Next Article in Journal
Heat Diffusion Kernel Algorithm-Based Interpretation of the Disease Intervention Mechanism for DHA
Next Article in Special Issue
Telomere Dynamics in the Diploid and Triploid Rainbow Trout (Oncorhynchus mykiss) Assessed by Q-FISH Analysis
Previous Article in Journal
The Importance of ATM and ATR in Physcomitrella patens DNA Damage Repair, Development, and Gene Targeting
Previous Article in Special Issue
Sex Chromosomes and Internal Telomeric Sequences in Dormitator latifrons (Richardson 1844) (Eleotridae: Eleotrinae): An Insight into Their Origin in the Genus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 11
Issue 7
10.3390/genes11070753
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hybridization of Russian Sturgeon (Acipenser gueldenstaedtii, Brandt and Ratzeberg, 1833) and American Paddlefish (Polyodon spathula, Walbaum 1792) and Evaluation of Their Progeny

by
Jenő Káldy
1,*,†,
Attila Mozsár
1,†,
Gyöngyvér Fazekas
1,
Móni Farkas
1,2,
Dorottya Lilla Fazekas
1,3,
Georgina Lea Fazekas
1,4,
Katalin Goda
5,6,
Zsuzsanna Gyöngy
5,6,
Balázs Kovács
7,
Kenneth Semmens
8,
Miklós Bercsényi
2,9,
Mariann Molnár
4,10 and
Eszter Patakiné Várkonyi
10
1
National Agricultural Research and Innovation Centre, Research Institute for Fisheries and Aquaculture, H-5540 Szarvas, Hungary
2
Festetics György Doctoral School, Georgikon Faculty, University of Pannonia, H-8360 Keszthely, Hungary
3
Juhász-Nagy Pál Doctoral School of Biology and Environmental Sciences, University of Debrecen, H-4031 Debrecen, Hungary
4
Animal Husbandry Science Doctoral School, Szent István University, H-2100 Gödöllő, Hungary
5
Department of Biophysics and Cell Biology, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary
6
Doctoral School of Molecular Cell and Immune Biology, University of Debrecen, H-4032 Debrecen, Hungary
7
Department of Aquaculture, Institute for Conservation of Natural Resources, Faculty of Agricultural and Environmental Sciences, Szent Istvan University, H-2100 Gödöllő, Hungary
8
School of Aquaculture and Aquatic Sciences, Kentucky State University, Frankfort, KY 40601, USA
9
Department of Animal Science, Georgikon Faculty, University of Pannonia, H-8360 Keszthely, Hungary
10
National Centre for Biodiversity and Gene Conservation, Institute for Farm Animal Gene Conservation, H-2100 Gödöllő, Hungary
*
Author to whom correspondence should be addressed.
†
These authors contributed equally.
Genes 2020, 11(7), 753; https://doi.org/10.3390/genes11070753
Submission received: 21 May 2020 / Revised: 29 June 2020 / Accepted: 3 July 2020 / Published: 6 July 2020
(This article belongs to the Special Issue Fish Cytogenetics: Present and Future)
Browse Figures
Versions Notes

Abstract

:
Two species from the families Acipenseridae and Polyodontidae, Russian sturgeon (Acipenser gueldenstaedtii, Brandt and Ratzeberg, 1833; functional tetraploid) and American paddlefish (Polyodon spathula, Walbaum 1792, functional diploid) were hybridized. The hybridization was repeated using eggs from three sturgeon and sperm from four paddlefish individuals. Survival in all hybrid family groups ranged from 62% to 74% 30 days after hatching. This was the first successful hybridization between these two species and between members of the family Acipenseridae and Polyodontidae. Flow cytometry and chromosome analysis revealed two ploidy levels in hybrids. The chromosome numbers of the hybrids ranged between 156–184 and 300–310, in “functional” triploids and “functional” pentaploids, respectively. The hybrid origin and the ploidy levels were also confirmed by microsatellite analyses. In hybrids, the size and the number of dorsal and ventral scutes correlated with the ploidy levels as well as with the calculated ratio of the maternal and paternal chromosome sets. An extra haploid cell lineage was found in three hybrid individuals irrespective of the ploidy level, suggesting polyspermy. Although the growth performance showed high variance in hybrids (mean: 1.2 kg, SD: 0.55), many individuals reached a size of approximately 1 kg by the age of one year under intensive rearing conditions.

1. Introduction

In some fish taxa, polyploidization is an ongoing process and can occur, even within a species (autopolyploidy; i.e., polyploidy derived from a single species), while in other taxa, e.g., Cyprinidae, it is rare [1]. Polyploidy is relatively frequent in interspecific hybrids of fishes (allopolyploidy; i.e., polyploidy arising from interspecific hybridization). Berrebi [2] and Birstein et al. [3] pointed out that polyploidy increased the success of interspecific hybridization in fishes.
Sturgeons represent ancestral ray-finned fishes (besides bichirs and ropefishes) in the class Actinopterygii [4], originating during the Jurassic era 200 million years ago [5,6]. The order Acipenseriformes consists of 27 living species, many of which are listed in the Appendices to CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora; [7]). They diverged before the teleost specific genome duplication from the other ray-finned fishes [8]. The sturgeons split into three families, one extinct and two presently living—Acipenseridae and Polyodontidae [9]. In the family Polyodontidae, no further genome duplication has occurred, and they are considered “functional diploids” (2n) with around 120 chromosomes. There are only two species in the family: American paddlefish (P. spathula), Chinese paddlefish (Psephurus gladius). The extinction of the Chinese paddlefish has been recently reported [10]. Several polyploidization evens occurred later in Acipenseridae, which can contribute to the resilience and adaptability of species belonging to Acipenseridae. Due to these evolutionary processes, as a byproduct, hybridization can be successful between Acipenseridae, and even among taxa with different chromosome numbers. In Acipenseridae, at least one additional genome duplication happened during the evolution of the Atlantic clade of the family, and more during the shortnose sturgeon (Acipenser brevirostrum) and the pacific clade evolution. Most of the species in the Atlantic clade, including the Russian sturgeon (A. gueldenstaedtii), are considered “functional tetraploid“ (4n) with ≈250 chromosomes [11].
Although hybridization among acipenserid species is common, there are no reports of successful hybridization of acipenserids and polyodontids. Previous hybridization experiments on shovelnose sturgeon (Scaphirhynchus platorynchus) × American paddlefish [12,13] or American paddlefish × Amur sturgeon (Acipenser schrenckii) [14] have failed to result in viable offspring. Besides the large phylogenetic distance (i.e., they diverged 184.4 Mya [15]), representatives of Polyodontidae and Acipenseridae differ in their gross morphology (e.g., presence of scutes, the structure of mouth, rostrum, filter apparatus) as well as feeding behavior, preferred habitat, etc. [3,16]. This suggests an inability to hybridize. In hybrids of acipenserids, odd ploidy plasticity may occur, which is highly dependent on the ploidy level of the parental species. Various ploidy levels are caused either by polyspermy or partial or full duplication of the maternal genome and hybridization [7,17]. Mosaicism also may occur [18,19,20].
During an experiment to produce gynogenic Russian sturgeon progeny, a negative control was initiated using non-irradiated American paddlefish sperm and eggs from the Russian sturgeon. Unexpectedly, the control cross resulted in viable hybrids. This was the first report of viable hybrids between any acipenserid and Polyodon species. In this study, we described the morphology, ploidy level, and chromosome number, demonstrating the hybrid origin of the progeny. This study addressed whether the simultaneous genome duplication occurs and how it affects the ploidy level of hybrid progenies. Finally, it described the relationship between the external morphology and ploidy level in the hybrids of species with such great phylogenetic distance.

2. Materials and Methods

2.1. Reproduction and Nursing

Breeders originated from stocks that have been raised for three generations or more in captivity at the live gene bank, Szarvas, Hungary. For gynogenesis, we used irradiated paddlefish sperm. As a control of the success of gynogenesis, we ran parallel fertilization using untreated American paddlefish sperm. For the controls, three females from Russian sturgeon (tag codes: 6F15, 1748, and AG03) and four males from American paddlefish (tag codes: 2E75, 596B, 551F and 6517) were crossed and produced five parent hybrid combinations (Table 1). Experiments were ethically approved and reviewed by the Institutional Animal Care and Use Committee of Research Institute of Aquaculture and Fisheries (permission number NAIK/4842-1/2019, license number BE/25/4302-3/2017).
The breeders were injected with LHRH (luteinizing hormone-releasing hormone) analog Des-Gly10 (D-Ala6) LHRH-ethylamide (40 µg/kg for females and 20 µg/kg males) to induce ovulation and spermiation. Milt was stripped 48 h post injection, while eggs were stripped 48–52 h post injection using the method of Podushka, cited by Štěch et al. [21]. Immediately before fertilization, milt was diluted with water at a ratio of 1:200, and 2 mL of this diluted solution was added to egg samples weighing 300 g, according to the common aquaculture practice [22]. In the case of gynogenic fertilization, the milt was irradiated by 1 kGy dose of 60Co γ ray. For retention of the second polar body, a 2 min 36 °C heat shock was applied 18 min post fertilization [12,23]. Fertilization rates at 48 h post fertilization and survival at hatching were determined by counting 3 × 100 eggs in each parent combination. Two thousand newly hatched fry from each of the treatment groups were stocked into 400 L volume tanks with trough-flow water for nursing. On the eighth day after hatching, fry received frozen brine shrimp nauplii, and mosquito larvae followed dry feed feeding from the twentieth day. When fish reached the size of 3 cm, they were transferred into larger tanks. When fingerlings reached 12–15 cm, individuals were labeled with passive induced transponder (PIT) tags (Loligo® Systems, Toldboden, Viborg, Danemark).

2.2. Microsatellite Marker Analysis

Fin clips were collected from the female Russian sturgeons (6F15; 174B; AG03) and male American paddlefish (596B; 6517; 2E75) parents and from 19 hybrid offspring. Genomic DNA was extracted using the standard protocol of the E.Z.N.A. Tissue Kit (Omega Bio-Tek, Doraville, CA, USA). Four pairs of microsatellite primers were used. Three microsatellite loci (Psp-28, Psp-29, Psp-32) were developed for American paddlefish [24], and the fourth locus (Spl_101) was developed for shovelnose sturgeon [25]. The universal fluorescent labeling method was used for capillary electrophoretic analysis of microsatellite alleles [26]. The forward primers were tailed by a 5′ 17 bp long sequence to provide an attachment site for fluorescent dye-labeled (fluorescent dyes: FAM, VIC, NED, PET) “universal” oligos. One tail-specific oligo was added to each reaction mixture. The reactions consisted of 100 ng genomic DNA, 10× Dream Taq PCR buffer (it contains 20 mM MgCl2), 0.4 µL (0.2 mM of each dNTP), 0.5 µL forward and reverse primer, (10 µM), 0.5 µL fluorescent dye-labeled tail specific oligo (5′dye-ATTACCGCGGCTGCTGG-3′) (10 µM), and 1.0 U DreamTaq DNA polymerase in a total volume of 20 µL. PCR conditions: Initial denaturing at 94 °C for 2 min; 35 cycles of 94 °C denaturing for 30 s, annealing temperature (Table 2) for 30 s, 72 °C extension for 1 min, and a final extension at 72 °C for 5 min. Amplified, labeled products were subjected to capillary electrophoresis on an ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). GeneMapper 4.0 Software (Applied Biosystems, Waltham, MA, USA) was used to determine the fragment size of the detected alleles.

2.3. Flow Cytometry and DNA Content Analysis

The DNA content of red blood cells (RBCs) was measured by flow cytometry using propidium iodide (PI) staining. Blood cells were centrifuged at 500× g for 5 min and re-suspended in 500 µL PBS to set the cell concentration to 107/mL. Then, by adding 4500 µL 70% ethanol (Scharlab Hungary, Budapest) to the samples, the cells were fixed and permeabilized for 30 min at room temperature [27]. Subsequently, the samples were washed twice in PBS (at 500× g for 5 min and re-suspended in 5000 µL PBS). At that point, the ethanol-fixed cells were stained with 40 µg/mL PI (Sigma-Aldrich) for 30 min. The samples were measured by using a Becton Dickinson FACS Array flow cytometer. A green 532 nm laser was used for the excitation of PI, and the fluorescence signal was detected at 585/42 nm. Cell debris was excluded from analysis, on the basis of forward scatter (FSC) and side scatter (SSC) signals. Flow cytometry data were analyzed using the Flowing Software (Flowing Software 2.5.1 (released 4.11.2013)), Cell Imaging Core, Turku Centre for Biotechnology (Turku, Finland).
Flow cytometry measurements were carried out on 98 hybrid fish, two Russian sturgeon (6F15, Ag03), and four male American paddlefish (2E75, 551F, 596B, 6517). Each measurement was repeated three times independently. The analysis was carried out in a blind manner except for the four male American paddlefish blood samples. Upon DNA content analysis, the mean PI fluorescence intensity of each progeny was normalized to the mean PI fluorescence intensity measured in the case of the three male American paddlefish and expressed in pg.
The genome size of each individual was calculated using a modified formula by Tiersch et al. [28]: DNA content (pg) = 3.9× (I/P), where I and P are the fluorescence intensities of hybrids and paternal individuals, respectively. The constant of 3.9 is the DNA content of paddlefish cells given in the picogram [28].

2.4. Chromosome Analysis

Chromosome analysis was carried out on tissue culture cells, modified after Tóth et al. [29], from eight ten-month-old hybrid individuals. The fibroblast culture was set up from the pectoral fin. The culture medium was changed twice a week. After 4–6 weeks, when the fibroblast monolayer was almost confluent in the flasks (Greiner 690175; 50 mL), 40 µL of KaryoMAX™ Colcemid™ Solution (Gibco 15212012) was added. Two hours later, cells were trypsinized, and after 7-min centrifugation (1500× g) were resuspended in 0.56% KCL as hypotonic treatment; this was followed by three changes of methanol/acetic acid (3:1) fixative. The cell suspension was spread on slides, dried at room temperature, and stained with 5% fresh Giemsa solution (in phosphate buffer pH 7.0) (Sigma 48900) for 7–8 min [30]. Five slides from each individual were prepared, and at least 30 metaphase spreads per individual were examined to determine the chromosome number. Chromosomes were classified using the nomenclature of Levan et al. [31].

2.5. Morphometry

After clove oil narcotization, we measured 21 morphometric and four meristic characters (Table 3) on 218 American paddlefish × Russian sturgeon hybrids, 49 American paddlefish, and 50 Russian sturgeon individuals with a digital caliper. The morphometric characters were determined according to Holcik et al. [32], Keszka and Krzykawski [33], and Hoover et al. [34]. In addition, we measured the width of the first three dorsal scutes. The meristic characters covered the number of dorsal (sDL), lateral (sLL), ventral scutes (sVL) and the number of barbels. The age of the examined fish varied between 228 and 258 days.
Morphometric data were standardized to eliminate the effect of body size, according to Elliott et al. [35]. Fishes were divided into five groups based on their origin and genome size: American paddlefish (PF), Russian sturgeon (RS), small genome size hybrids (SH), large genome size hybrids (LH), and hybrids without genome size data (NH). We ran a series of non-parametric univariate tests (Kruskal–Wallis) and pairwise comparisons (Mann–Whitney U test with Bonferroni correction) for each morphometric and meristic character to reveal differences between groups. Principal component analysis (PCA) was performed on the entire standardized dataset to evaluate the morphometric variation. Scute size was excluded from the multivariate test because it was absent in all paddlefishes and many hybrids. Statistical analyses were performed using PAST 1.95 [36].

3. Results

3.1. Fertilization, Survival, Growth of Hybrids

The fertilization rate varied from 86 to 93% and the hatching rate from 78 to 85% in the five parent combinations. Survival after hatching at 30 days ranged from 62 to 74% and at 180 days from 49 to 68%. Substantial differences in individual weights were observed within the groups. By the end of the first year, many hybrid individuals reached a bodyweight of over 1 kg (mean: 1.2 kg, SD: 0.55).

3.2. Microsatellite Analysis

There was no common allele between the two species. The Psp-28, Psp-32, and Spl-101 were disomic, while the Psp-29 was tetrasomic on the American paddlefish males. In the case of American paddlefish, all of the detected alleles of the four loci were different from the Russian sturgeon: five at the 2E75 males, six at the 596B males, and seven at 6517 males. Four alleles were common in both American paddlefish males (Table 4).
The Psp-29 was disomic, while the Psp-28, Psp-32, and Spl-101 were tetrasomic on Russian sturgeon females. Two female genotypes did not differ from each other. Altogether twelve alleles were detected at the four loci, and none of them were present in American paddlefish. All the markers segregated in the offspring groups. All hybrid individuals inherited one paternal allele from the disomic (Psp-28, Psp-32, and Spl-101) and two alleles from the tetrasomic alleles loci. The SH individuals inherited one maternal allele from the Psp-28 or Psp-29 and two alleles from the tetrasomic Psp-32 and Spl-101 loci, while the LH hybrids inherited two, three, or four alleles in the case of tetrasomic markers, but at least one of the two maternal tetrasomic loci revealed the presence of two maternal genomes (Table 4). None of the genotypes suggested the presence of polyspermy.

3.3. Flow Cytometry and DNA Content Analysis

Based on the DNA content analysis, we distinguished two main groups: A small genome size group (SH), with 7.22 ± 0.71 pg DNA content, and a large genome size group (LH), with 11.60 ± 0.84 pg DNA content. The hybrids were divided into five subgroups based on their parents. Estimated genome sizes of the hybrids are shown for the different parent combinations in Table 1. The majority of the tested progenies belonged to the small genome size (SH) group in the case of each parent combination. Although there was no statistically significant difference in mean DNA content among subgroups of the SH group, we identified some outlier individuals with statistically different DNA content, such as the D4AF3A individual (Table 5).

3.4. Chromosome Analysis and Ploidy Level in Different Cytometry Class Groups

The chromosome analysis of hybrid individuals confirmed the results of DNA content analysis. Two large groups could be distinguished by their chromosome number: inter-species triploid hybrids (SH) and inter-species pentaploid hybrids (LH). The triploid hybrids were formed by one maternal gamete (2n) of a functional tetraploid female Russian sturgeon and one paternal gamete (1n) from a functional diploid paddlefish. The chromosome numbers of SH varied between 156 ± 4 and 174 ± 10 (Table 5) due to the different numbers of microchromosomes. The pentaploid LH group contained the entire maternal genome (4n = 250 ± 8) and the paternal haploid genome (n = 60). They had 304 ± 6 chromosomes (Table 5). The morphology of microchromosomes was unclear because of their very small size. The paternal haploid cell lines described by Iegorova et al. [18] were also observed in several individuals (PIT ID D52B1B, D4B091, and D4D979) (Table 5).
A detailed karyotype analysis was performed on one randomly chosen SH (PIT ID D52B1B; 3n = 176) and LH individual (PIT ID D4D979; 5n = 310). The karyotype of triploid individuals consisted of 70 meta- and submetacentric, 12 acrocentric, and 94 microchromosomes (Figure 1, Table 6). In the case of pentaploid individuals, the analysis showed the occurrence of 118 metacentric and submetacentric, 18 acrocentric, and 174 microchromosomes (Figure 2, Table 6). In both cases, two large acrocentric chromosomes (Acipenseriformes marker chromosomes) were found (Figure 1 and Figure 2). The reference data of karyotypes found in Table 6 regarding the number of middle-size acrocentric chromosomes were incomplete because references [3,8] did not classify them separately.

3.5. Morphometry

The most pronounced difference between American paddlefish and Russian sturgeon occurred in morphometric characters related to the rostrum length (rc, R, rr, C), which were higher in American paddlefish (Table 3). Russian sturgeons had longer upper caudal lobe (Cfa) and pectoral fin (IP). The rostrum length related characters of hybrids differed from the parent species’, and further differences occurred between the LH and SH groups. The upper caudal lobe (Cfa) and pectoral fin (IP) lengths showed similar patterns, but in the latter character, the LHs differed just marginally from the Russian sturgeons. The size and number of scutes were higher in Russian sturgeon, lower in the SH group, and intermediate in the LH group. The number of lateral scutes was typically higher in hybrids.
The first principal component accounted for the vast majority of the total variance (84.43%); the subsequent component explained much less (10.38%; Figure 3). The ordination showed pronounced differentiation between the American paddlefish and Russian sturgeon. The hybrids were closer to the Russian sturgeon. The PCA plot supported the result of the univariate test and highlighted the importance of rostrum length-related characters (rr, R, rc, C) and upper caudal lobe (Cfa) and pectoral fin (IP) length in the separation of hybrids and parent species (Figure 3 and Figure 4). Although we could not divide the hybrids into distinct subgroups, the LH individuals were projected closer to the Russian sturgeon.

4. Discussion

Former experiences on the hybridization of acipenserids and paddlefishes [14,38] support the assumed inability of the hybridization of taxa with such a high phylogenetic distance separating them. Still, the cross of female Russian sturgeon and male American paddlefish, as a negative control for gynogenesis, resulted in viable hybrids. The fertilization, hatching, and survival rates of these hybrids were close to that of the pure maternal species. The progenies exhibited two ploidy levels (triploid and pentaploid) due to spontaneous polyploidization, relating to external morphological and meristic characteristics.
The reproductive success of these two distant species could be the combined consequence of the ancient genome duplication (180 Mya, that occurred in the common ancestor of the two families) and the slow evolution rate of acipenserids. The theory of slow evolution was reinforced by the “small” morphological differences of the living sturgeon species, the smaller substitution rates of mitochondrial or nuclear genes, and the slower protein evolution, compared to other fish species. This theory has been recently confirmed by a detailed evaluation of the sterlet genome [39]. Since the common sturgeon genome duplication, the sterlet genome has not formed back to a diploid state, and structural and functional elements have been found on the tetraploid level in unexpectedly high degree [39]. These phenomena could lead to a higher similarity, compatibility, and flexibility among the sturgeon genomes and allow the hybridization between Russian sturgeon and American paddlefish despite the large geographical, physiological, and morphological distances.
The intermediate appearance is common in interspecific hybrids [40,41]. A further increase of morphological variability occurs in polyploid hybrids, primarily due to the difference in gene dosage from parent species [42]. Hybrids showed the widest variability in characters, which differed the most parental species, i.e., rostrum-length-related characters and length of the upper caudal lobe. The LH individuals were more similar to the maternal species, presumably due to the larger gene dosage from Russian sturgeon overwhelming the paddlefish-like traits [43]. The SH hybrids showed a more diverse appearance since the ration of maternal and paternal chromosome sets is more balanced than LH hybrids [43].
Similar to the interspecific teleost hybrids, where a substantial difference has been observed in size and the number of scales between hybrids and parental species [40,43], the number of scutes differed substantially in hybrids in conjunction with ploidy level. The presence or absence of the scutes, as well as their modified forms in the hybrids, offer the opportunity to study the role of the fibroblast growth factor receptor gene (fgfr) as it influences the number and size of scales in the mirror, nude, and scaled forms of common carp and zebrafish [44]. Sub-functionalization of paralogues of this gene may have occurred following genome duplication during the evolutionary process [45].
The characteristics of karyotypes and the results of microsatellite analysis confirmed that the progenies were interspecies hybrids. As with Váradi et al. [46], chromosome analysis revealed the occurrence of two ploidy levels in hybrids: triploid hybrids (SH, AP) and pentaploid hybrids (LH, AAP). Slight variation in chromosome numbers was also observed within the groups. On the one hand, inconsistency in the published chromosome numbers within a pure-bred species could be the consequence of difficulties in the determination of microchromosome numbers [37]. On the other hand, microchromosome loss also occurs in interspecies hybrids of species characterized by different ploidy levels [47]. We observed haploid paternal cell lineages in some individuals in both groups, suggesting polyspermy [18]. In this case, a supernumerary spermatozoon began to develop as a single cell line, and triploid/pentaploid and haploid cell lines were present in the genome of individuals, causing mosaicism in the hybrids.
Investigations on the functional scale of the ploidy level [20] assume that the interspecific differences in ploidy levels (e.g., diploid American paddlefish and tetraploid Russian sturgeon) originated from whole-genome duplication events during the evolution of Acipenseriformes [8]. Furthermore, intraspecific polyploidization is also relatively frequent among the acipenseriform fishes. It has been detected in white sturgeon (Acipenser transmontanus) [48], Siberian sturgeon (Acipenser baerii) [20,49], kaluga (Huso dauricus) [14], sterlet [50], and Sakhalin sturgeon (Acipenser mikadoi) [14]. The spontaneous intraspecific polyploidization can result in variance in genome size. Havelka et al. [20] described the spontaneous duplication of the maternal chromosome set in Siberian sturgeon of different ploidy caused by either premeiotic endomitosis or the retention of the second polar body. Many other studies [51,52,53] have stated the retention that the second polar body can lead to polyploidization. The different ratios of triploid/pentaploid individuals among the parent combinations in our study also supported this hypothesis.
Microsatellites from both species and hybrids were amplified successfully. All the used microsatellite markers were suitable for distinguishing the two species and for verification of the hybridization. Previously, Zou et al. [14] used the Psp-28, Psp-29, Psp-32 markers on Polyodontidae and Acipenseridae fishes to verify the success of gynogenesis. They also found different allele ranges between the paddlefish and Amur sturgeon. However, the allele sizes could not be compared directly because different techniques were used for allele sizing (polyacrylamide gels and silver staining). All three Psp loci were disomic in that experiment, while the Psp-29 appeared to be tetrasomic in our experiment as well as in the description of Heist et al. [24]. The analyses proved the presence of both the Russian sturgeon and American paddlefish genomes in all examined hybrid individuals, discarding the possibility of spontaneous gynogenesis, which was observed in Siberian sturgeons [20,49] and sterlet [54]. The two tetrasomic markers enabled us to follow the segregation of the tetraploid Russian sturgeon genome and to analyze ploidy levels. These markers showed the presence of only one American paddlefish and two Russian sturgeon alleles in the SH genomes, while in the LH genomes, more alleles were found. This suggested the presence of spontaneous duplication of the maternal genomes in the individuals with high chromosome numbers (250 ± 8–304 ± 4) and/or nucleus size.
The polyploid status of the species within the Acipenserdae family, as well as their similar karyotype and genome, contribute to easy interspecific and intergeneric hybridization [3]. Based on our findings, successful interspecific hybridization is also supposed in other species combinations in the order Acipenseriformes. Consequently, American paddlefish may hybridize with other sturgeons independent of ploidy level.
The aquaculture potential of this hybrid is a subject for debate. Sturgeon hybrids are commonly used in aquaculture to exploit the advantages of heterosis [55]. It is estimated that hybrids account for approximately 35 and 20% percent of global sturgeon meat and caviar production, respectively [56]. If the planktivorous feeding habit of parent species of paddlefish is inherited to a certain extent, the new hybrid can play an important role in adapting pond aquaculture to the challenges of climate change. Non-fed species have a lower carbon footprint than fed ones, and the co-culture of a filter feeder with relatively high market value as a supplementary species would strengthen pond aquaculture both from an ecological and environmental perspective [57].

Author Contributions

Conceptualization and investigation of morphometry, J.K.; Investigation of morphometry and writing the original draft, A.M.; Investigation of molecular markers and writing the original draft, G.F., B.K. and M.F.; Investigation of propagation and visualization, D.L.F. and G.L.F.; Investigation of flow cytometry and writing the original draft, K.G. and Z.G.; Writing—Review and Editing, K.S.; Conceptualization and writing the original draft, M.B.; Investigation of chromosome counting, M.M.; Investigation of cell culturing, chromosome analysis, and writing the original draft, E.P.V. All authors have read and agreed to the published version of the manuscript.

Funding

The research leading to these results has received funding from the Hungarian Ministry of Agriculture (HHgF/194-1/2018.); the EFOP-3.6.3-VEKOP-16-2017-00008 grant, co-financed by the European Union and the European Social Fund; the “HOP-3COLL-1 (reference number: 1699279607), which are co-financed by the European Union and the European Social Fund”; the Higher Education Institutional Excellence Program FEKUT2019: TUDFO/47138/2019- ITM awarded by the Ministry of Human Capacities (Hungary). This publication is created in number EFOP-3.6.1-16-2016-00016.

Acknowledgments

We acknowledge Bence Lázár for assistance in the preparation of Figure 1 and Figure 2 and to Gergő Gyalog for his contribution.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Leggatt, R.A.; Iwama, G.K. Occurrence of polyploidy in the fishes. Rev. Fish Boil. Fish. 2003, 13, 237–246. [Google Scholar] [CrossRef]
  2. Berrebi, P. Speciation of the genus Barbus in the north Mediterranean basin: Recent advances from biochemical genetics. Boil. Conserv. 1995, 72, 237–249. [Google Scholar] [CrossRef]
  3. Birstein, V.J.; Hanner, R.; DeSalle, R. Phylogeny of the Acipenseriformes: Cytogenetic and molecular approaches. Environ. Biol. Fishes 1997, 48, 127–155. [Google Scholar] [CrossRef]
  4. Sallan, L. Major issues in the origins of ray-finned fish (Actinopterygii) biodiversity. Boil. Rev. 2014, 89, 950–971. [Google Scholar] [CrossRef] [PubMed]
  5. Hilton, E.J.; Grande, L. Review of the fossil record of sturgeons, family Acipenseridae (Actinopterygii: Acipenseriformes), from North America. J. Paléontol. 2006, 80, 672–683. [Google Scholar] [CrossRef]
  6. Bemis, W.; Findeis, E.K.; Grande, L. An overview of Acipenseriformes. Environ. Biol. Fishes 1997, 48, 25–71. [Google Scholar] [CrossRef]
  7. Zhang, X.; Wu, W.; Li, L.; Ma, X.; Chen, J. Genetic variation and relationships of seven sturgeon species and ten interspecific hybrids. Genet. Sel. Evol. 2013, 45, 21. [Google Scholar] [CrossRef] [Green Version]
  8. Symonová, R.; Havelka, M.; Amemiya, C.T.; Howell, W.M.; Kořínková, T.; Flajšhans, M.; Gela, D.; Ráb, P. Molecular cytogenetic differentiation of paralogs of HOX paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula). BMC Genet. 2017, 18, 19. [Google Scholar] [CrossRef] [Green Version]
  9. Nelson, S.J.; Grande, C.T.; Wilson, V.H.M. Fishes of the World; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2016; pp. 118–121. [Google Scholar]
  10. Zhang, H.; Jarić, I.; Roberts, D.L.; He, Y.; Du, H.; Wu, J.; Wang, C.; Wei, Q. Extinction of one of the world’s largest freshwater fishes: Lessons for conserving the endangered Yangtze fauna. Sci. Total. Environ. 2020, 710, 136242. [Google Scholar] [CrossRef]
  11. Rajkov, J.; Shao, Z.; Berrebi, P. Evolution of Polyploidy and Functional Diploidization in Sturgeons: Microsatellite Analysis in 10 Sturgeon Species. J. Hered. 2014, 105, 521–531. [Google Scholar] [CrossRef] [Green Version]
  12. Mims, S.D.; Shelton, W.L.; Linhart, O.; Wang, C. Induced Meiotic Gynogenesis of Paddlefish Polyodon spathula. J. World Aquac. Soc. 1997, 28, 334–343. [Google Scholar] [CrossRef]
  13. Mims, S.D.; Shelton, W.L. Induced meiotic gynogenesis in shovelnose sturgeon. Aquac. Int. 1998, 6, 323–329. [Google Scholar] [CrossRef]
  14. Zou, Y.C.; Wei, Q.W.; Pan, G.B. Induction of meiotic gynogenesis in paddlefish (Polyodon spathula) and its confirmation using microsatellite markers. J. Appl. Ichthyol. 2011, 27, 496–500. [Google Scholar] [CrossRef]
  15. Peng, Z.; Ludwig, A.; Wang, D.; Diogo, R.; Wei, Q.; He, S. Age and biogeography of major clades in sturgeons and paddlefishes (Pisces: Acipenseriformes). Mol. Phylogenetics Evol. 2007, 42, 854–862. [Google Scholar] [CrossRef] [PubMed]
  16. Grande, L.; Bemis, W. Osteology and Phylogenetic Relationships of Fossil and Recent Paddlefishes (Polyodontidae) with Comments on the Interrelationships of Acipenseriformes. J. Vertebr. Paléontol. 1991, 11, 1–121. [Google Scholar] [CrossRef]
  17. Vasil’Ev, V.P.; Vasil’Eva, E.D.; Shedko, S.; Novomodny, G.V. How many times has polyploidization occurred during acipenserid evolution? New data on the karyotypes of sturgeons (Acipenseridae, Actinopterygii) from the Russian Far East. J. Ichthyol. 2010, 50, 950–959. [Google Scholar] [CrossRef]
  18. Iegorova, V.; Psenicka, M.; Lebeda, I.; Rodina, M.; Saito, T. Polyspermy produces viable haploid/diploid mosaics in sturgeon. Boil. Reprod. 2018, 99, 695–706. [Google Scholar] [CrossRef]
  19. Havelka, M.; Hulak, M.; Bailie, D.A.; Prodöhl, P.; Flajšhans, M. Extensive genome duplications in sturgeons: New evidence from microsatellite data. J. Appl. Ichthyol. 2013, 29, 704–708. [Google Scholar] [CrossRef]
  20. Havelka, M.; Bytyutskyy, D.; Symonová, R.; Ráb, P.; Flajšhans, M. The second highest chromosome count among vertebrates is observed in cultured sturgeon and is associated with genome plasticity. Genet. Sel. Evol. 2016, 48, 12. [Google Scholar] [CrossRef] [Green Version]
  21. Štěch, L.; Linhart, O.; Shelton, W.L.; Mims, S.D. Minimally Invasive Surgical Removal of Ovulated Eggs from Paddlefish. Aquac. Int. 1999, 7, 129–133. [Google Scholar] [CrossRef]
  22. Rónyai, A.; Váradi, L. World Animal Science: Production of Aquatic Animals; Elsevier Science: Amsterdam, The Netherland, 1995; Volume 1, pp. 95–108, Chapter 5. [Google Scholar]
  23. Shelton, W.L.; Mims, S.D.; Semmens, K.J.; Cuevas-Uribe, R. Artificial propagation of Paddlefish: An overview of developments. In Paddlefish: Ecological, Aquacultural, and Regulatory Challenges of Managing a Global Resource; Schooley, J.D., Scarnecchia, D.L., Eds.; American Fisheries Society: Bethesda, MD, USA, 2019; pp. 191–210. [Google Scholar]
  24. Heist, E.J.; Nicholson, E.H.; Sipiorski, J.T.; Keeney, D.B. Microsatellite Markers for the Paddlefish (Polyodon spathula). Conserv. Genet. 2002, 3, 205–207. [Google Scholar] [CrossRef]
  25. McQuown, E.C.; Sloss, B.L.; Sheehan, R.J.; Rodzen, J.; Tranah, G.J.; May, B. Microsatellite Analysis of Genetic Variation in Sturgeon: New Primer Sequences forScaphirhynchusandAcipenser. Trans. Am. Fish. Soc. 2000, 129, 1380–1388. [Google Scholar] [CrossRef]
  26. Shimizu, M.; Kosaka, N.; Shimada, T.; Nagahata, T.; Iwasaki, H.; Nagai, H.; Shiba, T.; Emi, M. Universal Fluorescent Labeling (UFL) Method for Automated Microsatellite Analysis. DNA Res. 2002, 9, 173–178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Darzynkiewicz, Z.; Juan, G. DNA Content Measurement for DNA Ploidy and Cell Cycle Analysis. Curr. Protoc. Cytom. 1997, 1, 7.5.1–7.5.24. [Google Scholar] [CrossRef]
  28. Tiersch, T.R.; Chandler, R.W.; Wachtel, S.S.; Elias, S. Reference standards for flow cytometry and application in comparative studies of nuclear DNA content. Cytometry 1989, 10, 706–710. [Google Scholar] [CrossRef] [PubMed]
  29. Toth, B.; Varkonyi, E.; Hidas, A.; Meleg, E.E.; Váradi, L. Genetic analysis of offspring from intra- and interspecific crosses of Carassius auratus gibelio by chromosome and RAPD analysis. J. Fish Boil. 2005, 66, 784–797. [Google Scholar] [CrossRef]
  30. Earley, E.M. Chromosome preparations from monolayer cell cultures. J. Tissue Cult. Methods 1975, 1, 31–35. [Google Scholar] [CrossRef]
  31. LeVan, A.; Fredga, K.; Sandberg, A.A. Nomenclature for centromeric position on chromosomes. Hereditas 2009, 52, 201–220. [Google Scholar] [CrossRef]
  32. Holčik, J. General Introduction to Fishes, Acipenseriformes. In The freshwater fishes of Europe; Aula-Verlag: Wiesbaden, Germany, 1989; Volume 1, p. 469. [Google Scholar]
  33. Keszka, S.; Krzykawski, S. Morphometry of juvenile Russian sturgeon (Acipenser gueldenstaedtii Brandt et Ratzeburg, 1833) from fish farms. Acta Sci. Pol. Pisc. 2008, 7, 21–36. [Google Scholar]
  34. Hoover, J.J.; Boysen, K.A.; Murphy, C.E.; George, S.G. Morphological Variation in Juvenile Paddlefish; American Fisheries Society: Bethesda, MD, USA, 2009; pp. 157–171. [Google Scholar]
  35. Elliott, N.G.; Haskard, K.; Koslow, J.A. Morphometric analysis of orange roughy (Hoplostethus atlanticus) off the continental slope of southern Australia. J. Fish Boil. 1995, 46, 202–220. [Google Scholar] [CrossRef]
  36. Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological Statistics software package for education and data analysis. Pal. Elect. 2001, 4, 1–9. [Google Scholar]
  37. Fontana, F.; Lanfredi, M.; Rossi, R.; Bronzi, P.; Arlati, G. Karyotypic characterization of Acipenser gueldenstaedti with C-, AgNO 3, and fluorescence banding techniques. Ital. J. Zool. 1996, 63, 113–118. [Google Scholar] [CrossRef]
  38. Mims, S.D.; Shelton, W.L. Paddlefish Aquaculture; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2015; p. 63. [Google Scholar]
  39. Du, K.; Stöck, M.; Kneitz, S.; Klopp, C.; Woltering, J.M.; Adolfi, M.C.; Feron, R.; Prokopov, D.; Makunin, A.; Kichigin, I.; et al. The sterlet sturgeon genome sequence and the mechanisms of segmental rediploidization. Nat. Ecol. Evol. 2020, 4, 841–852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Zou, S.; Li, S.; Cai, W.; Yang, H.; Jiang, X. Ploidy polymorphism and morphological variation among reciprocal hybrids by Megalobrama amblycephala×Tinca tinca. Aquaculture 2007, 270, 574–579. [Google Scholar] [CrossRef]
  41. Zhao, H.; Zou, H.; Lu, W. Ploidy polymorphism and morphological variation among reciprocal hybrids of Pseudosciaena crocea (♀) × Miichthys miiuy (♂). Aquac. Res. 2015, 47, 3390–3398. [Google Scholar] [CrossRef]
  42. Beck, M.; Biggers, C.J. Ploidy of Hybrids between Grass Carp and Bighead Carp Determined by Morphological Analysis. Trans. Am. Fish. Soc. 1983, 112, 808–811. [Google Scholar] [CrossRef]
  43. Cassani, J.R.; Caton, W.E.; Clark, B. Morphological comparisons of diploid and triploid hybrid grass carp, Ctenopharyngodon idella ♀ × Hypophthalmichthys nobilis ♂. J. Fish Boil. 1984, 25, 269–278. [Google Scholar] [CrossRef]
  44. Rohner, N.; Bercsényi, M.; Orbán, L.; Kolanczyk, M.E.; Linke, D.; Brand, M.; Nusslein-Volhard, C.; Harris, M.P. Duplication of fgfr1 Permits Fgf Signaling to Serve as a Target for Selection during Domestication. Curr. Boil. 2009, 19, 1642–1647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Force, A.; Lynch, M.; Pickett, F.B.; Amores, A.; Yan, Y.L.; Postlethwait, J. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 1999, 151, 1531–1545. [Google Scholar]
  46. Váradi, L.; Hidas, A.; Varkonyi, E.; Horvath, L. Interesting phenomena in hybridization of carp (Cyprinus carpio) and rosy barb (Barbus conchonius). Aquaculture 1995, 129, 211–214. [Google Scholar] [CrossRef]
  47. Arefjev, V.A.; Nikolaev, A.I. Cytological Analysis of the Reciprocal Hybrids between Low- and High-Chromosome Acipenserids, the Great Sturgeon, Huso huso(L.), and the Russian Sturgeon, Acipenser gueldenstaedtii Brandt. Cytologia 1991, 56, 495–502. [Google Scholar] [CrossRef] [Green Version]
  48. Schreier, A.; May, B.; Gille, D. Incidence of spontaneous autopolyploidy in cultured populations of white sturgeon, Acipenser transmontanus. Aquaculture 2013, 416, 141–145. [Google Scholar] [CrossRef]
  49. Fopp-Bayat, D.; Fopp-Bayat, R. Spontaneous gynogenesis in Siberian sturgeon Acipenser baeri Brandt. Aquac. Res. 2007, 38, 776–779. [Google Scholar] [CrossRef]
  50. Havelka, M.; Hulak, M.; Rodina, M.; Flajšhans, M. First evidence of autotriploidization in sterlet (Acipenser ruthenus). J. Appl. Genet. 2013, 54, 201–207. [Google Scholar] [CrossRef] [PubMed]
  51. Gille, D.A.; Famula, T.R.; May, B.P.; Schreier, A. Evidence for a maternal origin of spontaneous autopolyploidy in cultured white sturgeon (Acipenser transmontanus). Aquaulture 2015, 435, 467–474. [Google Scholar] [CrossRef]
  52. Leal, M.J.; Van Eenennaam, J.P.; Schreier, A.; Todgham, A.E. Triploidy in white sturgeon (Acipenser transmontanus): Effects of acute stress and warm acclimation on physiological performance. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2019, 229, 10–17. [Google Scholar] [CrossRef] [Green Version]
  53. Van Eenennaam, J.P.; Fiske, A.J.; Leal, M.J.; Cooley-Rieders, C.; Todgham, A.E.; Conte, F.S.; Schreier, A. Mechanical shock during egg de-adhesion and post-ovulatory ageing contribute to spontaneous autopolyploidy in white sturgeon culture (Acipenser transmontanus). Aquaculture 2020, 515, 734530. [Google Scholar]
  54. Dorota, F.-B.; Pawel, W. Spontaneous and induced gynogenesis in sterlet Acipenser ruthenus Brandt. Caryologia 2007, 60, 315–318. [Google Scholar] [CrossRef] [Green Version]
  55. Havelka, M.; Arai, K. Hybridization and Polyploidization in Sturgeon. In Sex Control in Aquaculture; Wiley: Hoboken, NJ, USA, 2018; pp. 669–687. [Google Scholar]
  56. Bronzi, P.; Chebanov, M.; Michaels, J.T.; Wei, Q.; Rosenthal, H.; Gessner, J. Sturgeon meat and caviar production: Global update 2017. J. Appl. Ichthyol. 2019, 35, 257–266. [Google Scholar] [CrossRef] [Green Version]
  57. Varga, M.; Berzi-Nagy, L.; Csukas, B.; Gyalog, G. Long-term dynamic simulation of environmental impacts on ecosystem-based pond aquaculture. Environ. Model. Softw. 2020. [Google Scholar] [CrossRef]
Genes 11 00753 g001 550
Figure 1. Mitotic metaphase chromosome spread (A) from fibroblast cell culture of the pectoral fin of an SH (small genome size hybrids) individual (No. D52B1B). (B) Corresponding karyotype of A. gueldenstaedtii × P. spathula triploid hybrid. Red arrows show the paternal-originated two large acrocentric chromosomes from P. spathula. Bar 5 µm.
Figure 1. Mitotic metaphase chromosome spread (A) from fibroblast cell culture of the pectoral fin of an SH (small genome size hybrids) individual (No. D52B1B). (B) Corresponding karyotype of A. gueldenstaedtii × P. spathula triploid hybrid. Red arrows show the paternal-originated two large acrocentric chromosomes from P. spathula. Bar 5 µm.
Genes 11 00753 g001
Genes 11 00753 g002 550
Figure 2. Mitotic metaphase chromosome spread (A) from fibroblast cell culture of the pectoral fin of an LH (large genome size hybrids) individual (No. D4D979). (B) Corresponding karyotype of A. gueldenstaedtii. × P. spathula. pentaploid hybrid. Red arrows show the paternal-originated two large acrocentric chromosomes from P. spathula. Bar 5 µm.
Figure 2. Mitotic metaphase chromosome spread (A) from fibroblast cell culture of the pectoral fin of an LH (large genome size hybrids) individual (No. D4D979). (B) Corresponding karyotype of A. gueldenstaedtii. × P. spathula. pentaploid hybrid. Red arrows show the paternal-originated two large acrocentric chromosomes from P. spathula. Bar 5 µm.
Genes 11 00753 g002
Genes 11 00753 g003 550
Figure 3. Principal component analysis (PCA) plot for morphometric characters. The percentage of total variance associated with each component is provided. Abbreviations: Cfa: length of the upper caudal lobe, IP: length of pectoral fin, L2: standard length, aD: predorsal distance, aA: preanal distance, aV: preventral distance, rr: snout length, R: preorbital length, C: head length, rc: snout tip–barbel base distance.
Figure 3. Principal component analysis (PCA) plot for morphometric characters. The percentage of total variance associated with each component is provided. Abbreviations: Cfa: length of the upper caudal lobe, IP: length of pectoral fin, L2: standard length, aD: predorsal distance, aA: preanal distance, aV: preventral distance, rr: snout length, R: preorbital length, C: head length, rc: snout tip–barbel base distance.
Genes 11 00753 g003
Genes 11 00753 g004 550
Figure 4. (a) Yearlings of A. gueldenstaedtii and (b) their hybrids: (c) typical LH hybrid, (d) typical SH hybrid of P. spathula.
Figure 4. (a) Yearlings of A. gueldenstaedtii and (b) their hybrids: (c) typical LH hybrid, (d) typical SH hybrid of P. spathula.
Genes 11 00753 g004
Table
Table 1. Parents and their progenies with expected and unexpected ploidy groups. Abbreviations: SH: small genome size, LH: large genome size.
Table 1. Parents and their progenies with expected and unexpected ploidy groups. Abbreviations: SH: small genome size, LH: large genome size.
Codes of ParentsProgeny with Expected PloidyProgeny with Spontaneous Alloploidy
FemaleMale n Range (pg)Mean (pg)Ploidy n Range (pg)Mean (pg)Ploidy
6F152E75116.96–8.17.55 ± 0.393n (SH)110.7-5n (LH)
1748.2E7597.19–8.427.59 ± 0.333n (SH)311.78–12.7112.09 ± 0.445n (LH)
Ag03596B224.39–7.796.56 ± 0.693n (SH)110.36-5n (LH)
Ag03551F246.53–8.847.62 ± 0.553n (SH)113.17-5n (LH)
Ag036517175.93–8.167.05 ± 0.513n (SH)810.87–12.8711.48 ± 0.685n (LH)
Table
Table 2. Sequence and annealing temperature of microsatellite primers.
Table 2. Sequence and annealing temperature of microsatellite primers.
LocusInheritancePrimer Sequences (5′-3′)Annealing Temperature (°C)Repeat Motif
P. spathulaA. gueldenstaedtii
Psp-28DisomicTetrasomicF: Tail-CAAAGGCATCCCCTACCAC56GA
R: GCTGGACAAAAAGTATGGAGTGC
Psp-29TetrasomicDisomicF: Tail-GGGGTCTAATAAAATCCACCGTTC56GCAC
R: TTGCCTTGTGCTCTGTGTTCC
Psp-32DisomicTetrasomicF: Tail-AATGACTCAGTTGTGTGCTGC60GT
R: AAGTGTAGGGGAATCTCACCAG
Spl-101DisomicTetrasomicF: Tail-CCCTCCACTGGAAATTTGAC52TCTA
R: GCAATCAACAAG GTCTCTTTCA
Tail (17bp)--ATTACCGCGGCTGCTGG--
Table
Table 3. Mean morphometric (mm) and meristic characteristics among Russian sturgeon and American paddlefish and their hybrids. The numbers in parentheses are the coefficient of variation percentage values. The hybrids were grouped by genome size into small genome hybrids, large genome hybrids, and hybrids without genome size data. Different bold letters (a, b, c, d) indicate the significant differences (p > 0.05) based on Kruskal–Wallis tests and Mann–Whitney U pairwise comparisons on standardized data. The data were standardized on the total length; hence, this character was not available for pairwise comparison.
Table 3. Mean morphometric (mm) and meristic characteristics among Russian sturgeon and American paddlefish and their hybrids. The numbers in parentheses are the coefficient of variation percentage values. The hybrids were grouped by genome size into small genome hybrids, large genome hybrids, and hybrids without genome size data. Different bold letters (a, b, c, d) indicate the significant differences (p > 0.05) based on Kruskal–Wallis tests and Mann–Whitney U pairwise comparisons on standardized data. The data were standardized on the total length; hence, this character was not available for pairwise comparison.
Russian Sturgeon HybridsAmerican Paddlefish
Large Genome Small GenomeWithout Genome Data
Morphometric Characters
TLtotal length328.10(11.63)-350.27(31.54)-308.52(24.77)-323.79(25.31)-239.45(10.44)-
L2standard length 242.48(11.46)a257.93(30.84)b235.34(23.98)a245.02(24.19)ab196.94(10.82)c
aApreanal distance201.78(11.97)a221.80(31.08)a200.96(24.31)b208.93(24.01)b169.04(10.75)c
aDpredorsal distance 191.62(11.43)ab204.93(30.73)b187.47(23.37)a194.07(23.84)ab160.18(10.54)c
aVpreventral distance161.32(11.82)ab173.13(31.08)b158.17(23.72)a164.31(23.21)a145.78(10.14)c
Cfalength of upper caudal lobe92.50(13.33)a94.15(33.65)b76.81(28.11)b83.61(30.08)b43.43(9.58)c
Cfblength of lower caudal lobe34.12(13.85)a43.48(36.16)b37.46(27.31)b39.96(27.15)b36.31(10.56)c
Chead length61.26(8.81)a81.97(27.5)b84.93(21.28)c86.48(18.79)c147.43(9.37)d
Rpreorbital length26.56(10.29)a38.30(26.6)b44.62(19.51)c44.41(18.59)c78.99(9.76)d
IPlength of pectoral fin41.85(10.95)a44.01(26.08)ab37.90(20.29)b40.46(21.19)b18.73(12.37)d
IVlength of ventral fin22.60(13.81)a28.01(33.02)b23.78(25.21)b25.51(25.57)b14.47(12.56)c
IAlength of anal fin26.81(15.39)a30.56(34.13)ab27.43(25.46)b29.60(25.02)b22.92(13.64)c
IDlength of dorsal fin25.27(15.31)a28.53(33.62)ab25.91(24.09)b27.06(24.07)b23.53(10.76)c
HChead depth28.66(11.64)a28.46(28.9)b26.70(19.94)b27.74(22.64)b17.43(10.82)c
hcaudal peduncle depth11.03(13.96)a10.70(33.36)b9.87(27.18)b10.53(28.77)b6.56(12.88)c
iOinterorbital distance21.54(9.77)a23.58(24.7)a24.15(18.07)b24.70(18.57)b18.76(8.25)c
rrsnout length28.46(9.5)a40.80(25.95)b46.21(21.66)c46.04(19.29)c79.02(9.63)d
rcsnout tip–barbel base distance12.26(11.71)a19.52(27.38)b26.25(20.22)c25.91(20.37)c65.84(9.44)d
SRrhead width on mouth27.70(10.47)a27.63(23.9)b27.52(19.04)ab27.77(19.85)ab20.86(10.59)c
SRChead width on barbel base18.12(11.82)a17.90(21.81)a19.01(19.42)b19.30(21.61)b17.10(8.5)c
SOmouth width13.66(12.58)a16.32(28.87)b17.31(22.31)c17.59(21.09)c16.64(11.3)d
Oeye diameter6.20(8.93)a6.79(13.48)a6.29(14.14)a6.38(14.85)a3.80(11.07)b
sLscute length10.76(11.04)a9.81(11.99)a3.71(103.77)b4.77(62.9)b---
Meristic parameters
sDLnumber of dorsal scutes13.06(12.71)a11.8(40.79)a3.9(125.53)b5.37(98.16)b---
sLLnumber of lateral scutes 37.72(11.56)a42.6(10.38)b45.01(20.83)bc47.18(15.87)c---
sVLnumber of ventral scutes10.14(13.22)a7.93(34.18)b5.01(45.21)c5.55(39.21)c---
nBnumber of barbel4(0)-3.47(28.57)-2.76(40.26)-2.87(36.24)-2(0)-
Table
Table 4. Examples of microsatellite genotypes of SH and LH individuals. (RS: Russian sturgeon; P: paddlefish; SH: hybrid with small genome; LH: hybrid with large genome). Psp-28 was disomic, and Psp-29 was tetrasomic on the paddlefish; Psp-28, Psp-32, and Spl-101 were tetrasomic on Russian sturgeon (paternal alleles are in italics). PIT IDs are the individual numbers of internal tags for individual identification.
Table 4. Examples of microsatellite genotypes of SH and LH individuals. (RS: Russian sturgeon; P: paddlefish; SH: hybrid with small genome; LH: hybrid with large genome). Psp-28 was disomic, and Psp-29 was tetrasomic on the paddlefish; Psp-28, Psp-32, and Spl-101 were tetrasomic on Russian sturgeon (paternal alleles are in italics). PIT IDs are the individual numbers of internal tags for individual identification.
PIT ID Genome TypePsp-28Psp-29Psp-32Spl_101
6F15RS1220222 201 134162164166 294 322330334
174BRS2 220 201 162164166 294304 330
Ag04RS3220 201 162164166 294304 330
2E7BP1 260 211 225 196 274
596BP2 260267 211 225 196 274
6517P3 260267 211218225 196 274
D50F80SH220 260 201211 225134 164 196 330334274
D4BE1DSH220 260 201211 225134 164 196 322330 274
D4B65ASH220 260 201211 225134 164 196 322330 274
D509E7SH220 260 201211 225134 164 196 322330 274
D4B071SH220 260 201211 225134162 196294 322 274
D4AE5ESH220 260 201211 225 162 166196294 330 274
D49E04SH220222260 201211 225 162 166196294 322 274
D4BA3FSH220222260 201211 225 162 166196 322330 274
D4A57ASH220222260 201211 225 162 166196 322 334274
D4C792SH220 260 201211 225 164166196294304 274
D49F88SH220 260 201211 225 164166196 304 274
D4C16ASH220 267201 218225 164166196294304 274
D4C4AFLH220222260 201211 225134162164166196294 322 274
D4D979LH220 260 201211 225134 164 196294304 330 274
D4C8FFLH220 260 201211 225 162164166196294304 330 274
D4B8EBLH220 260 201211 225 162164166196 304 330 274
D4B4DFLH220 260 201211 225 162164166196294304 330 274
D50340LH220 260 201211 225 162 166196294304 330 274
D522C1LH220 267201211 225 162164166196294304 330 274
Table
Table 5. DNA content and chromosome number of the different hybrid types (SH/AP and LH/AAP). AP was an interspecies triploid hybrid with two maternal (4n) genomes and one paternal (2n) genome characterized by small genome size (SH). AAP was an interspecies pentaploid hybrid with four maternal genomes and one paternal genome characterized by large genome size (LH). PIT IDs are the individual numbers of internal tags for individual identification.
Table 5. DNA content and chromosome number of the different hybrid types (SH/AP and LH/AAP). AP was an interspecies triploid hybrid with two maternal (4n) genomes and one paternal (2n) genome characterized by small genome size (SH). AAP was an interspecies pentaploid hybrid with four maternal genomes and one paternal genome characterized by large genome size (LH). PIT IDs are the individual numbers of internal tags for individual identification.
PIT ID of IndividualsDNA Content (pg)Chromosome NumberRemarks
D4AF3A4.39 ± 0.47156 ± 4 (3n)interspecies triploid hybrid (SH/AP)
D4C16A7.49 ± 0.35170 ± 2 (3n)interspecies triploid hybrid (SH/AP)
D4B0917.57 ± 0.39170 ± 6 (3n)interspecies triploid hybrid (SH/AP), paternal haploid cell lineage (1n = 66)
D4AE5E8.42 ± 0.71160 ± 4 (3n)interspecies triploid hybrid (SH/AP)
D52B1B6.85 ± 0.78176 ± 8 (3n)interspecies triploid hybrid (SH/AP), paternal haploid cell lineage (1n = 66–68)
D4D97910.87 ± 0.65308 ± 4 (5n)pentaploid hybrid (LH/AAP), dicentric chromosome was found, paternal haploid cell lineage (1n = 68)
D4C9E412.36 ± 0.84302 ± 4 (5n)pentaploid hybrid (LH/AAP)
D522C112.87 ± 1.58306 ± 4 (5n)pentaploid hybrid (LH/AAP)
Polyodon spathula3.90120 (2n)Symonová et al. [8]
Acipenser gueldenstaedtii7.86–7.88258 ± 4 (4n)Fontana et al. [37]
Table
Table 6. Characteristics of karyotypes of triploid and pentaploid hybrids compared with parental species (based on Birnstein et al.) [3].
Table 6. Characteristics of karyotypes of triploid and pentaploid hybrids compared with parental species (based on Birnstein et al.) [3].
Species/PIT IDNumber of Metacentric Plus Submetacentric ChromosomesNumber of Middle-Sized Acrocentric ChromosomesNo. of Large Acrocentric Chromosomes Number of MicrochromosomesTotal Chromosome Number
Polyodon spatula44 472120 (PP)
Acipenser gueldenstaedtii92 -155247 (AA)
D52B1B 7010294176 (SH-AP)
D4D979 118162174310 (LH-AAP)

Share and Cite

MDPI and ACS Style

Káldy, J.; Mozsár, A.; Fazekas, G.; Farkas, M.; Fazekas, D.L.; Fazekas, G.L.; Goda, K.; Gyöngy, Z.; Kovács, B.; Semmens, K.; et al. Hybridization of Russian Sturgeon (Acipenser gueldenstaedtii, Brandt and Ratzeberg, 1833) and American Paddlefish (Polyodon spathula, Walbaum 1792) and Evaluation of Their Progeny. Genes 2020, 11, 753. https://doi.org/10.3390/genes11070753

AMA Style

Káldy J, Mozsár A, Fazekas G, Farkas M, Fazekas DL, Fazekas GL, Goda K, Gyöngy Z, Kovács B, Semmens K, et al. Hybridization of Russian Sturgeon (Acipenser gueldenstaedtii, Brandt and Ratzeberg, 1833) and American Paddlefish (Polyodon spathula, Walbaum 1792) and Evaluation of Their Progeny. Genes. 2020; 11(7):753. https://doi.org/10.3390/genes11070753

Chicago/Turabian Style

Káldy, Jenő, Attila Mozsár, Gyöngyvér Fazekas, Móni Farkas, Dorottya Lilla Fazekas, Georgina Lea Fazekas, Katalin Goda, Zsuzsanna Gyöngy, Balázs Kovács, Kenneth Semmens, and et al. 2020. "Hybridization of Russian Sturgeon (Acipenser gueldenstaedtii, Brandt and Ratzeberg, 1833) and American Paddlefish (Polyodon spathula, Walbaum 1792) and Evaluation of Their Progeny" Genes 11, no. 7: 753. https://doi.org/10.3390/genes11070753

APA Style

Káldy, J., Mozsár, A., Fazekas, G., Farkas, M., Fazekas, D. L., Fazekas, G. L., Goda, K., Gyöngy, Z., Kovács, B., Semmens, K., Bercsényi, M., Molnár, M., & Patakiné Várkonyi, E. (2020). Hybridization of Russian Sturgeon (Acipenser gueldenstaedtii, Brandt and Ratzeberg, 1833) and American Paddlefish (Polyodon spathula, Walbaum 1792) and Evaluation of Their Progeny. Genes, 11(7), 753. https://doi.org/10.3390/genes11070753

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop