Loss of msnA, a Putative Stress Regulatory Gene, in Aspergillus parasiticus and Aspergillus flavus Increased Production of Conidia, Aflatoxins and Kojic Acid
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strains and Media
2.2. Construction of the msnA Disruption Vector
2.3. Generation of msnA Disruption Strains of A. parasiticus and A. flavus
2.4. Reintroduction of msnA into the A. flavus ∆msnA Strain
2.5. Colony Growth, Conidial Production, and Sclerotial Formation
2.6. Ultraviolet-Visible (UV-Vis) Spectrophotometry and Fourier Transform Infrared (FTIR) Spectroscopy
2.7. Determination of Aflatoxins and Kojic Acid by HPLC
2.8. RNA Isolation and Probe Labeling
2.9. Microarray Assays
2.10. Quantitative PCR
2.11. Quantification of Reactive Oxygen Species (ROS)
3. Results
3.1. Vegetative Growth, Conidial Production, and Sclerotial Formation of ∆msnA Strains

3.2. Characterization of the Pigment by FTIR


3.3. Production of Aflatoxins and Kojic Acid by the ∆msnA Strains of A. parasiticus BN9 and A. flavus CA14
| Strain(T)a | Colony(mm)b | AF(μg)c | KA(mg)c | ||||
|---|---|---|---|---|---|---|---|
| B1 | B2 | G1 | G2 | Total | |||
| a: T, days of growth. RH is a blocked strain and accumulates O-methylsterigmatocystin as the end product; it does not produce aflatoxins; b: Diameter averages from triplicate MCA plates; c: Data were normalized to an area with the radius of 1.0 cm; d: ND, not determined. | |||||||
| BN9(4) | 42 | 2.87 | 0.09 | 4.50 | 0.09 | 7.58 | 0.06 |
| BN∆msn (4) | 17 | 4.36 | 0.13 | 5.11 | 0.09 | 9.69 | 1.06 |
| BN9(8) | 75 | 5.36 | 0.18 | 7.18 | 0.17 | 12.90 | 0.05 |
| BN∆msn (8) | 28 | 9.31 | 0.31 | 10.04 | 0.24 | 19.81 | 1.19 |
| RH(4) | 42 | NDd | 0.10 | ||||
| RH∆msn (4) | 13 | ND | 1.17 | ||||
| RH(7) | 67 | ND | 0.12 | ||||
| RH∆msn (8) | 20 | ND | 1.38 | ||||
| CA14(4) | 35 | <0.01 | <0.01 | 0.18 | |||
| CA∆msn (4) | 13 | 0.02 | 0.02 | 0.83 | |||
| CA14(8) | 76 | <0.01 | <0.01 | 0.35 | |||
| CA∆msn (8) | 27 | 0.01 | 0.01 | 1.33 | |||
3.4. Microarray Profiling of Differentially Expressed Genes in the ∆msnA Strains of A. parasiticus and A. flavus
| Enzyme | Gene Locus | Oligoprimer Sequence | Fold-of-Increase c |
|---|---|---|---|
| Primers used for 18S rDNA in qPCR are ttcctagcgagcccaacct and cccgccgaagcaactaag. | |||
| a: Broad Institute Aspergillus Comparative Database gene accession number (http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html); b: NCBI Entrez Gene accession number (http://www.ncbi.nlm.nih.gov/gene) (Table S1 and Table S2); c: Relative gene expression level ° S.D. The gene expression level of A. parasiticus BN9 is 1.00. | |||
| superoxide dismutase | AFL2G_10810.2 a | cgccggtactgacgacctt | 2.09 ° 0.06 |
| AFLA_099000 b | agcattgccagtcttcttgga | ||
| catalase | AFL2G_05806.2 | caggtggcttcgcgtccta | 2.30 ° 0.13 |
| AFLA_056170 | caggccgcgcttcttg | ||
| cytochrome c peroxidase | AFL2G_04481.2 | tcggtcgtgcccatcct | 2.38 ° 0.12 |
| AFLA_110690 | aagacagtagggctgaagttcca | ||
3.5. ROS Production by A. parasiticus and A. flavus ∆msnA Strains and by A. flavus msnA Addback Strains

4. Discussion
5. Conclusions
References
- Ruis, H.; Schuller, C. Stress signaling in yeast. Bioessays 1995, 17, 959–965. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, A.P.; McEntee, K. Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisia. Proc. Natl. Acad. Sci. USA 1996, 93, 5777–5782. [Google Scholar] [CrossRef]
- Treger, J.M.; Magee, T.R.; McEntee, K. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 1998, 243, 13–19. [Google Scholar] [CrossRef] [PubMed]
- Peterbauer, C.K.; Litscher, D.; Kubicek, C.P. The Trichoderma atroviride seb1 (stress response element binding) gene encodes an AGGGG-binding protein which is involved in the response to high osmolarity stress. Mol. Genet. Genom. 2002, 268, 223–231. [Google Scholar] [CrossRef]
- Seidl, V.; Seiboth, B.; Karaffa, L.; Kubicek, C.P. The fungal STRE-element-binding protein Seb1 is involved but not essential for glycerol dehydrogenase (gld1) gene expression and glycerol accumulation in Trichoderma atroviride during osmotic stress. Fungal Genet. Biol. 2004, 41, 1132–1140. [Google Scholar] [CrossRef] [PubMed]
- Aguirre, J.; Rios-Momberg, M.; Hewitt, D.; Hansberg, W. Reactive oxygen species and development in microbial eukaryotes. Trends Microbiol. 2005, 13, 111–118. [Google Scholar] [CrossRef] [PubMed]
- Georgiou, C.D.; Patsoukis, N.; Papapostolou, I.; Zervoudakis, G. Sclerotial metamorphosis in filamentous fungi is induced by oxidative stress. Integ. Comp. Biol. 2006, 46, 691–712. [Google Scholar] [CrossRef]
- Jeon, M.-H.; Hagiwara, D.; Yoshimi, A.; Abe, K.; Han, D.-M.; Chae, S.-K. Analysis of nrdA, a negative regulator of differentiation in Aspergillus nidulans. In Proceedings of 25thFungal Genetics Conference, Pacific Grove, CA, USA, 17-22 March 2009.
- Horn, B.W.; Moore, G.G.; Carbone, I. Sexual reproduction in Aspergillus flavus. Mycologia 2009, 101, 423–429. [Google Scholar] [CrossRef] [PubMed]
- Horn, B.W.; Ramirez-Prado, J.H.; Carbone, I. Sexual reproduction and recombination in the aflatoxin-producing fungus Aspergillus parasiticus. Fungal Genet. Biol. 2009, 46, 169–175. [Google Scholar] [CrossRef] [PubMed]
- Horn, B.W.; Greene, R.L.; Sobolev, V.S.; Dorner, J.W.; Powell, J.H.; Layton, R.C. Association of morphology and mycotoxin production with vegetative compatibility groups in Aspergillus flavus, A. parasiticus, and A. tamarii. Mycologia 1996, 88, 574–587. [Google Scholar] [CrossRef]
- Cotty, P.J. Virulence and cultural characteristics of two Aspergillus flavus strains pathogenic on cotton. Phytopathology 1989, 79, 808–814. [Google Scholar] [CrossRef]
- Ehrlich, K.C.; Scharfenstein, L.L.; Montalbano, B.G.; Chang, P.-K. Are the genes nadA and norB involved in formation of aflatoxin G1? Int. J. Mol. Sci. 2008, 9, 1717–1729. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.-K. A highly efficient gene-targeting system for Aspergillus parasiticus. Lett. Appl. Microbiol. 2008, 46, 587–592. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.-K.; Scharfenstein, L.L.; Wei, Q.; Bhatnagar, D. Development and refinement of a high-efficiency gene-targeting system for Aspergillus flavus. J. Microbiol. Methods 2010, 81, 240–246. [Google Scholar] [CrossRef] [PubMed]
- McAlpin, C.E.; Wicklow, D.T. Culture media and sources of nitrogen promoting the formation of stromata and ascocarps in Petromyces alliaceus (Aspergillus section Flavi). Can. J. Microbiol. 2005, 51, 765–771. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kubodera, T.; Yamashita, N.; Nishimura, A. Pyrithiamine resistance gene (ptrA) of Aspergillus oryzae: cloning, characterization and application as a dominant selectable marker for transformation. Biosci. Biotechnol. Biochem. 2000, 64, 1416–1421. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, T.; Chang, P.-K.; Matsushima, K.; Yu, J.; Abe, K.; Bhatnagar, D.; Cleveland, T.E.; Koyama, Y. Nonfunctionality of Aspergillus sojae aflR in a strain of Aspergillus parasiticus with a disrupted aflR gene. Appl. Environ. Microbiol. 2002, 68, 3737–3743. [Google Scholar] [CrossRef] [PubMed]
- Gems, D.H.; Clutterbuck, A.J. Co-transformation with autonomously-replicating helper plasmids facilitates gene cloning from an Aspergillus nidulans gene library. Curr. Genet. 1993, 24, 520–524. [Google Scholar] [CrossRef] [PubMed]
- Wan, C.; Sun, C.; Yu, J.; Niermann, W.; Fedorova, N.; Varga, J. JCVI Aspergillus flavus NRRL3357 27.6k oligo array. Available online: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL7117 (Accessed on 6 January 2011).
- McBryde, W.A.E.; Atkinson, G.F. Spectrophotometric study of the reaction between iron(III) and kojic acid. Can. J. Chem. 1961, 39, 510–525. [Google Scholar]
- Jeon, M.-H.; Hagiwara, D.; Yoshimi, A.; Abe, K.; Han, D.-M.; Chae, S.-K. Analysis of nrdA, a negative regulator of differentiation in Aspergillus nidulans. In Proceedings of 25th Fungal Genetics Conference, Pacific Grove, CA, USA, 17-22 March 2009.
- Navarro, R.E.; Stringer, M.A.; Hansberg, W.; Timberlake, W.E.; Aguirre, J. catA, a new Aspergillus nidulans gene encoding a developmentally regulated catalase. Curr. Genet. 1996, 29, 352–359. [Google Scholar] [PubMed]
- Hansberg, W.; de Groot, H.; Sies, H. Reactive oxygen species associated with cell differentiation in Neurospora crassa. Free Radic. Biol. Med. 1993, 14, 287–293. [Google Scholar] [CrossRef] [PubMed]
- Michan, S.; Lledias, F.; Hansberg, W. Asexual development is increased in Neurospora crassa cat-3-null mutant strains. Eukaryot. Cell 2003, 2, 798–808. [Google Scholar] [CrossRef] [PubMed]
- Patsoukis, N.; Georgiou, C.D. Effect of thiol redox state modulators on oxidative stress and sclerotial differentiation of the phytopathogenic fungus Rhizoctonia solani. Arch. Microbiol. 2007, 188, 225–233. [Google Scholar] [CrossRef] [PubMed]
- Patsoukis, N.; Georgiou, D.C. Thiol redox state and related enzymes in sclerotium-forming filamentous phytopathogenic fungi. Mycol. Res. 2008, 112, 602–610. [Google Scholar] [CrossRef] [PubMed]
- Geiser, D.M.; Timberlake, W.E.; Arnold, M.L. Loss of meiosis in Aspergillus. Mol. Biol. Evol. 1996, 13, 809–817. [Google Scholar] [PubMed]
- Calvo, A.M.; Bok, J.; Brooks, W.; Keller, N.P. veA is required for toxin and sclerotial production in Aspergillus parasiticus. Appl. Environ. Microbiol. 2004, 70, 4733–4739. [Google Scholar] [CrossRef] [PubMed]
- Cary, J.W.; O'Brian, G.R.; Nielsen, D.M.; Nierman, W.; Harris-Coward, P.; Yu, J.; Bhatnagar, D.; Cleveland, T.E.; Payne, G.A.; Calvo, A.M. Elucidation of veA-dependent genes associated with aflatoxin and sclerotial production in Aspergillus flavus by functional genomics. Appl. Microbiol. Biotechnol. 2007, 76, 1107–1118. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Han, K.; Kim, K.; Han, D.; Jahng, K.; Chae, K. The veA gene activates sexual development in Aspergillus nidulans. Fungal Genet. Biol. 2002, 37, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Mooney, J.L.; Yager, L.N. Light is required for conidiation in Aspergillus nidulans. Genes Devel. 1990, 4, 1473–1482. [Google Scholar] [CrossRef]
- Purschwitz, J.; Muller, S.; Kastner, C.; Schoser, M.; Haas, H.; Espeso, E.A.; Atoui, A.; Calvo, A.M.; Fischer, R. Functional and physical interaction of blue- and red-light sensors in Aspergillus nidulans. Curr. Biol. 2008, 18, 255–259. [Google Scholar] [CrossRef] [PubMed]
- Bennett, J.W.; Fernholz, F.A.; Lee, L.S. Effect of light on aflatoxins, anthraquinones, and sclerotia in Aspergillus flavus and parasiticus. Mycologia 1978, 70, 104–116. [Google Scholar] [CrossRef] [PubMed]
- Kale, S.P.; Milde, L.; Trapp, M.K.; Frisvad, J.C.; Keller, N.P.; Bok, J.W. Requirement of LaeA for secondary metabolism and sclerotial production in Aspergillus flavus. Fungal Genet. Biol. 2008, 45, 1422–1429. [Google Scholar] [CrossRef] [PubMed]
- Narasaiah, K.V.; Sashidhar, R.B.; Subramanyam, C. Biochemical analysis of oxidative stress in the production of aflatoxin and its precursor intermediates. Mycopathologia 2006, 162, 179–189. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Campbell, B.C.; Yu, J.; Mahoney, N.; Chan, K.L.; Molyneux, R.J.; Bhatnagar, D.; Cleveland, T.E. Examination of fungal stress response genes using Saccharomy cescerevisiae as a model system: targeting genes affecting aflatoxin biosynthesis by Aspergillus flavus Link. Appl. Microbiol. Biotechnol. 2005, 67, 807–815. [Google Scholar] [CrossRef] [PubMed]
- Reverberi, M.; Zjalic, S.; Ricelli, A.; Punelli, F.; Camera, E.; Fabbri, C.; Picardo, M.; Fanelli, C.; Fabbri, A.A. Modulation of antioxidant defense in Aspergillus parasiticus is involved in aflatoxin biosynthesis: a role for the ApyapA gene. Eukaryot. Cell 2008, 7, 988–1000. [Google Scholar] [CrossRef] [PubMed]
- Jayashree, T.; Subramanyam, C. Antiaflatoxigenic activity of eugenol is due to inhibition of lipid peroxidation. Lett. Appl. Microbiol. 1999, 28, 179–183. [Google Scholar] [CrossRef] [PubMed]
- Mahoney, N.; Molyneux, R.J. Phytochemical inhibition of aflatoxigenicity in Aspergillus flavus by constituents of walnut (Juglans regia). J. Agric. Food Chem. 2004, 52, 1882–1889. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Yu, J.; Mahoney, N.; Chan, K.L.; Molyneux, R.J.; Varga, J.; Bhatnagar, D.; Cleveland, T.E.; Nierman, W.C.; Campbell, B.C. Elucidation of the functional genomics of antioxidant-based inhibition of aflatoxin biosynthesis. Int. J. Food Microbiol. 2008, 122, 49–60. [Google Scholar] [CrossRef] [PubMed]
- Reverberi, M.; Fabbri, A.A.; Zjalic, S.; Ricelli, A.; Punelli, F.; Fanelli, C. Antioxidant enzymes stimulation in Aspergillus parasiticus by Lentinula edodes inhibits aflatoxin production. Appl. Microbiol. Biotechnol. 2005, 69, 207–215. [Google Scholar] [CrossRef] [PubMed]
- Niwa, Y.; Akamatsu, H. Kojic acid scavenges free radicals while potentiating leukocyte functions including free radical generation. Inflammation 1991, 15, 303–315. [Google Scholar] [CrossRef] [PubMed]
- Halliwell, B.; Chirico, S. Lipid peroxidation: its mechanism, measurement, and significance. Am. J. Clin. Nutr. 1993, 57, 715–724. [Google Scholar] [PubMed]
- Keyer, K.; Gort, A.S.; Imlay, J.A. Superoxide and the production of oxidative DNA damage. J. Bacteriol. 1995, 177, 6782–6790. [Google Scholar] [PubMed]
Supplementary Materials



| Gene ID (a) | Fold change | Regulation | Annotation |
|---|---|---|---|
| (a) NCBI Entrez Gene (http://www.ncbi.nlm.nih.gov/gene) accession number. | |||
| AFLA_003050 | 2.13 | down | RTA1 like protein |
| AFLA_003050 | 2.12 | down | RTA1 like protein |
| AFLA_003090 | 2.10 | down | hypothetical protein |
| AFLA_004690 | 2.12 | up | hypothetical protein |
| AFLA_004690 | 2.21 | up | hypothetical protein |
| AFLA_004940 | 8.07 | down | Glycolipid 2-alpha-mannosyltransferase family protein |
| AFLA_005520 | 3.38 | down | hypothetical protein |
| AFLA_006160 | 2.90 | down | hypothetical protein |
| AFLA_011970 | 2.22 | down | Major Facilitator Superfamily protein |
| AFLA_014260 | 3.08 | up | hydrophobin, putative |
| AFLA_014960 | 2.73 | down | hypothetical protein |
| AFLA_015300 | 2.03 | down | FMN-dependent dehydrogenase family protein |
| AFLA_015300 | 2.43 | down | FMN-dependent dehydrogenase family protein |
| AFLA_015550 | 4.26 | down | Sugar transporter family protein |
| AFLA_015780 | 5.24 | down | small oligopeptide transporter, OPT family protein |
| AFLA_017860 | 2.00 | up | hypothetical protein |
| AFLA_024250 | 2.01 | up | Amidase family protein |
| AFLA_027340 | 2.04 | down | Aha1 domain family, putative |
| AFLA_027340 | 2.16 | down | Aha1 domain family, putative |
| AFLA_028030 | 3.03 | down | conserved hypothetical protein |
| AFLA_029390 | 4.22 | down | HMG box family protein |
| AFLA_036040 | 2.18 | down | mitochondrial inner membrane translocase subunit (TIM17), putative |
| AFLA_036040 | 2.23 | down | mitochondrial inner membrane translocase subunit (TIM17), putative |
| AFLA_036980 | 2.76 | down | MOSC N-terminal beta barrel domain containing protein |
| AFLA_037160 | 2.40 | up | thiazole biosynthesis enzyme, putative |
| AFLA_037160 | 2.29 | up | thiazole biosynthesis enzyme, putative |
| AFLA_037290 | 2.10 | down | hypothetical protein |
| AFLA_037290 | 5.14 | down | hypothetical protein |
| AFLA_040140 | 2.02 | down | Major intrinsic protein |
| AFLA_040400 | 6.62 | down | hypothetical protein |
| AFLA_041930 | 2.93 | down | conserved hypothetical protein |
| AFLA_042970 | 3.98 | down | MIF4G domain containing protein |
| AFLA_042970 | 5.44 | down | MIF4G domain containing protein |
| AFLA_046230 | 4.20 | down | amino acid permease (Dip5), putative |
| AFLA_046400 | 4.57 | down | unknown-related |
| AFLA_046400 | 4.41 | down | DUF788 domain protein |
| AFLA_051570 | 3.88 | down | To ribosomal protein YmL36 precursormitochondrial |
| AFLA_052640 | 2.07 | down | PH domain containing protein |
| AFLA_056170 | 2.10 | up | mycelial catalase Cat1, putative |
| AFLA_056170 | 2.05 | up | mycelial catalase Cat1, putative |
| AFLA_056480 | 2.91 | down | glycosyl transferase, group 2 family protein |
| AFLA_056480 | 3.85 | down | glycosyl transferase, group 2 family protein |
| AFLA_057950 | 2.50 | up | hypothetical protein |
| AFLA_057950 | 2.33 | up | hypothetical protein |
| AFLA_059660 | 2.38 | down | Major intrinsic protein |
| AFLA_060050 | 3.07 | down | Amino acid permease family protein |
| AFLA_060050 | 3.99 | down | Amino acid permease family protein |
| AFLA_060090 | 3.87 | down | Major Facilitator Superfamily protein |
| AFLA_068610 | 2.92 | down | hypothetical protein |
| AFLA_070900 | 3.43 | down | hypothetical protein |
| AFLA_073580 | 2.96 | down | cell division control protein Cdc6, putative |
| AFLA_073800 | 2.07 | up | short chain dehydrogenase/reductase family, putative |
| AFLA_073800 | 2.10 | up | short chain dehydrogenase/reductase family, putative |
| AFLA_076860 | 2.38 | down | MOSC domain containing protein |
| AFLA_080910 | 2.98 | down | hypothetical protein |
| AFLA_080910 | 2.65 | down | hypothetical protein |
| AFLA_085250 | 2.03 | down | RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) protein, putative |
| AFLA_087740 | 3.09 | down | ANTH domain containing protein |
| AFLA_089240 | 2.98 | down | Amidase family protein |
| AFLA_089240 | 3.09 | down | Amidase family protein |
| AFLA_091600 | 3.23 | down | nascent polypeptide-associated complex (NAC) subunit, putative |
| AFLA_091980 | 4.26 | down | Ctr copper transporter family protein |
| AFLA_091980 | 3.38 | down | Ctr copper transporter family protein |
| AFLA_092600 | 2.54 | down | hypothetical protein |
| AFLA_094470 | 2.58 | down | To UV radiation resistance associated protein p63 |
| AFLA_096520 | 2.11 | down | hypothetical protein |
| AFLA_096570 | 4.88 | down | hypothetical protein |
| AFLA_097790 | 2.15 | down | To chloride-bicarbonate anion exchanger AE2, putative |
| AFLA_098050 | 3.28 | down | gamma-cysteine synthetase regulatory subunit, putative |
| AFLA_099000 | 2.07 | up | Cu, Zn superoxide dismutase SOD1, putative |
| AFLA_106370 | 2.46 | down | Conserved hypothetical ATP binding protein |
| AFLA_110690 | 2.04 | up | Peroxidase family protein |
| AFLA_110690 | 2.03 | up | Peroxidase family protein |
| AFLA_111740 | 2.83 | down | To SAC1 protein, putative |
| AFLA_111740 | 3.30 | down | To SAC1 protein, putative |
| AFLA_112180 | 2.50 | down | ATP-dependent RNA helicase, putative |
| AFLA_112420 | 2.59 | down | hypothetical protein |
| AFLA_112540 | 4.63 | down | hypothetical protein |
| AFLA_112540 | 5.17 | down | hypothetical protein |
| AFLA_114570 | 3.92 | down | conserved hypothetical protein |
| AFLA_118050 | 2.31 | down | POT family protein |
| AFLA_118050 | 2.47 | down | POT family protein |
| AFLA_119430 | 2.07 | down | Sec1 family protein |
| AFLA_120960 | 2.50 | down | hypothetical protein |
| AFLA_122110 | 2.32 | up | bifunctional catalase-peroxidase Cat2 |
| AFLA_123290 | 3.12 | down | hypothetical protein |
| AFLA_123290 | 2.35 | down | hypothetical protein |
| AFLA_124420 | 2.32 | down | amine oxidase, flavin-containing family protein |
| AFLA_127570 | 3.63 | down | hypothetical protein |
| AFLA_128560 | 3.84 | down | PrnA protein, putative |
| AFLA_131410 | 3.93 | down | PCI domain containing protein |
| AFLA_132310 | 2.45 | down | tRNA intron endonuclease, catalytic C-terminal domain containing protein |
| AFLA_132310 | 3.58 | down | tRNA intron endonuclease, catalytic C-terminal domain containing protein |
| AFLA_132750 | 2.47 | down | conserved hypothetical protein |
| AFLA_133810 | 3.05 | down | conserved hypothetical protein |
| AFLA_137510 | 4.23 | down | Emopamil binding protein |
| AFLA_138590 | 2.01 | up | cysteine-type peptidase, putative |
| AO090012000538 | 2.90 | down | predicted protein |
| AO090012000538 | 2.45 | down | predicted protein |
| Gene ID | Fold change | Regulation | Annotation |
|---|---|---|---|
| a: NCBI Entrez Gene (http://www.ncbi.nlm.nih.gov/gene) accession number. | |||
| AFLA_001010 | 4.06 | up | hypothetical protein |
| AFLA_002840 | 3.43 | down | conserved hypothetical protein |
| AFLA_002840 | 4.83 | down | conserved hypothetical protein |
| AFLA_002860 | 2.62 | down | Oxidoreductase family, NAD-binding Rossmann fold containing protein |
| AFLA_002940 | 2.43 | down | Glycosyl hydrolase family 76 protein |
| AFLA_003980 | 2.51 | down | cation diffusion facilitator family transporter containing protein |
| AFLA_003980 | 2.38 | down | cation diffusion facilitator family transporter containing protein |
| AFLA_004420 | 2.22 | up | hypothetical protein |
| AFLA_007830 | 2.85 | up | hypothetical protein |
| AFLA_007830 | 3.00 | up | hypothetical protein |
| AFLA_007860 | 2.09 | up | Major Facilitator Superfamily protein |
| AFLA_007860 | 2.12 | up | Major Facilitator Superfamily protein |
| AFLA_010180 | 2.42 | up | hypothetical protein |
| AFLA_010180 | 2.35 | up | hypothetical protein |
| AFLA_011370 | 2.17 | up | hypothetical protein |
| AFLA_011370 | 2.23 | up | hypothetical protein |
| AFLA_011530 | 5.11 | up | hypothetical protein |
| AFLA_011530 | 5.76 | up | hypothetical protein |
| AFLA_011560 | 2.49 | up | Phosphoesterase family protein |
| AFLA_011560 | 2.43 | up | Phosphoesterase family protein |
| AFLA_012030 | 2.10 | down | DUF895 domain membrane protein, putative |
| AFLA_012030 | 2.08 | down | DUF895 domain membrane protein, putative |
| AFLA_012050 | 2.68 | down | N-acetylglucosamine-6-phosphate deacetylase family protein |
| AFLA_012050 | 2.47 | down | N-acetylglucosamine-6-phosphate deacetylase family protein |
| AFLA_012080 | 2.74 | down | glucosamine-6-phosphate deaminase, putative |
| AFLA_012080 | 2.74 | down | glucosamine-6-phosphate deaminase, putative |
| AFLA_013060 | 2.88 | down | expressed protein, putative |
| AFLA_013060 | 2.83 | down | expressed protein, putative |
| AFLA_013740 | 2.46 | up | acid phosphatase SurE family protein |
| AFLA_013740 | 2.45 | up | acid phosphatase SurE family protein |
| AFLA_014210 | 3.22 | down | Major Facilitator Superfamily protein |
| AFLA_014210 | 3.78 | down | Major Facilitator Superfamily protein |
| AFLA_014510 | 4.89 | down | Formate/nitrite transporter family protein |
| AFLA_014510 | 4.33 | down | Formate/nitrite transporter family protein |
| AFLA_015780 | 4.29 | down | small oligopeptide transporter, OPT family protein |
| AFLA_015780 | 3.91 | down | small oligopeptide transporter, OPT family protein |
| AFLA_015800 | 2.25 | down | conserved hypothetical protein |
| AFLA_017750 | 3.37 | down | conserved hypothetical protein |
| AFLA_017750 | 2.75 | down | conserved hypothetical protein |
| AFLA_018790 | 3.16 | down | nitrate transporter (nitrate permease), putative |
| AFLA_018790 | 3.21 | down | nitrate transporter (nitrate permease), putative |
| AFLA_019510 | 2.60 | up | conserved hypothetical protein |
| AFLA_019510 | 3.04 | up | conserved hypothetical protein |
| AFLA_021000 | 2.16 | down | conserved hypothetical protein |
| AFLA_022370 | 2.08 | down | hypothetical protein |
| AFLA_023610 | 3.94 | down | hypothetical protein |
| AFLA_025130 | 4.27 | up | To blastomyces yeast phase-specific protein 1 |
| AFLA_025960 | 2.26 | down | Nucleoside transporter family protein |
| AFLA_025960 | 2.10 | down | Nucleoside transporter family protein |
| AFLA_026950 | 2.05 | down | acetyl-CoA-acetyltransferase, putative |
| AFLA_026950 | 2.22 | down | acetyl-CoA-acetyltransferase, putative |
| AFLA_028830 | 2.30 | up | FG-GAP repeat family protein |
| AFLA_028830 | 2.45 | up | FG-GAP repeat family protein |
| AFLA_028950 | 2.41 | down | Glycosyl hydrolase family 81 protein |
| AFLA_029000 | 2.03 | up | hypothetical protein |
| AFLA_029000 | 2.05 | up | hypothetical protein |
| AFLA_029970 | 3.69 | down | conserved hypothetical protein |
| AFLA_029970 | 3.51 | down | conserved hypothetical protein |
| AFLA_031380 | 3.64 | down | class V chitinase, putative |
| AFLA_031380 | 3.82 | down | class V chitinase, putative |
| AFLA_034140 | 3.10 | down | Major Facilitator Superfamily protein |
| AFLA_034140 | 2.88 | down | Major Facilitator Superfamily protein |
| AFLA_036370 | 2.37 | down | phosphoenolpyruvate carboxykinase (ATP), putative |
| AFLA_036370 | 2.24 | down | phosphoenolpyruvate carboxykinase (ATP), putative |
| AFLA_037820 | 3.75 | up | Hsp20/alpha crystallin family protein |
| AFLA_037820 | 3.81 | up | Hsp20/alpha crystallin family protein |
| AFLA_040140 | 2.07 | down | Major intrinsic protein |
| AFLA_040330 | 4.54 | down | Chitin binding Peritrophin-A domain containing protein |
| AFLA_040330 | 4.58 | down | Chitin binding Peritrophin-A domain containing protein |
| AFLA_041010 | 2.16 | up | hypothetical protein |
| AFLA_041010 | 2.16 | up | hypothetical protein |
| AFLA_041180 | 7.25 | down | hypothetical protein |
| AFLA_042000 | 2.01 | down | D-isomer specific 2-hydroxyacid dehydrogenase family protein, putative |
| AFLA_042360 | 2.07 | up | hypothetical protein |
| AFLA_042360 | 2.01 | up | hypothetical protein |
| AFLA_042540 | 2.38 | up | hypothetical protein |
| AFLA_043390 | 2.26 | down | hypothetical protein |
| AFLA_043390 | 2.13 | down | hypothetical protein |
| AFLA_044040 | 3.66 | down | hypothetical protein |
| AFLA_044720 | 3.39 | down | permease, cytosine/purines, uracil, thiamine, allantoin family protein |
| AFLA_044720 | 3.37 | down | permease, cytosine/purines, uracil, thiamine, allantoin family protein |
| AFLA_046620 | 2.91 | up | MAPEG family protein |
| AFLA_046620 | 2.66 | up | MAPEG family protein |
| AFLA_049470 | 3.22 | up | hypothetical protein |
| AFLA_049470 | 3.36 | up | hypothetical protein |
| AFLA_050070 | 2.19 | down | conserved hypothetical protein |
| AFLA_050940 | 2.08 | down | phenylalanyl-tRNA synthetase, beta subunit, putative |
| AFLA_053700 | 2.07 | up | hypothetical protein |
| AFLA_055550 | 2.75 | down | conserved hypothetical protein |
| AFLA_055550 | 2.55 | down | conserved hypothetical protein |
| AFLA_058030 | 2.77 | down | MFS transporter, putative |
| AFLA_058030 | 2.81 | down | MFS transporter, putative |
| AFLA_060260 | 2.32 | up | heat shock protein HSP30, putative |
| AFLA_062460 | 2.46 | down | non-classical export protein (Nce2), putative |
| AFLA_062460 | 2.66 | down | non-classical export protein (Nce2), putative |
| AFLA_063260 | 3.03 | down | Sic1.20-related |
| AFLA_063260 | 3.08 | down | Sic1.20-related |
| AFLA_063290 | 3.92 | down | hypothetical protein |
| AFLA_063290 | 4.09 | down | hypothetical protein |
| AFLA_063320 | 3.34 | down | hypothetical protein |
| AFLA_063320 | 3.74 | down | hypothetical protein |
| AFLA_065220 | 4.99 | up | hypothetical protein |
| AFLA_065220 | 4.93 | up | hypothetical protein |
| AFLA_065450 | 3.37 | down | Deuterolysin metalloprotease, putative |
| AFLA_065450 | 3.01 | down | Deuterolysin metalloprotease, putative |
| AFLA_065460 | 6.03 | down | hypothetical protein |
| AFLA_065460 | 7.02 | down | hypothetical protein |
| AFLA_065960 | 3.05 | up | fucose-specific lectin, putative |
| AFLA_065960 | 3.02 | up | fucose-specific lectin, putative |
| AFLA_066810 | 4.31 | up | To blastomyces yeast phase-specific protein 1 |
| AFLA_067640 | 2.15 | down | alternative NADH-dehydrogenase, putative |
| AFLA_067640 | 2.18 | down | alternative NADH-dehydrogenase, putative |
| AFLA_067770 | 2.62 | down | PQ loop repeat family protein |
| AFLA_067770 | 2.64 | down | PQ loop repeat family protein |
| AFLA_068600 | 2.89 | down | ammonium transporter MEAA, putative |
| AFLA_068600 | 2.90 | down | ammonium transporter MEAA, putative |
| AFLA_068790 | 2.23 | down | adenylylsulfate kinase, putative |
| AFLA_068790 | 2.27 | down | adenylylsulfate kinase, putative |
| AFLA_070070 | 2.09 | up | hypothetical protein |
| AFLA_070070 | 2.07 | up | hypothetical protein |
| AFLA_070470 | 2.02 | up | hypothetical protein |
| AFLA_074060 | 2.40 | down | R3H domain containing protein |
| AFLA_075190 | 2.96 | down | conserved hypothetical protein |
| AFLA_075190 | 2.94 | down | conserved hypothetical protein |
| AFLA_078210 | 2.37 | down | membrane protein-related |
| AFLA_078210 | 2.36 | down | membrane protein-related |
| AFLA_078900 | 3.11 | down | Glycosyl hydrolase family 20, catalytic domain containing protein |
| AFLA_078900 | 2.70 | down | Glycosyl hydrolase family 20, catalytic domain containing protein |
| AFLA_083890 | 2.60 | up | oxidoreductase, zinc-binding dehydrogenase family protein |
| AFLA_083890 | 2.59 | up | oxidoreductase, zinc-binding dehydrogenase family protein |
| AFLA_087630 | 2.96 | down | alpha, alpha-trehalose-phosphate synthase subunit, putative |
| AFLA_087630 | 2.36 | down | alpha, alpha-trehalose-phosphate synthase subunit, putative |
| AFLA_087750 | 2.96 | down | isopentenyl-diphosphate delta-isomerase, putative |
| AFLA_090690 | 2.25 | up | catalase A, putative |
| AFLA_090690 | 2.73 | up | catalase A, putative |
| AFLA_090970 | 2.24 | down | conserved hypothetical protein |
| AFLA_090970 | 2.09 | down | conserved hypothetical protein |
| AFLA_091260 | 2.08 | down | acetyltransferase, GNAT family protein |
| AFLA_091260 | 2.15 | down | acetyltransferase, GNAT family protein |
| AFLA_094630 | 2.11 | down | hypothetical protein |
| AFLA_094630 | 2.16 | down | hypothetical protein |
| AFLA_095460 | 2.39 | down | PBS lyase HEAT-like repeat family protein |
| AFLA_098380 | 3.39 | down | conidial hydrophobin RodA, putative |
| AFLA_098380 | 3.77 | down | conidial hydrophobin RodA, putative |
| AFLA_098700 | 2.54 | down | oxidoreductase, short chain dehydrogenase/reductase family protein |
| AFLA_098700 | 2.47 | down | oxidoreductase, short chain dehydrogenase/reductase family protein |
| AFLA_099050 | 3.83 | down | hypothetical protein |
| AFLA_099050 | 3.70 | down | hypothetical protein |
| AFLA_101780 | 2.41 | down | Oxidoreductase molybdopterin binding domain containing protein |
| AFLA_101780 | 2.20 | down | Oxidoreductase molybdopterin binding domain containing protein |
| AFLA_101800 | 3.81 | down | Glycosyl hydrolases family 18 protein |
| AFLA_101800 | 4.33 | down | Glycosyl hydrolases family 18 protein |
| AFLA_104350 | 8.01 | down | Dynamin central region family protein |
| AFLA_104350 | 6.90 | down | Dynamin central region family protein |
| AFLA_105630 | 3.94 | up | Cytochrome P450 family protein |
| AFLA_105630 | 3.82 | up | Cytochrome P450 family protein |
| AFLA_109030 | 3.01 | down | To nucleotide exsicion repair protein RAD7 |
| AFLA_109160 | 3.31 | down | isopentenyl-diphosphate delta-isomerase, putative |
| AFLA_110040 | 5.26 | down | blr7677-related |
| AFLA_110040 | 6.41 | down | blr7677-related |
| AFLA_112720 | 2.26 | down | diphosphomevalonate decarboxylase, putative |
| AFLA_112910 | 2.85 | up | hypothetical protein |
| AFLA_112910 | 2.89 | up | hypothetical protein |
| AFLA_113790 | 2.78 | down | hypothetical protein |
| AFLA_113790 | 2.39 | down | hypothetical protein |
| AFLA_115930 | 3.40 | up | hypothetical protein |
| AFLA_115930 | 3.22 | up | hypothetical protein |
| AFLA_119340 | 2.12 | up | Helix-loop-helix DNA-binding domain containing protein |
| AFLA_119340 | 2.29 | up | Helix-loop-helix DNA-binding domain containing protein |
| AFLA_125770 | 3.03 | down | hypothetical protein |
| AFLA_125770 | 3.25 | down | hypothetical protein |
| AFLA_127620 | 7.70 | down | New cDNA-based gene: (AO_CDS_042706, novel, updateIDs: 11597, [gene: novel_gene_1223, model: novel_model_1223]) |
| AFLA_127620 | 11.51 | down | New cDNA-based gene: (AO_CDS_042706, novel, updateIDs: 11597, [gene: novel_gene_1223, model: novel_model_1223]) |
| AFLA_129810 | 3.08 | down | cytoplasmic asparaginyl-tRNA synthetase, putative |
| AFLA_129810 | 2.94 | down | cytoplasmic asparaginyl-tRNA synthetase, putative |
| AFLA_130150 | 2.02 | down | NAD+ dependent glutamate dehydrogenase, putative |
| AFLA_133830 | 2.02 | down | oxidoreductase, zinc-binding dehydrogenase family protein |
| AFLA_134420 | 2.02 | up | Sugar transporter family protein |
| AFLA_139270 | 2.28 | up | aflNa/ hypD/ hypothetical protein |
| AFLA_139270 | 2.37 | up | aflNa/ hypD/ hypothetical protein |
| AFLA_139290 | 3.06 | up | aflMa/ hypE/ hypothetical protein |
| AFLA_139400 | 2.17 | up | aflCa/hypC/hypothetical protein |
| AFLA_139400 | 2.03 | up | aflCa/hypC/hypothetical protein |
| AO090120000447 | 6.76 | down | predicted protein |
| AO090120000447 | 5.18 | down | predicted protein |
© 2011 by the authors; licensee MDPI, Basel, Switzerland This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Chang, P.-K.; Scharfenstein, L.L.; Luo, M.; Mahoney, N.; Molyneux, R.J.; Yu, J.; Brown, R.L.; Campbell, B.C. Loss of msnA, a Putative Stress Regulatory Gene, in Aspergillus parasiticus and Aspergillus flavus Increased Production of Conidia, Aflatoxins and Kojic Acid. Toxins 2011, 3, 82-104. https://doi.org/10.3390/toxins3010082
Chang P-K, Scharfenstein LL, Luo M, Mahoney N, Molyneux RJ, Yu J, Brown RL, Campbell BC. Loss of msnA, a Putative Stress Regulatory Gene, in Aspergillus parasiticus and Aspergillus flavus Increased Production of Conidia, Aflatoxins and Kojic Acid. Toxins. 2011; 3(1):82-104. https://doi.org/10.3390/toxins3010082
Chicago/Turabian StyleChang, Perng-Kuang, Leslie L. Scharfenstein, Meng Luo, Noreen Mahoney, Russell J. Molyneux, Jiujiang Yu, Robert L. Brown, and Bruce C. Campbell. 2011. "Loss of msnA, a Putative Stress Regulatory Gene, in Aspergillus parasiticus and Aspergillus flavus Increased Production of Conidia, Aflatoxins and Kojic Acid" Toxins 3, no. 1: 82-104. https://doi.org/10.3390/toxins3010082
APA StyleChang, P.-K., Scharfenstein, L. L., Luo, M., Mahoney, N., Molyneux, R. J., Yu, J., Brown, R. L., & Campbell, B. C. (2011). Loss of msnA, a Putative Stress Regulatory Gene, in Aspergillus parasiticus and Aspergillus flavus Increased Production of Conidia, Aflatoxins and Kojic Acid. Toxins, 3(1), 82-104. https://doi.org/10.3390/toxins3010082
