Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHED
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of APC-CT
2.2. Preparation of the Material Extracts
2.3. Cell Culture
2.4. Apoptosis Assay
2.5. Assessment of Cell Attachment
2.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis
2.7. Extracellular Matrix (ECM) Mineralization
2.8. Statistical Analysis
3. Results
3.1. APC-CT Did Not Exhibit Cytotoxic Effects in SHED
3.2. APC-CT Promoted Dentinogenic/Osteogenic Differentiation in SHED
3.3. APC-CT Enhanced Mineralization Activity in SHED
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kaur, M.; Singh, H.; Dhillon, J.S.; Batra, M.; Saini, M. MTA versus Biodentine: Review of literature with a comparative analysis. J. Clin. Diagn. Res. 2017, 11, ZG01–ZG05. [Google Scholar] [CrossRef]
- Parirokh, M.; Torabinejad, M.; Dummer, P. Mineral trioxide aggregate and other bioactive endodontic cements: An updated overview–part I: Vital pulp therapy. Int. Endod. J. 2018, 51, 177–205. [Google Scholar] [CrossRef]
- Samiee, M.; Eghbal, M.J.; Parirokh, M.; Abbas, F.M.; Asgary, S. Repair of furcal perforation using a new endodontic cement. Clin. Oral. Investig. 2010, 14, 653–658. [Google Scholar] [CrossRef]
- Peng, W.; Liu, W.; Zhai, W.; Jiang, L.; Li, L.; Chang, J.; Zhu, Y. Effect of tricalcium silicate on the proliferation and odontogenic differentiation of human dental pulp cells. J. Endod. 2011, 37, 1240–1246. [Google Scholar] [CrossRef]
- Kim, J.; Song, Y.S.; Min, K.S.; Kim, S.H.; Koh, J.T.; Lee, B.N.; Chang, H.S.; Hwang, I.N.; Oh, W.M.; Hwang, Y.C. Evaluation of reparative dentin formation of ProRoot MTA, Biodentine and BioAggregate using micro-CT and immunohistochemistry. Restor. Dent. Endod. 2016, 41, 29–36. [Google Scholar] [CrossRef]
- Jang, Y.E.; Lee, B.N.; Koh, J.T.; Park, Y.J.; Joo, N.E.; Chang, H.S.; Hwang, I.N.; Oh, W.M.; Hwang, Y.C. Cytotoxicity and physical properties of tricalcium silicate-based endodontic materials. Restor. Dent. Endod. 2014, 39, 89–94. [Google Scholar] [CrossRef] [PubMed]
- Parirokh, M.; Torabinejad, M. Mineral Trioxide Aggregate: A Comprehensive Literature Review—Part III: Clinical Applications, Drawbacks, and Mechanism of Action. J. Endod. 2010, 36, 400–413. [Google Scholar] [CrossRef] [PubMed]
- Dawood, A.E.; Parashos, P.; Wong, R.H.; Reynolds, E.C.; Manton, D.J. Calcium silicate-based cements: Composition, properties, and clinical applications. J. Investig. Clin. Dent. 2017, 8, 12195. [Google Scholar] [CrossRef] [PubMed]
- Caron, G.; Azérad, J.; Faure, M.-O.; Machtou, P.; Boucher, Y. Use of a new retrograde filling material (Biodentine) for endodontic surgery: Two case reports. Int. J. Oral. Sci. 2014, 6, 250–253. [Google Scholar] [CrossRef] [PubMed]
- Abdullah, D.; Ford, T.P.; Papaioannou, S.; Nicholson, J.; McDonald, F. An evaluation of accelerated Portland cement as a restorative material. Biomaterials 2002, 23, 4001–4010. [Google Scholar] [CrossRef]
- Saidon, J.; He, J.; Zhu, Q.; Safavi, K.; Spångberg, L.S. Cell and tissue reactions to mineral trioxide aggregate and Portland cement. Oral. Surg. Oral. Med. Oral. Pathol. Oral. Radiol. Endod. 2003, 95, 483–489. [Google Scholar] [CrossRef]
- Funteas, U.R.; Wallace, J.; Fochtman, F. A comparative analysis of mineral trioxide aggregate and Portland cement. Aust. Endod. J. 2003, 29, 43–44. [Google Scholar] [CrossRef]
- Oliveira, M.G.d.; Xavier, C.B.; Demarco, F.F.; Pinheiro, A.L.B.; Costa, A.T.; Pozza, D.H. Comparative chemical study of MTA and Portland cements. Braz. Dent. J. 2007, 18, 3–7. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Dong, Y.; Yang, Y.-W.; Lin, P.-t.; Yu, H.-h.; Sun, X.; Sun, X.-f.; Zhou, H.; Huang, L.; Chen, J.-h. Effect of an experimental direct pulp-capping material on the properties and osteogenic differentiation of human dental pulp stem cells. Sci. Rep. 2016, 6, 34713. [Google Scholar] [CrossRef] [PubMed]
- Islam, I.; Chng, H.K.; Yap, A.U.J. Comparison of the root-end sealing ability of MTA and portland cement. Aust. Endod. J. 2005, 31, 59–62. [Google Scholar] [CrossRef] [PubMed]
- Islam, I.; Chng, H.; Yap, A. X-ray diffraction analysis of mineral trioxide aggregate and portland cement. Int. Endod. J. 2006, 39, 220–225. [Google Scholar] [CrossRef]
- Wiltbank, K.B.; Schwartz, S.A.; Schindler, W.G. Effect of selected accelerants on the physical properties of mineral trioxide aggregate and Portland cement. J. Endod. 2007, 33, 1235–1238. [Google Scholar] [CrossRef]
- Torkittikul, P.; Chaipanich, A. Optimization of calcium chloride content on bioactivity and mechanical properties of white Portland cement. Mater. Sci. Eng. C 2012, 32, 282–289. [Google Scholar] [CrossRef]
- Ong, R.M.; Luddin, N.; Ahmed, H.M.A.; Omar, N.S. Cytotoxicity of accelerated white MTA and Malaysian white Portland cement on stem cells from human exfoliated deciduous teeth (SHED): An in vitro study. Singap. Dent. J. 2012, 33, 19–23. [Google Scholar] [CrossRef]
- Cheung, R.C.F.; Ng, T.B.; Wong, J.H.; Chan, W.Y. Chitosan: An update on potential biomedical and pharmaceutical applications. Mar. Drugs 2015, 13, 5156–5186. [Google Scholar] [CrossRef]
- Rodríguez-Vázquez, M.; Vega-Ruiz, B.; Ramos-Zúñiga, R.; Saldaña-Koppel, D.A.; Quiñones-Olvera, L.F. Chitosan and its potential use as a scaffold for tissue engineering in regenerative medicine. Biomed. Res. Int. 2015, 2015, 821279. [Google Scholar] [CrossRef] [PubMed]
- Hu, D.; Ren, Q.; Li, Z.; Zhang, L. Chitosan-Based Biomimetically Mineralized Composite Materials in Human Hard Tissue Repair. Molecules 2020, 25, 4785. [Google Scholar] [CrossRef] [PubMed]
- Cornélio, A.L.G.; Salles, L.P.; da Paz, M.C.; Cirelli, J.A.; Guerreiro-Tanomaru, J.M.; Tanomaru Filho, M. Cytotoxicity of Portland cement with different radiopacifying agents: A cell death study. J. Endod. 2011, 37, 203–210. [Google Scholar] [CrossRef] [PubMed]
- Damas, B.A.; Wheater, M.A.; Bringas, J.S.; Hoen, M.M. Cytotoxicity comparison of mineral trioxide aggregates and EndoSequence bioceramic root repair materials. J. Endod. 2011, 37, 372–375. [Google Scholar] [CrossRef]
- Athanasiadou, E.; Paschalidou, M.; Theocharidou, A.; Kontoudakis, N.; Arapostathis, K.; Bakopoulou, A. Biological interactions of a calcium silicate based cement (Biodentine™) with Stem Cells from Human Exfoliated Deciduous teeth. Dent. Mater. 2018, 34, 1797–1813. [Google Scholar] [CrossRef]
- Miura, M.; Gronthos, S.; Zhao, M.; Lu, B.; Fisher, L.W.; Robey, P.G.; Shi, S. SHED: Stem cells from human exfoliated deciduous teeth. Proc. Natl. Acad. Sci. USA 2003, 100, 5807–5812. [Google Scholar] [CrossRef]
- Sebastian, A.A.; Kannan, T.P.; Norazmi, M.N.; Nurul, A.A. Interleukin-17A promotes osteogenic differentiation by increasing OPG/RANKL ratio in stem cells from human exfoliated deciduous teeth (SHED). J. Tissue. Eng. Regen. Med. 2018, 12, 1856–1866. [Google Scholar] [CrossRef]
- Subhi, H.; Husein, A.; Mohamad, D.; Nurul, A.-A. Physicochemical, mechanical and cytotoxicity evaluation of chitosan-based accelerated portland cement. J. Mater. Res. Technol. 2020, 9, 11574–11586. [Google Scholar] [CrossRef]
- Ahmed, H.M.A.; Luddin, N.; Kannan, T.P.; Mokhtar, K.I.; Ahmad, A. Chemical analysis and biological properties of two different formulations of white Portland cements. Scanning 2016, 38, 303–316. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Sharpe, P.T. Dental mesenchymal stem cells. Development 2016, 143, 2273–2280. [Google Scholar] [CrossRef]
- Bacakova, L.; Filova, E.; Parizek, M.; Ruml, T.; Svorcik, V. Modulation of cell adhesion, proliferation and differentiation on materials designed for body implants. Biotechnol. Adv. 2011, 29, 739–767. [Google Scholar] [CrossRef]
- Zhu, Q.; Haglund, R.; Safavi, K.E.; Spangberg, L.S. Adhesion of human osteoblasts on root-end filling materials. J. Endod. 2000, 26, 404–406. [Google Scholar] [CrossRef]
- Ahmed, H.M.A.; Luddin, N.; Kannan, T.P.; Mokhtar, K.I.; Ahmad, A. White mineral trioxide aggregate mixed with calcium chloride dihydrate: Chemical analysis and biological properties. Restor. Dent. Endod. 2017, 42, 176–187. [Google Scholar] [CrossRef]
- Zhang, Y.-F.; Cheng, X.-R.; Chen, Y.; Shi, B.; Chen, X.-H.; Xu, D.-X.; Ke, J. Three-dimensional nanohydroxyapatite/chitosan scaffolds as potential tissue engineered periodontal tissue. J. Biomater. Appl. 2007, 21, 333–349. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Gan, L.; Xiao, Y.-F.; Wu, Y.; Wu, F.; Gu, Z.-W. Antibacterial hydroxyapatite/chitosan complex coatings with superior osteoblastic cell response. Mater. Lett. 2011, 65, 974–977. [Google Scholar] [CrossRef]
- Geurtsen, W. Biocompatibility of root canal filling materials. Aust. Endod. J. 2001, 27, 12–21. [Google Scholar] [CrossRef]
- Gorduysus, M.; Avcu, N.; Gorduysus, O.; Pekel, A.; Baran, Y.; Avcu, F.; Ural, A.U. Cytotoxic effects of four different endodontic materials in human periodontal ligament fibroblasts. J. Endod. 2007, 33, 1450–1454. [Google Scholar] [CrossRef]
- Wiegand, C.; Winter, D.; Hipler, U.-C. Molecular-weight-dependent toxic effects of chitosans on the human keratinocyte cell line HaCaT. Skin Pharmacol. Physiol. 2010, 23, 164–170. [Google Scholar] [CrossRef] [PubMed]
- Gandolfi, M.; Siboni, F.; Prati, C. Chemical–physical properties of TheraCal, a novel light-curable MTA-like material for pulp capping. Int. Endod. J. 2012, 45, 571–579. [Google Scholar] [CrossRef] [PubMed]
- Bahar, E.; Kim, H.; Yoon, H. ER stress-mediated signaling: Action potential and Ca2+ as key players. Int. J. Mol. Sci. 2016, 17, 1558. [Google Scholar] [CrossRef]
- Siew Ching, H.; Luddin, N.; Ab Rahman, I.; Thirumulu Ponnuraj, K. Expression of odontogenic and osteogenic markers in DPSCs and SHED: A review. Curr. Stem Cell Res. Ther. 2017, 12, 71–79. [Google Scholar] [CrossRef]
- Flores-Arriaga, J.C.; de Jesús Pozos-Guillén, A.; González-Ortega, O.; Escobar-García, D.M.; Masuoka-Ito, D.; del Campo-Téllez, B.I.M.; Cerda-Cristerna, B.I. Calcium sustained release, pH changes and cell viability induced by chitosan-based pastes for apexification. Odontology 2019, 107, 223–230. [Google Scholar] [CrossRef]
- Lei, Y.; Xu, Z.; Ke, Q.; Yin, W.; Chen, Y.; Zhang, C.; Guo, Y. Strontium hydroxyapatite/chitosan nanohybrid scaffolds with enhanced osteoinductivity for bone tissue engineering. Mater. Sci. Eng. C Mater. Biol. Appl. 2017, 72, 134–142. [Google Scholar] [CrossRef]
- Kulan, P.; Karabiyik, O.; Kose, G.; Kargul, B. The effect of accelerated mineral trioxide aggregate on odontoblastic differentiation in dental pulp stem cell niches. Int. Endod. J. 2018, 51, 758–766. [Google Scholar] [CrossRef]
- El Ashry, S.H.; Abu-Seida, A.M.; Emara, R.A. The influence of addition of osteogenic supplements to mineral trioxide aggregate on the gene expression level of odontoblastic markers following pulp capping in dog. Vet. Arhiv. 2016, 86, 685–697. [Google Scholar]
- Shen, C.; Yang, C.; Xu, S.; Zhao, H. Comparison of osteogenic differentiation capacity in mesenchymal stem cells derived from human amniotic membrane (AM), umbilical cord (UC), chorionic membrane (CM), and decidua (DC). Cell Biosci. 2019, 9, 17. [Google Scholar] [CrossRef] [PubMed]
- Roberts, S.J.; Chen, Y.; Moesen, M.; Schrooten, J.; Luyten, F.P. Enhancement of osteogenic gene expression for the differentiation of human periosteal derived cells. Stem Cell Res. 2011, 7, 137–144. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, H.M.A.; Luddin, N.; Kannan, T.P.; Mokhtar, K.I.; Ahmed, A. Dentinogenic differentiation potential of fast set white portland cements of a different origin on dental pulp stem cells. Eur. J. Gen. Dent. 2017, 6, 115–122. [Google Scholar]
- Lee, B.-N.; Kim, H.-J.; Chang, H.-S.; Hwang, I.-N.; Oh, W.-M.; Kim, J.-W.; Koh, J.-T.; Min, K.-S.; Choi, C.-H.; Hwang, Y.-C. Effects of mineral trioxide aggregate mixed with hydration accelerators on osteoblastic differentiation. J. Endod. 2014, 40, 2019–2023. [Google Scholar] [CrossRef]
- Ho, M.-H.; Liao, M.-H.; Lin, Y.-L.; Lai, C.-H.; Lin, P.-I.; Chen, R.-M. Improving effects of chitosan nanofiber scaffolds on osteoblast proliferation and maturation. Int. J. Nanomed. 2014, 9, 4293–4304. [Google Scholar]
- Boyce, B.F.; Xing, L. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch. Biochem. Biophys. 2008, 473, 139–146. [Google Scholar] [CrossRef]
- Coon, D.; Gulati, A.; Cowan, C.; He, J. The role of cyclooxygenase-2 (COX-2) in inflammatory bone resorption. J. Endod. 2007, 33, 432–436. [Google Scholar] [CrossRef] [PubMed]
- Lian, J.B.; Stein, G.S.; Javed, A.; Van Wijnen, A.J.; Stein, J.L.; Montecino, M.; Hassan, M.Q.; Gaur, T.; Lengner, C.J.; Young, D.W. Networks and hubs for the transcriptional control of osteoblastogenesis. Rev. Endocr. Metab. Disord. 2006, 7, 1–16. [Google Scholar] [CrossRef]
- Chen, S.; Gluhak-Heinrich, J.; Wang, Y.; Wu, Y.; Chuang, H.; Chen, L.; Yuan, G.; Dong, J.; Gay, I.; MacDougall, M. Runx2, osx, and dspp in tooth development. J. Dent. Res. 2009, 88, 904–909. [Google Scholar] [CrossRef] [PubMed]
- Wen, J.; Tao, R.; Ni, L.; Duan, Q.; Lu, Q. Immunolocalization and expression of Runx2 in tertiary dentinogenesis. Hybridoma 2010, 29, 195–199. [Google Scholar] [CrossRef]
- Komori, T. Regulation of osteoblast and odontoblast differentiation by runx2. J. Oral Biosci. 2010, 52, 22–25. [Google Scholar] [CrossRef]
- Liu, W.; Toyosawa, S.; Furuichi, T.; Kanatani, N.; Yoshida, C.; Liu, Y.; Himeno, M.; Narai, S.; Yamaguchi, A.; Komori, T. Overexpression of Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia with multiple fractures. J. Cell. Biol. 2001, 155, 157–166. [Google Scholar] [CrossRef]
- Li, S.; Kong, H.; Yao, N.; Yu, Q.; Wang, P.; Lin, Y.; Wang, J.; Kuang, R.; Zhao, X.; Xu, J. The role of runt-related transcription factor 2 (Runx2) in the late stage of odontoblast differentiation and dentin formation. Biochem. Biophys. Res. Commun. 2011, 410, 698–704. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Rani, S.; Wu, Y.; Unterbrink, A.; Gu, T.T.; Gluhak-Heinrich, J.; Chuang, H.-H.; MacDougall, M. Differential regulation of dentin sialophosphoprotein expression by Runx2 during odontoblast cytodifferentiation. J. Biol. Chem. 2005, 280, 29717–29727. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Zhou, Y.; Yu, Y.; Zhou, X.; Du, W.; Wan, M.; Fan, Y.; Zhou, X.; Xu, X.; Zheng, L. Evaluation of Chitosan Hydrogel for Sustained Delivery of VEGF for Odontogenic Differentiation of Dental Pulp Stem Cells. Stem Cells Int. 2019, 2019, 1515040. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Chen, T.; Han, Q.; Chen, M.; You, J.; Fang, F.; Peng, L.; Wu, B. HDAC inhibitor LMK235 promotes the odontoblast differentiation of dental pulp cells. Mol. Med. Rep. 2018, 17, 1445–1452. [Google Scholar] [PubMed]
- Mortada, I.; Mortada, R. Dental pulp stem cells and osteogenesis: An update. Cytotechnology 2018, 70, 1479–1486. [Google Scholar] [CrossRef]
- Balic, A.; Mina, M. Identification of secretory odontoblasts using DMP1-GFP transgenic mice. Bone 2011, 48, 927–937. [Google Scholar] [CrossRef][Green Version]
- Nakajima, K.; Kho, D.H.; Yanagawa, T.; Harazono, Y.; Gao, X.; Hogan, V.; Raz, A. Galectin-3 inhibits osteoblast differentiation through notch signaling. Neoplasia 2014, 16, 939–949. [Google Scholar] [CrossRef]
- An, S.; Ling, J.; Gao, Y.; Xiao, Y. Effects of varied ionic calcium and phosphate on the proliferation, osteogenic differentiation and mineralization of human periodontal ligament cells in vitro. J. Periodontal. Res. 2012, 47, 374–382. [Google Scholar] [CrossRef]
- Zanini, M.; Sautier, J.M.; Berdal, A.; Simon, S. Biodentine induces immortalized murine pulp cell differentiation into odontoblast-like cells and stimulates biomineralization. J. Endod. 2012, 38, 1220–1226. [Google Scholar] [CrossRef]
- Rashid, F.; Shiba, H.; Mizuno, N.; Mouri, Y.; Fujita, T.; Shinohara, H.; Ogawa, T.; Kawaguchi, H.; Kurihara, H. The effect of extracellular calcium ion on gene expression of bone-related proteins in human pulp cells. J. Endod. 2003, 29, 104–107. [Google Scholar] [CrossRef]
- Simon, S.; Smith, A.; Lumley, P.; Berdal, A.; Smith, G.; Finney, S.; Cooper, P. Molecular characterization of young and mature odontoblasts. Bone 2009, 45, 693–703. [Google Scholar] [CrossRef] [PubMed]
- Hao, J.; Zou, B.; Narayanan, K.; George, A. Differential expression patterns of the dentin matrix proteins during mineralized tissue formation. Bone 2004, 34, 921–932. [Google Scholar] [CrossRef]
- Florencio-Silva, R.; Sasso, G.R.d.S.; Sasso-Cerri, E.; Simões, M.J.; Cerri, P.S. Biology of bone tissue: Structure, function, and factors that influence bone cells. Biomed. Res. Int. 2015, 2015, 421746. [Google Scholar] [CrossRef] [PubMed]
- Orimo, H. The mechanism of mineralization and the role of alkaline phosphatase in health and disease. J. Nippon Med. Sch. 2010, 77, 4–12. [Google Scholar] [CrossRef] [PubMed]
- Min, K.-S.; Lee, S.-I.; Lee, Y.; Kim, E.-C. Effect of radiopaque Portland cement on mineralization in human dental pulp cells. Oral. Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 2009, 108, e82–e86. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.-C.; Yeh, L.-Y.; Shih, W.-Y.; Li, W.-C.; Chang, K.-W.; Lin, S.-C. Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a. J. Formos. Med. Assoc. 2018, 117, 308–315. [Google Scholar] [CrossRef]
- Silva, G.F.; Bosso, R.; Ferino, R.V.; Tanomaru-Filho, M.; Bernardi, M.I.; Guerreiro-Tanomaru, J.M.; Cerri, P.S. Microparticulated and nanoparticulated zirconium oxide added to calcium silicate cement: Evaluation of physicochemical and biological properties. J. Biomed. Mater. Res. A 2014, 102, 4336–4345. [Google Scholar] [CrossRef] [PubMed]
- Bortoluzzi, E.A.; Broon, N.J.; Duarte, M.A.H.; de Oliveira Demarchi, A.C.C.; Bramante, C.M. The use of a setting accelerator and its effect on pH and calcium ion release of mineral trioxide aggregate and white Portland cement. J. Endod. 2006, 32, 1194–1197. [Google Scholar]
- Tanomaru-Filho, M.; Faleiros, F.B.C.; Saçaki, J.N.; Duarte, M.A.H.; Guerreiro-Tanomaru, J.M. Evaluation of pH and calcium ion release of root-end filling materials containing calcium hydroxide or mineral trioxide aggregate. J. Endod. 2009, 35, 1418–1421. [Google Scholar] [CrossRef]
- Ambre, A.H.; Katti, D.R.; Katti, K.S. Nanoclays mediate stem cell differentiation and mineralized ECM formation on biopolymer scaffolds. J. Biomed. Mater. Res. A 2013, 101, 2644–2660. [Google Scholar] [CrossRef]
- Lim, T.Y.; Wang, W.; Shi, Z.; Poh, C.K.; Neoh, K. Human bone marrow-derived mesenchymal stem cells and osteoblast differentiation on titanium with surface-grafted chitosan and immobilized bone morphogenetic protein-2. J. Mater. Sci. Mater. Med. 2009, 20, 1–10. [Google Scholar] [CrossRef]
- Wang, G.; Zheng, L.; Zhao, H.; Miao, J.; Sun, C.; Ren, N.; Wang, J.; Liu, H.; Tao, X. In vitro assessment of the differentiation potential of bone marrow-derived mesenchymal stem cells on genipin-chitosan conjugation scaffold with surface hydroxyapatite nanostructure for bone tissue engineering. Tissue. Eng. Part A 2011, 17, 1341–1349. [Google Scholar] [CrossRef]
Genes | Gene Full Name | Primer Sequences 5′ to 3′ | Annealing Temperature (°C) | Accession Number |
---|---|---|---|---|
ALP | Alkaline phosphatase | F: GACCTCCTCGGAAGACACTC R: TGAAGGGCTTCTTGTCTGTG | 57.4 | NM_00478.5 |
COL1A1 | Collagen type 1 α 1 | F: ACATGTTCAGCTTTGTGGACC R: TGATTGGTGGGATGTCTTCGT | 55.6 | NM_000088.3 |
RUNX2 | Runt-related transcription factor 2 | F: TCTTAGAACAAATTCTGCCCTTT R: TGCTTTGGTCTTGAAATCACA | 52.4 | NM_001024630.3 |
OPN | Osteopontin | F: CAGCCATGAATTTCACAGCC R: GGGAGTTTCCATGAAGCCAC | 60.0 | NM_000582 |
OCN | Osteocalcin | F: CTCACACTCCTCGCCCTATT R: GTCAGCCAACTCGTCACAGT | 60.4 | NM_199173 |
OPG | Osteoprotegerin | F: CCACTACGACCTACTGGATGC R: GTTGCCGAAGTCACAGGTG | 60.4 | NM_002546.3 |
RANKL | Receptor activator of nuclear factor kappa-B ligand | F: GGGTGGAGGTGTACTATGATGG R: CTTGCCGTAGGAGGAGCTG | 60.4 | NM_033012.3 |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | F: CATCATCCCTGCCTCTACTG R: GCCTGCTTCACCACCTTC | 57.4 | NM_002046 |
β-actin | β - actin | F: TCCCTGGAGAAGAGCTACG R: GTAGTTTCGTGGATGCCACA | 60.0 | NM_001101.3 |
MEPE | Matrix extracellular phosphoglycoprotein | F: CCCTGGAAGAGAAGGAAACAGA R: TGAAACTCAACCTTCCCTTGGT | 60.0 | NM_001184694.2 |
DSPP | Dentin sialophosphoprotein | F: GGGATGTTGGCGATGCA R: CCAGCTACTTGAGGTCCATCTTC | 60.0 | NM_014208.3 |
DMP-1 | Dentin matrix protein 1 | F: TGCAGCTGAGATAGTTCCTAA R: TGTAGCTTTGTGGGTCCTT | 60.0 | NM_001079911.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Subhi, H.; Husein, A.; Mohamad, D.; Nik Abdul Ghani, N.R.; Nurul, A.-A. Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHED. Polymers 2021, 13, 3358. https://doi.org/10.3390/polym13193358
Subhi H, Husein A, Mohamad D, Nik Abdul Ghani NR, Nurul A-A. Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHED. Polymers. 2021; 13(19):3358. https://doi.org/10.3390/polym13193358
Chicago/Turabian StyleSubhi, Hasan, Adam Husein, Dasmawati Mohamad, Nik Rozainah Nik Abdul Ghani, and Asma-Abdullah Nurul. 2021. "Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHED" Polymers 13, no. 19: 3358. https://doi.org/10.3390/polym13193358
APA StyleSubhi, H., Husein, A., Mohamad, D., Nik Abdul Ghani, N. R., & Nurul, A.-A. (2021). Chitosan-Based Accelerated Portland Cement Promotes Dentinogenic/Osteogenic Differentiation and Mineralization Activity of SHED. Polymers, 13(19), 3358. https://doi.org/10.3390/polym13193358