strongyloides stercoralis (Nematoda)—Idiosyncratic gene order and evolutionary implications. Int. J. Parasitol. 2003, 33, 1393–1408. [Google Scholar] [CrossRef]
- Unnasch, H.T.R. The mitochondrial genome of Onchocerca volvulus: Sequence, structure and phylogenetic analysis. Mol. Biochem. Parasitol. 1998, 95, 111–127. [Google Scholar]
- Okimoto, R.; Macfarlane, J.L.; Clary, D.O.; Wolstenholme, D.R. The Mitochondrial Genomes of Two Nematodes, Caenorhabditis elegans and Ascaris suum. Genetics 1992, 130, 471–498. [Google Scholar] [CrossRef] [PubMed]
- Ramesh, A.; Small, S.T.; Kloos, Z.A.; Kazura, J.W.; Nutman, T.B.; Serre, D.; Zimmerman, P.A. The complete mitochondrial genome sequence of the filarial nematode Wuchereria bancrofti from three geographic isolates provides evidence of complex demographic history. Mol. Biochem. Parasitol. 2012, 183, 32–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sultana, T.; Kim, J.; Lee, S.H.; Han, H.; Park, J.K. Comparative analysis of complete mitochondrial genome sequences confirms independent origins of plant-parasitic nematodes. BMC Evol. Biol. 2013, 13, 12. [Google Scholar] [CrossRef] [Green Version]
- Levinson, G.; Gutman, G.A. Slipped-strand mispairing: A major mechanism for DNA sequence evolution. Mol. Biol. Evol. 1987, 4, 203–221. [Google Scholar]
- Černotíková, E.; Horák, A.; Moravec, F. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences. Folia Parasitol. 2011, 58, 135–148. [Google Scholar] [CrossRef] [Green Version]
- Liu, G.H.; Jia, Y.Q.; Wang, Y.N.; Zhao, G.H.; Zhu, X.-Q. The complete mitochondrial genome of the gullet worm Gongylonema pulchrum: Gene content, arrangement, composition and phylogenetic implications. Parasites Vectors 2015, 8, 100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boore, J.L.; Fuerstenberg, S.I. Beyond linear sequence comparisons: The use of genome-level characters for phylogenetic reconstruction. Philos. Trans. R. Soc. B Biol. Sci. 2008, 363, 1445–1451. [Google Scholar] [CrossRef] [PubMed]
- Kern, E.; Kim, T.; Park, J.K. The mitochondrial genome in nematode phylogenetics. Front. Ecol. Evol. 2020, 8, 250. [Google Scholar] [CrossRef]
- Kim, J.; Kern, E.; Kim, T.; Sim, M.; Kim, J.; Kim, Y.; Park, C.; Nadler, S.A.; Park, J.-K. Phylogenetic analysis of two Plectus mitochondrial genomes (Nematoda: Plectida) supports a sister group relationship between Plectida and Rhabditida within Chromadorea. Mol. Phylogenetics Evol. 2017, 107, 90–102. [Google Scholar] [CrossRef] [PubMed]
Fragment No. | Gene or Region | Primer Name | Sequence (5′-3′) | Length (bp) |
---|---|---|---|---|
F1 | COX1 | C1F1 | ATTGGGGGGTTTGGTAATTG | 506 |
C1R1 | TAAACTTCAGGGTGGCCAAA | |||
F2 | COX1-16S | C1F2 | TGGCAGGAGCTATTACTATG | 2452 |
C1R2 | CATAAGCCGAAGACTTCATTC | |||
F3 | 16S | C1F3 | ATGGCAGTCTTAGCGTGAGG | 404 |
C1R3 | TCTATCTCGCGATGAATTAAAC | |||
F4 | 16S-ND5 | C1F4 | CAGGAAATCATGCTAGATAG | 1328 |
C1R4 | CTACCAAAGCAGAAAATCTAGC | |||
F5 | ND5 | C1F5 | GAAGGTGGTTGCCTAAGGCGA | 234 |
C1R5 | GAGATAAAGTTCTCAAAGCAAC | |||
F6 | ND5-12S | C1F6 | TGGAGAACTTGTGTTGGTG | 2068 |
C1R6 | GTTTAACAAATCTTAATTCTG | |||
F7 | 12S | C1F7 | TGTTCCAGAATAATCGGCTA | 511 |
C1R7 | CAATTGATGGATGATTTGTACC | |||
F8 | 12S-ND1 | C1F8 | TGTGGATCTAGATTAGAG | 802 |
C1R8 | GACAAACCAGGTACTAAC | |||
F9 | ND1 | C1F9 | ACGTTTGGGTCCTAATAAGG | 482 |
C1R9 | CTGAAAAATCAAAAGGCGCC | |||
F10 | ND1-CYTB | C1F10 | GTGTTGCTTATGAGATTGC | 2902 |
C1R10 | CCAATAACCCCCAAGGTAAC | |||
F11 | CYTB | C1F11 | GGCTCAAATGAGGTTTTGGGC | 412 |
C1R11 | ATATCACTCAGGAACAATATGG | |||
F12 | CYTB-ND4 | C1F12 | GTTTTGTTGAGGCCCTTTAG | 1967 |
C1R12 | CCTAAAAGAACTACCCAAAAC | |||
F13 | ND4 | C1F13 | GCTCATGTTGAAGCACCTAC | 206 |
C1R13 | GAAGAATAAGCAGCCAAAG | |||
F14 | ND4-COX1 | C1F14 | GTTTTGGGTAGTTCTTTTAGG | 1481 |
C1R14 | GTACCACAACCCAAATCAAC |
Position | Codon | ||||||
---|---|---|---|---|---|---|---|
Gene | From | To | Size | Intergenic Nucleotides | Start | Stop | Anticodon |
trnP | 1 | 57 | 57 | TGG | |||
cox1 | 58 | 1623 | 1566 | TTG | TAG | ||
trnC | 1623 | 1678 | 56 | −1 | GCA | ||
trnM | 1679 | 1740 | 62 | CAT | |||
trnD | 1742 | 1798 | 57 | 1 | GTC | ||
trnG | 1799 | 1853 | 55 | TCC | |||
cox2 | 1854 | 2540 | 687 | GTG | TAG | ||
trnH | 2539 | 2593 | 55 | −2 | GTG | ||
rrnL | 2594 | 3538 | 945 | ||||
nad3 | 3551 | 3877 | 327 | 12 | TTG | TAA | |
nad5 | 3877 | 5460 | 1584 | −1 | ATT | TAA | |
trnN | 5459 | 5510 | 52 | −2 | GTT | ||
nad6 | 5511 | 5939 | 429 | TTG | TAA | ||
nad4L | 5944 | 6177 | 234 | 4 | ATT | TAA | |
trnW | 6177 | 6232 | 56 | −1 | TCA | ||
trnA | 6233 | 6288 | 56 | TGC | |||
trnE | 6288 | 6342 | 55 | −1 | TTC | ||
rrnS | 6343 | 7024 | 682 | ||||
trnS2 | 7025 | 7078 | 54 | TGA | |||
NCR1 | 7079 | 7362 | 284 | ||||
trnY | 7363 | 7420 | 58 | TAC | |||
nad1 | 7419 | 8291 | 873 | −2 | TTG | TAG | |
atp6 | 8294 | 8890 | 597 | 2 | ATT | TAA | |
trnK | 8949 | 9010 | 62 | 58 | TTT | ||
trnL2 | 9018 | 9073 | 56 | 7 | TAA | ||
trnS1 | 9071 | 9128 | 58 | −3 | TCT | ||
nad2 | 9129 | 9960 | 832 | TTG | T | ||
trnI | 9961 | 10016 | 56 | GAT | |||
trnR | 10027 | 10080 | 54 | 10 | ACG | ||
trnQ | 10081 | 10134 | 54 | TTG | |||
trnF | 10135 | 10191 | 57 | GAA | |||
cytb | 10183 | 11292 | 1110 | −9 | TTG | TAA | |
trnL1 | 11293 | 11350 | 58 | TAG | |||
cox3 | 11351 | 12118 | 768 | TTG | TAA | ||
trnT | 12119 | 12174 | 56 | TGT | |||
nad4 | 12190 | 13404 | 1215 | 15 | ATT | TAA | |
trnV | 13404 | 13457 | 54 | −1 | TAC | ||
NCR2 | 13458 | 13874 | 417 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, F.; Zou, H.; Jin, X.; Zhang, D.; Li, W.; Li, M.; Wu, S.; Wang, G. Sequencing of the Complete Mitochondrial Genome of Pingus sinensis (Spirurina: Quimperiidae): Gene Arrangements and Phylogenetic Implications. Genes 2021, 12, 1772. https://doi.org/10.3390/genes12111772
Chen F, Zou H, Jin X, Zhang D, Li W, Li M, Wu S, Wang G. Sequencing of the Complete Mitochondrial Genome of Pingus sinensis (Spirurina: Quimperiidae): Gene Arrangements and Phylogenetic Implications. Genes. 2021; 12(11):1772. https://doi.org/10.3390/genes12111772
Chicago/Turabian StyleChen, Fanglin, Hong Zou, Xiao Jin, Dong Zhang, Wenxiang Li, Ming Li, Shangong Wu, and Guitang Wang. 2021. "Sequencing of the Complete Mitochondrial Genome of Pingus sinensis (Spirurina: Quimperiidae): Gene Arrangements and Phylogenetic Implications" Genes 12, no. 11: 1772. https://doi.org/10.3390/genes12111772
APA StyleChen, F., Zou, H., Jin, X., Zhang, D., Li, W., Li, M., Wu, S., & Wang, G. (2021). Sequencing of the Complete Mitochondrial Genome of Pingus sinensis (Spirurina: Quimperiidae): Gene Arrangements and Phylogenetic Implications. Genes, 12(11), 1772. https://doi.org/10.3390/genes12111772