Next Article in Journal
Inhibitory Effects of Selected Chemical Substances on the Growth of Filamentous Fungi Occurring in Cellar Management
Previous Article in Journal
Occurrence and Transfer by Conjugation of Linezolid-Resistance Among Non-Enterococcus faecalis and Enterococcus faecium in Intensive Pig Farms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 16
Issue 8
10.3390/microbiolres16080181
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Burden of Streptococcus pyogenes and emm12 Type in Severe Otitis Media Among Children

by
Alexandra S. Alexandrova
*,
Adile A. Muhtarova
,
Vasil S. Boyanov
and
Raina T. Gergova
Department of Medical Microbiology, Medical Faculty, Medical University of Sofia, Zdrave Str. 2, 1431 Sofia, Bulgaria
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2025, 16(8), 181; https://doi.org/10.3390/microbiolres16080181
Submission received: 25 June 2025 / Revised: 25 July 2025 / Accepted: 31 July 2025 / Published: 3 August 2025
Browse Figures
Versions Notes

Abstract

Streptococcus pyogenes (GAS) is a leading cause of acute otitis media (AOM) and its complications. This study aimed to evaluate the antimicrobial resistance of all isolated bacterial agents recovered from children with AOM and to perform the emm typing of GAS isolates. Antibiotic susceptibility testing was evaluated according to EUCAST criteria. Phenotyping and genotyping were performed for the macrolide-resistant GAS isolates. All GAS isolates were subjected to emm typing. Among the 103 AOM cases considered, we identified GAS isolates (39.4%), Staphylococcus aureus (26.6%), Haemophilus influenzae (13.8%), Streptococcus pneumoniae (11.7%), Moraxella catarrhalis (7.4%), and Serratia marcescens (1.1%). GAS exhibited 32.4% macrolide resistance and 10.8% clindamycin resistance. The M phenotype and mefE gene (18.9%) were the most common, followed by cMLSB (10.8% with ermB), a combination of mefA and ermB (8.1%), and iMLSB (2.7% with ermA). The most prevalent emm types were emm12 (27.0%), emm1 (21.6%), and emm3 (16.2%). The most common GAS emm types identified among AOM patients in this study are found worldwide and are associated with invasive infections in various countries. This may influence the virulence and invasive potential of these strains.

1. Introduction

Acute otitis media (AOM) is a rapidly progressing infection of the middle ear, characterized by inflammation, serous or purulent effusion, high fever, otalgia, and potential complications. AOM is particularly common in young children due to anatomical and immunological factors. AOM is the most common complication of rhinopharyngitis and adenoiditis in children under 5 years of age due to Eustachian tube dysfunction. In the etiology of AOM, both viruses and bacteria are included [1,2]. Viral infections of the upper respiratory tract often occur prior to bacterial AOM, creating a favorable environment for bacterial overgrowth. Viral upper respiratory infections cause inflammation and swelling of the nasopharynx and Eustachian tube, which may affect mucociliary clearance, allowing pathogens to persist and ascend into the middle ear. Viral infections may reduce secretory IgA and impact macrophage function, enhancing bacterial adherence, invasion, and proliferation. Viral AOM occurs more often in mild cases [3]. Clinically, distinguishing between viral and bacterial AOM is difficult; therefore, routine microbiological examination is a key step in the appropriate therapy and prescribing of antibiotics.
The most common viruses causing AOM are the Respiratory Syncytial Virus (RSV), Rhinovirus, Adenovirus, Influenza, and Parainfluenza Viruses. Among bacterial pathogens, many studies cite the major role of Streptococcus pneumoniae (S. pneumoniae), Haemophilus influenzae (H. influenzae), Moraxella catarrhalis (M. catarrhalis), Staphylococcus aureus (S. aureus), and Streptococcus pyogenes (S. pyogenes). H. influenzae, M. catarrhalis, and S. aureus are included mainly in the milder form of otitis media. When S. pyogenes or S. pneumoniae are involved, the disease may progress more aggressively, increasing the risk of complications such as mastoiditis, impairment, or intracranial spread [1,4].
S. pneumoniae is a vaccine-preventable pathogen due to available pneumococcal conjugate vaccines (PCVs). In 2010, the 10-valent pneumococcal conjugated vaccine (PCV10, Synflorix, GlaxoSmithKline) was introduced into the Bulgarian National Pediatric Immunization Program for universal vaccination, and remains the current choice of vaccine. Widespread adoption of PCVs has led to a dramatic decrease in the incidence of invasive pneumococcal disease in children and a significant reduction in the incidence of AOM [5,6,7].
No vaccine currently exists for S. pyogenes. This Group A β-hemolytic streptococcus (GAS) can cause severe and recurrent episodes of AOM. Unlike other otopathogens, S. pyogenes tends to provoke a more intense inflammatory response, the rapid onset of symptoms, and otorrhea, often without the effusion typically seen in other forms of AOM. S. pyogenes can also lead to complications like tympanic membrane perforation and mastoiditis if not promptly treated. Its ability to produce multiple virulence factors, such as streptolysins and exotoxins, contributes to tissue damage and inflammation within the middle ear [8,9,10].
The potential of GAS as a causative agent of acute otitis media and complications warrants attention. Prompt recognition and appropriate antibiotic therapy are essential to managing this pathogen effectively in AOM cases. Due to the increasing awareness of antimicrobial resistance and the severity of S. pyogenes infections, accurate diagnosis and culture testing are important in recurrent or complicated cases.
We aimed to identify the bacterial pathogens isolated from middle ear fluid (MEF)/otorrhea in children experiencing severe AOM episodes. We evaluated the antibiotic resistance of the most commonly involved pathogens and specifically focused on S. pyogenes, which emerged as a leading cause of severe AOM, its antimicrobial resistance, and emm typing.

2. Materials and Methods

2.1. Study Population and Procedures

The study was conducted on MEF/otorrhea specimens collected between October 2024 and March 2025 from children diagnosed with AOM. During the visit of each child, an otorhinolaryngologist collected MEF/otorrhea specimens for bacterial investigation. Only one episode of AOM was included per patient. Demographic data of the patient’s age, sex, and recent antibiotic treatment were collected during the time of the physical examination.
In some cases, empirical antibacterial therapy was prescribed at the discretion of a general practitioner during the first medical examination. Antibiotic treatment was initiated, and microbiological tests were not recommended at that time. The prescribed therapy included antibiotics from the beta-lactam group, specifically second-generation cephalosporins: cefaclor, cefuroxime, cefoxitin, and penicillins combined with beta-lactamase inhibitors like amoxicillin/clavulanic acid.
All cases in which the otoscopic examinations revealed bulging, an erythematous tympanic membrane with decreased mobility, accompanied by middle ear effusion or spontaneous tympanic membrane perforation leading to otorrhea, were categorized as “severe” AOM episodes.
Marked bulging of the tympanic membrane (TM) was present in all cases when tympanocentesis was performed.
The MEF/otorrhea specimens obtained via tympanocentesis or by direct collection of pus from spontaneous TM perforation were collected with a sterile transport flocked swab (Copan Italia S.p.A., Brescia, Italy) and were processed using conventional culture at the microbiology laboratory.

2.2. Microbiological Testing

All MEF/otorrhea samples were cultured on suitable media for suspected aerobic and anaerobic bacterial otopathogens like Columbia blood agar, Brucella blood agar, Chocolate agar, MacConkey agar, and Sabouraud agar for Candida spp. Cultures of Blood agar and Chocolate agar were incubated in the presence of 5–10% CO2 at 37 °C, and an anaerostat was used for the cultivation of anaerobic bacteria. When more than one otopathogen was cultured from the same MEF/otorrhea sample, this was deemed a coinfection. We excluded cases in which MEF/otorrhea cultures grew with typical external ear canal saprophytes such as coagulase-negative staphylococci.
The identification of all bacterial pathogens was obtained through BD Phoenix M50 Automated Microbiology System (Becton, Dickinson and Company, Franklin Lakes, NJ, USA). After overnight growth, a pure bacterial culture was obtained from the sample and suspended in a broth for identification.
Additionally, for the identification of S. pneumoniae strains, conventional microbiological methods such as optochin and bile solubility tests were performed.

2.3. H. influenzae—Capsule Detection

The typeable H. influenzae strains possessed a polysaccharide capsule encoded by the cap locus, responsible for capsule types “a” through “f” [11]. The capsular variants were detected by PCR amplification of the bexB gene [12]; the non-capsulated strains without the bexB gene were named non-typeable (NTHi) isolates.

2.4. Antimicrobial Susceptibility Testing

The Disk Diffusion Method (Kirby-Bauer) was performed to assess the antimicrobial susceptibility of the tested strains. The interpretation was performed according to the criteria of the European Committee on Antimicrobial Susceptibility Testing (EUCAST, v 15.0, 2025) guidelines [13]. The Minimum inhibitory concentration (MIC) of penicillin, ceftriaxone, erythromycin, and clindamycin was evaluated using M.I.C.Evaluator™ (M.I.C.E.™) strips (Oxoid, Basingstok, UK).

2.5. Antimicrobial Resistance Phenotyping of S. pyogenes

The phenotyping tests were performed with erythromycin (15 μg) and clindamycin (2 μg) disks 20 mm apart on a Mueller Hinton agar plate inoculated with the GAS isolate for 24 h at 37 °C to differentiate inducible (iMLSB), constitutive (cMLSB), and M phenotypes [14,15].

2.6. PCR for Macrolide Resistance Genes in S. pyogenes

All S. pyogenes isolates were screened for the macrolide resistance genes ermA, ermB, and mefA. The PCR assay was conducted in a 25 mL reaction mix using the primers described by Malhotra-Kumar et al. [16]. The following program was used for DNA amplification: an initial denaturation at 95 °C for 4 min, followed by 30 cycles consisting of denaturation at 95 °C for 30 s, annealing at 60 °C for 40 s, and extension at 72 °C for 90 s. A final elongation step was performed at 72 °C for 7 min.

2.7. S. pyogenes emm Typing

The molecular analysis of isolates for emm typing genomic DNA was prepared from S. pyogenes pure culture isolates via an automated extractor (DNA MagCore® Plus II Automated Nucleic Acid Extractor (RBC Bioscience Corp., New Taipei City, Taiwan). For the emm typing of isolates, genes were amplified using primers CDC1 (Forward) TATT(C/G)GCTTAGAAAATTAA, CDC3 (Reverse) TTCTTCAAGCTCTTTGTT] according to the protocols of the Centers for Disease Control and Prevention (CDC) for emm typing, followed by the sequencing of the PCR amplicons with the forward primer (5′-emmseq2—TATTCGCTTAGAAAATTAAAAACAGG) [17].
Sanger sequencing was performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit and BigDye® Terminator v1.1 and v3.1 5 × Sequencing Buffer on an Applied Biosystems 3130xl Genetic Analyzer. The sequences were analyzed for homology using Blast search analysis (http://www2a.cdc.gov/ncidod/biotech/strepblast.asp, accessed on 25 March 2025). The determination of emm sequence types and subtypes was conducted following the CDC protocol BLAST server 2.0 (http://www.cdc.gov/ncidod/biotech/strep/assigning.htm, accessed on 25 March 2025).

3. Results

A total of 103 children with severe AOM episodes were enrolled. The demographic and clinical data of our study population according to the type of sample cultured from AOM children are shown in Table 1. Among 103 children with AOM, n = 62 were males (60.2%). According to the age groups of patients, n = 43 (41.7%) were under 5 years.
Antibiotic therapy was administered to 35 out of 103 children before microbiological results were available.
The MEF/otorrhea isolates from the 103 children with “severe” AOM, most of which were diagnosed as acute suppurative otitis media, were recovered by MEF samples associated mostly with spontaneous otorrhea (n = 71; 68.9%) or MEF collected by tympanocentesis (n = 32, 31.1%).

3.1. Bacterial Investigation

Among all 103 cases studied, 80 cases (77.7%) were culture-positive for pathogenic bacteria (Figure 1), while the remaining 23 cases (22.3%) exhibited no bacterial or fungal growth. A total of 94 bacterial pathogens were identified, including S. pyogenes (39.4%, n = 37), S. aureus (26.6%, n = 25), H. influenzae (13.8%, n = 13), S. pneumoniae (11.7%, n = 11), M. catarrhalis (7.4%, n = 7), and Serratia marcescens (1.1%, n = 1).
Among the culture-positive AOM cases, a significant majority (83.7%) were found to have a single isolated bacterial strain. Twelve children (15.0%) experienced coinfections involving two different pathogens. One child (1.3%) was found to have three distinct bacterial isolates (Table 2).

3.2. Antimicrobial Resistance of Otopathogenic Bacteria

The results from the susceptibility testing are illustrated in Table 3.
Additional antimicrobial drugs, not included in Table 3, but tested for S. marcescens according to the EUCAS criteria, were Cefotaxime, Ciprofloxacin, Gentamicin, Imipenem, Levofloxacin, and Trimethoprim-Sulfamethoxazole. The interpretation of the results revealed susceptibility to all of them.
S. pyogenes remains fully susceptible to beta-lactams, including penicillin G, amoxicillin, amoxicillin/clavulanic acid, cefuroxime, ceftriaxone, and meropenem. However, there is notable macrolide resistance at 32.4% and clindamycin resistance at 10.8%. Antimicrobial resistance phenotyping and genotyping revealed the M phenotype and the presence of the mefA gene in seven isolates (18.9%). One isolate showed an iMLSB phenotype (2.7%) encoded by ermA, and four strains demonstrated cMLSB (10.8%), harboring a single ermB gene (13.5%) and a combination of both genes, mefA and ermB, in three strains (8.1%).
Among the S. aureus strains, high resistance to penicillin G and amoxicillin was identified (92%). In 15.4% of the H. influenzae strains, penicillin and amoxicillin resistance were observed. High rates of macrolide (66.7%) and lincosamide (55.6%) resistance were revealed among the S.pneumoniae isolates.

3.3. Capsular Typing of H. influenzae

The typing of H. influenzae disclosed that all strains (n = 13) were non-capsular (NTHi) based on the absence of the bexb gene, which is a major gene for the export and expression of its capsule.

3.4. Emm Typing of S. pyogenes Strains

Eleven emm types and subtypes were recognized among the studied AOM population, illustrated in Figure 2. The most prevalent types were emm12 (27.0%), emm1 (21.6%), and emm3 (16.2%).
The classified emm types and subtypes were distributed in seven clusters (Table 4). The major clusters were A-C4 (n = 11), A-C5 (n = 9), A-C3 (n = 8), and E4 (n = 4).
Macrolide-resistant determinants were predominantly found in clusters A-C4, accounting for 56.2% of cases. The leading emm12 type included all isolates positive for the mefA gene. Additionally, strains that carried both the erm and mef determinants were also of the emm12 type. A single genetic determinant, ermA, was identified in emm75, while the ermB gene appeared in various clusters, including A-C4, A-C5, and E6.

4. Discussion

The bacterial spectrum of otitis media encompasses the most common respiratory pathogens in childhood. Different factors like antibiotic selective pressure and routine immunizations may influence the distribution of bacterial otopathogens [18]. S. pneumoniae and H. influenzae are vaccine-preventable agents. The immunization with PCV10 was included in the national immunization program in 2010, and after 15 years of vaccination, the PCV10 vaccine dramatically decreased S. pneumoniae prevalence [7,19]. However, in recent years, there has been a significant increase in the number of non-vaccine strains, especially from serotypes 19A, 6C, and 3, which are particularly prevalent among non-invasive pneumococcal diseases [20].
H. influenzae type b is a part of the combinatory vaccine against diphtheria, tetanus, pertussis, polio, and hepatitis B. The incidence of Hib decreased significantly after mass immunization, increasing the prevalence of non-typeable NTHi or other capsular H. influenzae variants. In our study, all H. influenzae strains were NTHi. Such investigations prove the crucial role of NTHi in the pathogenesis and persistence of otitis media [1,3,19].
The leading pathogen among all severe AOM cases studied was S. pyogenes. Other investigations found GAS in the MEF/otorrhea of children with higher rates, compared with other “mild” AOM episodes [4]. S. pyogenes is associated with severe presentations, especially in children over 3 years of age and adolescents [2]. It is more frequently identified in recurrent otitis media and acute mastoiditis [21,22].
GAS often participates in coinfections, where it interacts with other viral, bacterial, or fungal pathogens, leading to altered disease severity and complications. In our study, this occurred in association with almost all other recognized bacterial pathogens. These interactions can increase virulence and complicate antibiotic therapy, especially in cases of penicillin-resistant strains, like S. aureus and M.catarrhalis, producing extracellular beta-lactamases, S. pneumoniae, while GAS remains susceptible to penicillin [18]. NTHi is also associated with biofilm formation, which protects the bacteria from antibiotics and immune clearance; thus, the biofilm formations contribute to chronicity and therapeutic failure [23].
Macrolide resistance in S. pyogenes is of significant clinical importance, particularly because macrolides are commonly used as first-line alternatives for patients allergic to penicillin [24]. There has been a trend of macrolide resistance in recent years in our country. A study of 4768 patients (aged 1–16 years) with upper respiratory tract infections caused by S. pyogenes strains during the period from 1998 to 2014 disclosed almost 23% macrolide resistance in 2014 [25]. More than 36% of Bulgarian GAS isolates in 2015–2016 were identified to contain macrolide resistance genes [26,27]. In the current study, on the specific target group of children with AOM, the macrolide resistance was 32.4%. The M phenotype was the leading phenotype among the studied erythromycin-resistant strains, characterized by resistance to macrolides but not to lincosamides, which is typically due to efflux mechanisms encoded by mefA genes.
The results of in vitro susceptibility testing revealed significant resistance to penicillin G and amoxicillin among the S. aureus isolates. (92%), suggesting the widespread production of β-lactamase. Moderate resistance to macrolides and lincosamides was also detected, suggesting possible MLSB resistance mechanisms [28,29,30]. In 15.4% of the H. influenzae strains, penicillin and amoxicillin resistance were observed, likely due to β-lactamase production [31]. The most concerning resistance among the S. pneumoniae strains in acute otitis media (AOM) is the resistance to penicillin and cefuroxime, suggesting alterations in penicillin-binding proteins (PBPs). Additionally, the high rates of macrolide (66.7%) and lincosamide (55.6%) resistance indicate prevalent MLSB resistance [18,32,33]. There were no resistant M. catarrhalis strains to amoxicillin/clavulanic acid and cephalosporins, confirming that β-lactam/β-lactamase inhibitor combinations remained highly effective. The resistance to penicillin and amoxicillin, encoded with widespread β-lactamase production, is specifically for M. catarrhalis [34,35]. S. marcescens typically exhibit intrinsic resistance to penicillin and some cephalosporins due to the expression of AmpC β-lactamase [36].
emm typing is the most widely used method for the epidemiological characterization of S. pyogenes strains. It is based on the sequence of the emm gene, which encodes the M protein, a major virulence factor of S. pyogenes [37]. The M protein plays a crucial role in bacterial adhesion, immune evasion, and resistance to phagocytosis [38]. The emm gene exhibits significant sequence diversity, particularly in its N-terminal region, which is exposed on the bacterial surface and recognized by the host immune system, prompting the evolution of antigenic variants to escape immune detection. The sequence variability in the N-terminal region allows for the classification of S. pyogenes into over 275 distinct emm types known at this point, which are associated with different epidemiological and clinical patterns [9,39].
In our study, the most distributed emm types were emm12, emm1, and emm3. In a Bulgarian study of 182 non-duplicate GAS isolates collected between 2014 and 2018 from patients aged 1 to 86 years with various clinical manifestations, emm types 1 and 12 were reported to be the most virulent [40]. The same types are commonly linked to invasive infections, while emm4 and emm6 types are frequently found in cases of pharyngitis [9,41]. A multicenter European study described a high burden of emm1 and emm3 in invasive diseases, supporting their virulent profiles [42]. A recent study from Turkey reported that a high number of the GAS strains belonged to emm types 1, 12, and 89 [43].
A Canadian study on the collection of S. pyogenes from pharyngitis cases indicated that the rate of progression from pharyngitis to invasive disease increased in 2022–2023. This rise was linked to emm types 1 and 12, and the study reported cases in which S. pyogenes pharyngitis specimens progressed into invasive disease [44]. According to the GAS Surveillance Program in Spain, the most common types involved in invasive GAS from 2007 to 2019 were emm1, emm89, and emm3 [45].
Limitations of the study. The emm typing discloses only a single gene and may not fully reveal the genetic diversity and pathogenic potential of the strains. Whole-genome sequencing (WGS) and multi-locus sequence typing (MLST) are used in large-scale surveillance studies.

5. Conclusions

The emm GAS types found in the pediatric population with acute otitis media are globally widespread and have been associated with invasive infections in other countries. This is an important factor in the increasing virulence of these circulating genetic lineages. It is essential to monitor AOM microbiology and antibiotic resistance patterns to provide appropriate treatment recommendations for children. Additionally, infections caused by S. pyogenes are less likely to be resolved without antibiotics, underscoring the need for prompt medical evaluation and adequate treatment.

Author Contributions

Conceptualization, A.S.A., A.A.M., and R.T.G.; Formal analysis, A.S.A. and A.A.M.; Investigation, A.S.A., A.A.M., and V.S.B.; Methodology, A.S.A., A.A.M., V.S.B., and R.T.G.; Project administration, A.S.A. and R.T.G.; Software, A.S.A., A.A.M., and V.S.B.; Supervision, A.S.A. and R.T.G.; Validation, A.S.A., A.A.M., V.S.B., and R.T.G.; Visualization, A.S.A., A.A.M., and V.S.B.; Writing—original draft, A.S.A.; Writing—review and editing, A.S.A. and R.T.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Grant No. 157/4.06.2025 of Medical University-Sofia, Bulgaria.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All datasets generated or analyzed during the study are included in the manuscript.

Acknowledgments

We thank the Laboratory of the Department of Medical Microbiology team at the Medical University of Sofia for their participation in collecting the strains for the study.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Bustamante, J.; Tran, T.; Rodriguez, C. Otitides: Acute and chronic otitis media and externa. Prim. Care Clin. Off. Pract. 2025, 52, 1–14. [Google Scholar] [CrossRef] [PubMed]
  2. Leibovitz, E.; Broides, A.; Greenberg, D.; Newman, N. Current management of pediatric acute otitis media. Expert. Rev. Anti Infect. Ther. 2010, 8, 151–161. [Google Scholar] [CrossRef] [PubMed]
  3. Sawada, S.; Okutani, F.; Kobayashi, T. Comprehensive detection of respiratory bacterial and viral pathogens in the middle ear fluid and nasopharynx of pediatric patients with acute otitis media. Pediatr. Infect. Dis. J. 2019, 38, 1199–1203. [Google Scholar] [CrossRef] [PubMed]
  4. Segal, N.; Givon-Lavi, N.; Leibovitz, E.; Yagupsky, P.; Leiberman, A.; Dagan, R. Acute otitis media caused by Streptococcus pyogenes in children. Clin. Infect. Dis. 2005, 41, 35–41. [Google Scholar] [CrossRef] [PubMed]
  5. Guerra, S.; LaRock, C. Group A Streptococcus interactions with the host across time and space. Curr. Opin. Microbiol. 2024, 77, 102420. [Google Scholar] [CrossRef]
  6. Manzanares, Á.; Aguilera-Alonso, D.; Escobar, M.; Vigil-Vázquez, S.; Cercenado, E.; Saavedra-Lozano, J.; Mastoiditis-Gregorio Marañón Working Group. Changes in the epidemiology of acute mastoiditis according to the implementation of pneumococcal vaccination in a Spanish population. Enferm. Infect. Microbiol. Clin. 2025, 43, 361–364. [Google Scholar] [CrossRef]
  7. Alexandrova, A.S.; Pencheva, D.R.; Mitov, I.G.; Setchanova, L.P. Clonal distribution, antimicrobial resistance, and pilus islets in S. pneumoniae isolates recovered from PCV10-vaccinated children with suppurative AOM in Bulgaria (2015–2020). Jpn. J. Infect. Dis. 2022, 75, 92–95. [Google Scholar] [CrossRef]
  8. Wang, J.; Ma, C.; Li, M.; Gao, X.; Wu, H.; Dong, W.; Wei, L. Streptococcus pyogenes: Pathogenesis and the Current Status of Vaccines. Vaccines 2023, 11, 1510. [Google Scholar] [CrossRef]
  9. Campbell, P.T.; Tong, S.Y.C.; Geard, N.; Davies, M.R.; Worthing, K.A.; Lacey, J.A.; Smeesters, P.R.; Batzloff, M.R.; Kado, J.; Jenney, A.W.J.; et al. Longitudinal Analysis of Group A Streptococcus emm types and emm clusters in a high-prevalence setting: Relationship between past and future infections. J. Infect. Dis. 2020, 221, 1429–1437. [Google Scholar] [CrossRef]
  10. Davies, M.R.; Holden, M.T.G.; Coupland, P.; Chen, J.H.; Venturini, C.; Barnett, T.C.; Zakour, N.L.; Tse, H.; Dougan, G.; Yuen, K.Y.; et al. Emergence of scarlet fever Streptococcus pyogenes emm12 clones in Hong Kong is associated with toxin acquisition and multidrug resistance. Nat. Genet. 2015, 47, 84–87. [Google Scholar] [CrossRef]
  11. Kroll, S.; Loynds, B.; Brophy, L.; Moxon, E.R. The bex locus in encapsulated Haemophilus influenzae: A chromosomal region involved in capsule polysaccharide export. Mol. Microbiol. 1990, 4, 1853–1862. [Google Scholar] [CrossRef]
  12. Davis, G.S.; Sandstedt, S.A.; Patel, M.; Marrs, C.F.; Gilsdorf, J.R. Use of bexB to detect the capsule locus in Haemophilus influenzae. J. Clin. Microbiol. 2011, 7, 2594–2601. [Google Scholar] [CrossRef]
  13. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 15.0. 2025. Available online: http://www.eucast.org (accessed on 1 January 2025).
  14. Powell, L.M.; Choi, S.J.; Grund, M.E.; Demkowicz, R.; Berisio, R.; LaSala, P.R.; Lukomski, S. Regulation of erm(T) MLSB phenotype expression in the emergent emm92 type group A Streptococcus. NPJ Antimicrob. Resist. 2024, 2, 44. [Google Scholar] [CrossRef] [PubMed]
  15. Gerber, A.M. Antibiotic resistance in group A streptococci. Pediatr. Clin. North. Am. 1995, 42, 539–551. [Google Scholar] [CrossRef]
  16. Malhotra-Kumar, S.; Lammens, C.; Piessens, J.; Goossens, H. Multiplex PCR for simultaneous detection of macrolide and tetracycline resistance determinants in streptococci. Antimicrob. Agents Chemother. 2005, 49, 4798–4800. [Google Scholar] [CrossRef]
  17. Centers for Disease Control and Prevention (CDC). Emm Typing Protocol for M Protein Gene Sequencing. 2023. Available online: https://www.cdc.gov/streplab/groupa-strep/emm-typing-protocol.html (accessed on 25 March 2025).
  18. Gergova, R.; Boyanov, V.; Muhtarova, A.; Alexandrova, A. A Review of the Impact of Streptococcal Infections and Antimicrobial Resistance on Human Health. Antibiotics 2024, 13, 360. [Google Scholar] [CrossRef]
  19. Alexandrova, A.; Preslava, H.; Hitkova, H.; Gergova, R. A significant role of Non-typeable H. influenzae in acute otitis media in Bulgarian children. Pediatr. Infect. Dis. J. 2023, 18, 163–167. [Google Scholar] [CrossRef]
  20. Alexandrova, A.; Pencheva, D.; Mitov, I.; Setchanova, L. Phenotypic and genotypic characteristics of non-invasive S. pneumoniae isolates recovered from PCV10-vaccinated children in Bulgaria. Indian. J. Med. Microbiol. 2022, 40, 61–67. [Google Scholar] [CrossRef] [PubMed]
  21. Tzovara, I.; Doudoulakakis, A.; Kalogeras, G.; Koutouzis, E.; Dellis, C.; Pasparakis, S.; Charakida, M.; Lebessi, E.; Bozavoutoglou, E.; Tsakanikos, M.; et al. Bacterial acute otitis media complicated with otorrhea in a children’s hospital in the era of pneumococcal conjugate vaccines. Pathogens 2025, 14, 494. [Google Scholar] [CrossRef]
  22. Draut, S.; Müller, J.; Hempel, J.M.; Schrötzlmair, F.; Simon, F. Tenfold increase: Acute pediatric mastoiditis before, during, and after COVID-19 restrictions. Otol. Neurotol. 2024, 45, 777–782. [Google Scholar] [CrossRef]
  23. Boia, E.R.; Huț, A.R.; Roi, A.; Luca, R.E.; Munteanu, I.R.; Roi, C.I.; Riviș, M.; Boia, S.; Duse, A.O.; Vulcănescu, D.D.; et al. Associated Bacterial Coinfections in COVID-19-Positive Patients. Medicina 2023, 59, 1858. [Google Scholar] [CrossRef]
  24. Leclercq, R. Mechanisms of resistance to macrolides and lincosamides: Nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 2002, 34, 482–492. [Google Scholar] [CrossRef]
  25. Gergova, R.; Petrova, G.; Gergov, S.; Minchev, P.; Mitov, I.; Strateva, T. Microbiological features of upper respiratory tract infections in Bulgarian children for the period 1998–2014. Balkan Med. J. 2016, 33, 675–680. [Google Scholar] [CrossRef] [PubMed]
  26. Muhtarova, A.; Mihova, K.; Markovska, R.; Mitov, I.; Kaneva, R.; Gergova, R. Molecular emm typing of Bulgarian macrolide-resistant Streptococcus pyogenes isolates. Acta Microbiol. Immunol. Hung. 2019, 67, 14–17. [Google Scholar] [CrossRef]
  27. Muhtarova, A.; Gergova, R.; Mitov, I. Distribution of macrolide resistance mechanisms in Bulgarian clinical isolates of Streptococcus pyogenes during the years of 2013–2016. J. Glob. Antimicrob. Resist. 2017, 10, 238–242. [Google Scholar] [CrossRef] [PubMed]
  28. Abbas, A.; Srivastava, P.; Nirwan, P.S. Prevalence of MLSB Resistance and Observation of erm A and erm C genes at a tertiary care hospital. J. Clin. Diagn. Res. 2015, 9, DC08-10. [Google Scholar] [CrossRef]
  29. Khodabandeh, M.; Mohammadi, M.; Abdolsalehi, M.R.; Alvandimanesh, A.; Gholami, M.; Bibalan, M.H.; Pournajaf, A.; Kafshgari, R.; Rajabnia, R. Analysis of resistance to macrolide-lincosamide-streptogramin B Among mecA-positive Staphylococcus aureus isolates. Osong Public. Health Res. Perspect. 2019, 10, 25–31. [Google Scholar] [CrossRef] [PubMed]
  30. Fisher, J.F.; Mobashery, S. β-Lactams against the fortress of the Gram-Positive Staphylococcus aureus bacterium. Chem. Rev. 2021, 121, 3412–3463. [Google Scholar] [CrossRef]
  31. Fuji, N.; Pichichero, M.; Kaur, R. Haemophilus influenzae prevalence, proportion of capsulated strains and antibiotic susceptibility during colonization and acute otitis media in children, 2019–2020. Pediatr. Infect. Dis. J. 2021, 40, 792–796. [Google Scholar] [CrossRef]
  32. Hsieh, Y.C.; Su, L.H.; Hsu, M.H.; Chiu, C.H. Alterations of penicillin-binding proteins in pneumococci with stepwise increase in β-lactam resistance. Pathog. Dis. 2013, 67, 84–88. [Google Scholar] [CrossRef]
  33. Gavrilovici, C.; Spoială, E.L.; Miron, I.C.; Stârcea, I.M.; Haliţchi, C.O.I.; Zetu, I.N.; Lupu, V.V.; Pânzaru, C. Acute otitis media in children-challenges of antibiotic resistance in the post-vaccination era. Microorganisms 2022, 10, 1598. [Google Scholar] [CrossRef]
  34. Alexandrova, A.S.; Boyanov, V.S.; Mihova, K.Y.; Gergova, R.T. Phylogenetic Lineages and Diseases Associated with Moraxella catarrhalis Isolates Recovered from Bulgarian Patients. Int. J. Mol. Sci. 2024, 25, 9769. [Google Scholar] [CrossRef] [PubMed]
  35. Xiang, Y.; Shi, J.; Han, L.; Yang, C.; Lu, S. Pathogenicity and Bro gene typing of pediatric lower respiratory tract infections with Moraxella catarrhalis in Southwest Shandong, China. Sci. Rep. 2025, 15, 15070. [Google Scholar] [CrossRef]
  36. Tavares-Carreon, F.; De Anda-Mora, K.; Rojas-Barrera, I.C.; Andrade, A. Serratia marcescens antibiotic resistance mechanisms of an opportunistic pathogen: A literature review. PeerJ 2023, 11, e14399. [Google Scholar] [CrossRef]
  37. McMillan, D.; Drèze, P.A.; Vu, T.; Bessen, D.; Guglielmini, J.; Steer, A.; Carapetis, J.R.; van Melderen, L.; Sriprakash, K.S.; Smeesters, P.R. Updated model of group A Streptococcus M proteins based on a comprehensive worldwide study. Clin. Microbiol. Infect. 2013, 19, 222–229. [Google Scholar] [CrossRef] [PubMed]
  38. Smeesters, P.; McMillan, D.; Sriprakash, K. The streptococcal M protein: A highly versatile molecule. Trends Microbiol. 2010, 18, 275–282. [Google Scholar] [CrossRef]
  39. Centers for Disease Control and Prevention (CDC). Emm Sequence Database. 2021. Available online: https://www2.cdc.gov/vaccines/biotech/strepblast.asp (accessed on 25 March 2025).
  40. Gergova, R.; Muhtarova, A.; Mitov, I.; Setchanova, L.; Mihova, K.; Kaneva, R.; Markovska, R. Relation between emm types and virulence gene profiles among Bulgarian Streptococcus pyogenes clinical isolates. Infect. Dis. 2019, 51, 668–675. [Google Scholar] [CrossRef] [PubMed]
  41. Steer, A.C.; Law, I.; Matatolu, L.; Beall, B.W.; Carapetis, J.R. Global emm type distribution of group A streptococci: Systematic review and implications for vaccine development. Lancet Infect. Dis. 2009, 9, 611–616. [Google Scholar] [CrossRef]
  42. Luca-Harari, B.; Darenberg, J.; Neal, S.; Siljander, T.; Strakova, L.; Tanna, A.; Creti, R.; Ekelund, K.; Koliou, M.; Tassios, P.T.; et al. Strep-EURO Study Group. Clinical and microbiological characteristics of severe Streptococcus pyogenes disease in Europe. J. Clin. Microbiol. 2009, 47, 1155–1165. [Google Scholar] [CrossRef]
  43. Ünübol, N.; Caglayan, N.; Cebeci, S.; Beşli, Y.; Sancak, B.; Uyar, N.Y.; Ahrabi, S.S.; Alebouyeh, M.; Kocagöz, T. Antimicrobial resistance and epidemiological patterns of Streptococcus pyogenes in Turkiye. J. Infect. Public. Health. 2025, 18, 102633. [Google Scholar] [CrossRef]
  44. Tyrrell, G.; Croxen, M.; McCullough, E.; Li, V.; Golden, A.; Martin, I. Group A streptococcal infections in Alberta, Canada 2018–2023. Epidemiol. Infect. 2024, 153, e35. [Google Scholar] [CrossRef] [PubMed]
  45. Bellés-Bellés, A.; Prim, N.; Mormeneo-Bayo, S.; Villalón-Panzano, P.; Valiente-Novillo, M.; Jover-Sáenz, A.; Aixalà, N.; Bernet, A.; López-González, É.; Prats, I.; et al. Changes in Group A Streptococcus emm types associated with invasive infections in adults, Spain, 2023. Emerg. Infect. Dis. 2023, 29, 2390–2392. [Google Scholar] [CrossRef] [PubMed]
Microbiolres 16 00181 g001
Figure 1. Bacterial spectrum of AOM in children up to 14 years of age.
Figure 1. Bacterial spectrum of AOM in children up to 14 years of age.
Microbiolres 16 00181 g001
Microbiolres 16 00181 g002
Figure 2. Distribution of emm types among S. pyogenes AOM isolates.
Figure 2. Distribution of emm types among S. pyogenes AOM isolates.
Microbiolres 16 00181 g002
Table 1. Demographic data and clinical sampling of 103 children (0–14 years) with severe AOM cases.
Table 1. Demographic data and clinical sampling of 103 children (0–14 years) with severe AOM cases.
Sex (n, %)Age (n)Sampling of MEF * Specimens (n)Empirical Ab Therapy (n/All Cases) **
Male (n = 62, 60.2%)0–2 (n = 3)
3–6 (n = 21)
7–14 (n = 38)		Tympanocentesis (n = 19)n = 22/62 cases
Spontaneous otorrhea (n = 43)
Female (n = 41, 39.8%)0–2 (n = 1)
3–6 (n = 26)
7–14 (n = 14)		Tympanocentesis (n = 11)n = 13/41 cases
Spontaneous otorrhea (n = 30)
Total (100%)n = 103n = 103n = 35/103 cases
* MEF—middle ear fluid, ** Empirical antibiotic therapy—the prescribed medication is started before the exact causative agent of the infection is known.
Table 2. Bacterial coinfection in AOM cases from children up to 14 years of age.
Table 2. Bacterial coinfection in AOM cases from children up to 14 years of age.
Bacterial Coinfectionn *
S. pyogenes + S. aureusn = 5
S. pyogenes + S. pneumoniaen = 2
S. pneumoniae + M. catarrhalisn = 2
S. pneumoniae + S. aureusn = 1
M. catarrhalis + H. influenzaen = 1
M. catarrhalis + S. aureusn = 1
S. pyogenes + S. pneumoniae + S. aureusn = 1
Total (n)n = 13
* n—number of cases.
Table 3. Antimicrobial resistance of 94 bacterial pathogens isolated from AOM pediatric cases.
Table 3. Antimicrobial resistance of 94 bacterial pathogens isolated from AOM pediatric cases.
Pen GAmxAmcCxmCroEryCliMero
S. pyogenes
n = 37 (39.4%)		0000012 (32.4)4 (10.8)0
S. aureus
n = 25 (26.6%)		23 (92.0)23 (92.0)1 (4.0)1 (4.0)1 (4.0)9 (36.0)5 (25.0)0
H. influenzae
n = 13 (13.8%)		2 (15.4)2 (15.4)000--0
S. pneumoniae
n = 11 (11.7%)		2 (22.2)2 (22.2)1 (11.1)3 (33.3)06 (66.7)5 (55.6)0
M. catarrhalis
n = 7 (7.4%)		7 (100)7 (100)000000
S. marcescens
n = 1 (1.1%)		1 (100)1 (100)1 (100)1 (100)0--0
PenG—benzylpenicillin; Amx—amoxicillin; Amc—amoxicillin/clavulanic acid ratio 2:1; Cxm—cefuroxime; Cro—ceftriaxone; Ery—erythromycin; Cli—clindamycin; Mero—meropenem.
Table 4. Distribution of macrolide-resistant determinants among clusters and emm types of S. pyogenes AOM strains.
Table 4. Distribution of macrolide-resistant determinants among clusters and emm types of S. pyogenes AOM strains.
Clusteremm Typen *Macrolide Resistance Determinants
mefAermAermBermB + mefA
A-C4 (29.7%)emm12
emm12.5		105 13
1
A-C5 (24.3%)emm3
emm3.1		6 2
3
A-C3 (21.6%)emm181
E4 (10.8%)emm2
emm28		1 2
3
E3 (2.7%)emm4411
E6 (2.7%)emm751 1
Y-M6 (8.1%)emm6
emm6.4		2
1
100% 37 7 (18.9%)1(2.7%)5 (13.5%)3 (8.1)
* n—number of cases.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alexandrova, A.S.; Muhtarova, A.A.; Boyanov, V.S.; Gergova, R.T. Burden of Streptococcus pyogenes and emm12 Type in Severe Otitis Media Among Children. Microbiol. Res. 2025, 16, 181. https://doi.org/10.3390/microbiolres16080181

AMA Style

Alexandrova AS, Muhtarova AA, Boyanov VS, Gergova RT. Burden of Streptococcus pyogenes and emm12 Type in Severe Otitis Media Among Children. Microbiology Research. 2025; 16(8):181. https://doi.org/10.3390/microbiolres16080181

Chicago/Turabian Style

Alexandrova, Alexandra S., Adile A. Muhtarova, Vasil S. Boyanov, and Raina T. Gergova. 2025. "Burden of Streptococcus pyogenes and emm12 Type in Severe Otitis Media Among Children" Microbiology Research 16, no. 8: 181. https://doi.org/10.3390/microbiolres16080181

APA Style

Alexandrova, A. S., Muhtarova, A. A., Boyanov, V. S., & Gergova, R. T. (2025). Burden of Streptococcus pyogenes and emm12 Type in Severe Otitis Media Among Children. Microbiology Research, 16(8), 181. https://doi.org/10.3390/microbiolres16080181

Article Metrics

Back to TopTop