Next Article in Journal
Indicators of the Microbial Corrosion of Steel Induced by Sulfate-Reducing Bacteria Under the Influence of Certain Drugs
Next Article in Special Issue
Prevalence and Antibiotic Resistance of Salmonella spp. and Campylobacter spp. Isolated from Retail Chickens in Saudi Arabia
Previous Article in Journal
Molecular Diversity of Arbuscular Mycorrhizal Fungi Associated with the Rhizosphere of Vachellia seyal Del. from Selected Saline Soils in Senegal
Previous Article in Special Issue
Influence of Organic Matter from Native Fish on the Antimicrobial Efficacy of Sodium Hypochlorite (NaClO) in Reducing Salmonella spp. Population
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 16
Issue 1
10.3390/microbiolres16010020
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection and Characterization of Escherichia coli and Escherichia coli O157:H7 in Human, Animal, and Food Samples from Kirkuk Province, Iraq

by
Hayman Abdullah Ameen Altaie
1,2,
Maroua Gdoura Ben Amor
1,
Burhan Ahmed Mohammed
2 and
Radhouane Gdoura
1,*
1
Research Laboratory of Environmental Toxicology Microbiology and Health (LR17ES06), Faculty of Sciences, Sfax University, BP 1171, Sfax 3000, Tunisia
2
Department of Medical Laboratory Techniques, College of Medical Technology, Alkitab University, Kirkuk 1068, Iraq
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2025, 16(1), 20; https://doi.org/10.3390/microbiolres16010020
Submission received: 10 November 2024 / Revised: 21 December 2024 / Accepted: 13 January 2025 / Published: 16 January 2025
(This article belongs to the Collection Public Health and Quality Aspects Related to Animal Productions)
Versions Notes

Abstract

:
This study aims to investigate the prevalence of E. coli and E. coli O157:H7 in 353 samples collected in Kirkuk from human stool, animal feces, raw and pasteurized milk, and beef hamburgers. E. coli was isolated using conventional methods and identified with the Enterosystem Kit 18R. Suspected E. coli O157:H7 were confirmed serologically and tested for antimicrobial resistance and virulence genes (stx1, stx2, eaeA, and hlyA). The overall prevalence rates of 20.4% for E. coli and 7.9% for E. coli O157:H7 were found, with the highest prevalence in human stool. The antimicrobial susceptibility profile of 28 E. coli O157:H7 isolates revealed significant resistance and sensitivity patterns, highlighting important implications for public health. The isolates demonstrated complete sensitivity to gentamicin (100%), while also showing high sensitivity to ciprofloxacin (92.86%), ceftriaxone (85.71%), and amikacin (64.29%). Conversely, the isolates exhibited notable resistance to tetracycline (85.71%), ampicillin (75.00%), sulfamethoxazole (71.43%), and streptomycin (67.86%). All the E. coli O157:H7 strains isolated in this study were positive for stx1 and/or stx2, as well as the eaeA gene, and are referred to as enterohemorrhagic (EHEC) strains. In order to highlight the genotypic variability among the EHEC E. coli O157:H7 isolates, five virulence profiles were identified, with profile III (stx2, eaeA, and hlyA) being the most common (35.7%). This profile was closely associated with diarrheic humans, while profile V (stx1, eaeA) was prevalent in animal feces and products. These findings may raise awareness of the risks associated with this pathogen, helping to reduce the incidence of E. coli-related diseases and to protect human health.

1. Introduction

Escherichia coli (E. coli) are rod-shaped, Gram-negative coliform bacteria that are widely distributed in nature. They are a large and diverse group of bacteria, and they infect both humans and animals [1]. Most E. coli strains are harmless [2]. However, some strains are pathogenic and can cause severe human illness [3]. Diarrheagenic E. coli (DEC) are among the most abundant bacterial pathogens that cause gastroenteritis worldwide. According to the WHO Global Burden of Foodborne Diseases report, DEC causes 200,000 deaths and over 300 million illnesses worldwide each year [4]. Five DEC pathotypes are relatively well defined based on the presence of specific virulence traits directly related to disease development. The DEC pathotypes include enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC), and Shiga toxin-producing E. coli (STEC) [4,5].
STEC strains that cause human illnesses, such as bloody diarrhea and hemolytic uremic syndrome (HUS), are often classified as enterohemorrhagic E. coli (EHEC) [4,6].
The main STEC serogroups include E. coli O26, O45, O91, O103, O111, O113, O121, O128, O145, and O157, and they are all capable of producing one or both types of Shiga toxins encoded by the stx1 and stx2 genes, which are the chief factors accountable for the clinical signs [7]. Shiga toxin acts by inhibiting protein synthesis in endothelial and other cells; primarily, it damages the vascular endothelium and leads to thrombotic lesions and disseminated intravascular coagulation [8]. Within this classification of STEC, there are pathovars that also contain the eae gene encoding for intimin, which is involved in the attachment to the enterocyte and causes attaching and effacing (A/E) lesions in the intestinal mucosa [9]. Any E. coli strain that is positive for stx1 and/or stx2 and for eae is referred to as EHEC [10].
In addition to Shiga toxins and intimin production, certain isolates also have hlyA gene [11] encoding for cytolysin, which can lyse red blood cells and liberate iron to help support E. coli metabolism [12].
Much attention is devoted to the EHEC serotype O157:H7 strains, not only because they are associated with outbreaks and sporadic cases of diarrhea and HUS worldwide [13] but also because they have a low infectious dose and an ability to survive in extra-intestinal environments [14]. Moreover, O157 strains typically carry EHEC-associated virulence genes, and the expression of the H7 antigen (encoded by fliCH7) is also an important characteristic of EHEC O157 [15].
Typically, healthy cattle serve as the primary reservoir for E. coli O157:H7, but they are also carried by sheep, chicken, and goats [16].
Human infections with E. coli O157:H7 are often attributed to the consumption of contaminated food of animal origins, including raw or undercooked meat, meat products, raw milk, and unpasteurized dairy products [17]. These foods can become contaminated by contact with animal feces during harvesting, processing, or storage or by cross-contamination with other foods or utensils. During meat production, improper evisceration procedures or inadequate sanitation allow feces from the gastrointestinal tract to come in direct contact with carcasses, resulting in their contamination [18,19,20]. Likewise, in the case of dairy production, poor hygiene during the milking operation or the presence of feces on an animal udder or milking apparatus might contaminate raw milk [21,22,23].
During processing, mistakes in handling and preparation, such as insufficient handwashing or the use of unclean utensils, can heighten the risk of cross-contamination. Poor storage practices, including inadequate separation of raw and ready-to-eat foods or temperature abuse, can allow bacteria to survive and grow [24].
Additionally, person-to-person transmission is also possible [25]. Currently, another major concern for human health is the rise in antimicrobial resistance due to the overuse of antibiotics in livestock production and human disease treatment in developing countries [26,27]. Studies conducted in different areas indicate that there has been a significant rise in the antimicrobial resistance pattern of E. coli O157:H7 to commonly used antibiotics [28,29].
In Iraq, consuming raw (unpasteurized) milk is a common tradition, and ready-to-eat meat products like beef hamburger are highly popular. When contaminated, these products serve as major transmission routes for E. coli O157:H7 from animals to humans. Previous studies have not sufficiently examined the role of animals and derived products as sources of pathogenic and drug-resistant foodborne strains or their impact on human health. This study aims to address this gap by evaluating the prevalence, virulence factors, and antibiotic resistance of E. coli O157:H7 in animals, humans, raw milk, and beef hamburgers in Kirkuk Province in Iraq. The findings will help raise public awareness and guide effective prevention and control strategies.

2. Materials and Methods

2.1. Sampling

The study outlines the collection and processing of stool specimens from both human and animal sources for bacteriological examination. A total of 353 human and animal samples were collected in Kirkuk Province in Iraq, during the period from May 2021 to January 2024.
  • Human Stool Specimens
A total of 100 stool specimens were collected from a group of patients comprising 75 diarrheic patients and 25 healthy individuals. Each sample was collected using a multipurpose sample collecting bottle. In the study, a total of 100 patients were included—50 females and 50 males—with ages ranging from 1 to 40 years. Human clinical samples were collected from various healthcare settings, including hospitals, private clinics, and diagnostic centers. This diverse sampling approach ensures a broad representation of the population and enhances the reliability of the findings.
  • Animal Fecal Samples
In this study, a total of 100 fecal samples, including 35 cow feces, 35 sheep feces, and 30 goat feces samples, were collected from farms using sterile cotton swabs. Each cloacal swab sample was immediately placed in a sterile collection tube containing 10 mL of buffer peptone water.
  • Animal products
A total of 153 samples, comprising raw cow milk (n = 50), raw sheep milk (n = 35), pasteurized milk (n = 33), and hamburger beef (n = 35), were gathered from various retail shops selling dairy products and meat. All the samples were collected in sterile screw-capped bottles.
All the collected samples were kept in ice boxes and were transferred directly and as soon as possible to the laboratory of the medical analysis technique department, Faculty of Medical Technique, Al-Kitab University, for bacteriological examination within 24 to 72 h.

2.2. Ethics and Consent Approval

The study was approved by the Ethical Committee at Alkitab University, Kirkuk, Iraq. The research adhered to ethical principles aimed at protecting animal well-being and the human subjects, ensuring confidentiality and respecting the cultural sensitivities specific to Iraq.
Informed consent was obtained from the adults as well as from the parents of the children before enrolment in the study.
With the consent of the field owners, non-invasive sampling of the animals was carried out in order to minimize stress and preserve their well-being.

2.3. Isolation and Identification of E. coli and E. coli O157:H7

2.3.1. Isolation and Identification Procedure

The isolation method described for E. coli involves a systematic approach utilizing selective enrichment and differential plating techniques, following the protocol established by Quinn et al. [30]. Briefly, after each original sample was homogenized, 1 mL of the test sample was transferred into 9 mL of sterile peptone water and incubated at 37 °C for 24 h. The pre-enriched samples were further inoculated into MacConkey broth and incubated at 37 °C for 24 h for selective enrichment. An aliquot of 1 mL from each enrichment was taken and then streaked on the MacConkey agar plates for the identification of E. coli and incubated at 37 °C for 24 h.
The suspected E. coli colonies, which are pink-colored with a rod-shaped appearance, were again subcultured on the selective medium eosin methylene blue agar (EMB) and incubated at 37 °C for 24 h. Dark-centered and flat colonies with a metallic sheen were considered as E. coli [31].
The presumptive E. coli colonies were subjected to Gram staining and biochemical identification using the Enterosystem R18 kit (ref. 71711). This system provides a comprehensive analysis of various biochemical characteristics, allowing accurate identification of E. coli based on its specific metabolic profile.
The identified E. coli colonies were further subcultured onto sorbitol MacConkey agar (SMAC) plates at 37 °C for 24 h to differentiate the E. coli O157:H7 strain from the other E. coli strains. Sorbitol fermenters (pinkish colonies) were considered as non-O157:H7 E. coli strains, whereas the non-sorbitol-fermenting isolates (colorless or pale colonies) were confirmed as E. coli O157:H7 strains [32].

2.3.2. Serological Test for E. coli O157:H7 Screening

A fresh single colony of presumptive E. coli O157:H7 from the SMAC agar was picked and subjected to a serological test to determine the presence of somatic (O) and flagella (H) antigens through an agglutination technique [33]. The serological test involved the use of E. coli antisera Denka Kit (Denka Kit, Denka Seiken Co., Ltd., Tokyo, Japan). The test reagent consists of latex particles that have been coated with a rabbit antibody specific to the O157:H7 antigens found in E. coli. Antisera O157 and Antisera H7 latex, which are both utilized in the testing process, are supplied in bottles with droppers for easy administration.

2.4. Antimicrobial Susceptibility of E. coli O157:H7 Isolates

All the E. coli O157:H7 isolates that had been confirmed biochemically were evaluated for in vitro antimicrobial susceptibility using the Kirby–Bauer disk diffusion test on Meuller–Hinton agar according to the National Committee for Clinical Laboratory Standards method [34]. Eight antimicrobial agents were chosen for antibiotic sensitivity testing (Table 1).
The selection of these antibiotics was based on the availability and frequent use of these antimicrobials in the study area in both veterinary and human medicine.
The inhibition zones were measured and interpreted, and the isolates were classified as sensitive (S), intermediate (I), and resistant (R) according to the interpretation tables of the Clinical and Laboratory Standard Institute [35].

2.5. Detection of Virulence Genes in E. coli O157:H7 Isolates

Confirmed E. coli O157:H7 isolates were screened for the stx1 (encoding Shiga toxin 1), stx2 (encoding Shiga toxin 2), eaeA (encoding intimin), and hlyA (encoding hemolysin) genes. The primers employed in this research were the same as those used in Abdulmajeed et al.’s study [33]. Table 2 lists all the primers, as well as their annealing temperature and the size of the amplified fragments for each gene.
DNA isolation from a freshly grown bacterial culture was performed using the PROMEGA Wizard® Genomic DNA Purification Kit (Catalog number: A1120) (Promega Corporation, Madison, WI, USA), following the manufacturer’s recommended protocol. This kit is designed for efficient extraction of high-quality genomic DNA from various sources, including animal and plant tissues, yeast, and bacteria. It uses a phenol-free method, which is suitable for PCR, enzyme digestion restriction, and hybridization applications.
Amplifications were performed in a 25 µL reaction mixture containing 1 × PCR buffer 5× Go Taq Flexi Buffer (Promega, Charbonnières-les-Bains, France), a final concentration of 0.2 mM from each deoxynucleotide triphosphate, a concentration of 0.5 mM for each primer, and 2.5 mM of MgCl2. In addition, 1 U of GoTaq® Flexi DNA polymerase (Promega, France) was used. Optimal amplification was carried out as follows: initial denaturation at 95 °C for 5 min; 30 cycles at 95 °C for 30 s, followed by 30 s at the annealing temperatures (Table 2) and 72 °C for 30 s min. A final elongation step at 72 °C for 7 min was performed.
For each run, the whole PCR mix without any DNA template was used as a negative control. Locally isolated strains containing the key virulence genes often targeted in PCR assays were used as positive controls. The PCR products were analyzed by gel electrophoresis in a 1% agarose gel run at 50 V. To visualize band migration, the gel was stained with ethidium bromide and observed under UV light. A 100 pb ladder was used to estimate amplicon size.

2.6. Statistical Analysis

The statistical significance of the differences between measurements was evaluated using the Student’s t-test, implemented in Microsoft Excel. A p value of less than 0.05 (p < 0.05) was considered statistically significant.

3. Results

3.1. Occurrence of E. coli

A total of 353 samples were collected from both human and animal sources in Kirkuk Province in Iraq.
The numbers of E. coli isolates recovered from the sites are shown in Table 3.
E. coli was recovered from 20.4% (72/353) of all the samples. Only one colony was selected from each positive sample.
The overall percentage of E. coli was 42% (42 out of 100) of the human stool samples, 7% (7 out of 100) of the animal fecal samples, and 15.03% (23 out of 153) of the animal products.
As shown in Table 3, human stool samples contributed the highest number of positive cases, with an overall positivity rate of 42%. This included 40 out of the 75 participants with diarrhea (53.3%) and 2 out of the 25 participants known to be healthy (8%).
The Table 4 presents the frequency distribution of E. coli in humans with respect to gender. Among the individuals with diarrhea, 22 out of 35 males (62.8%) and 18 out of 40 females (45%) tested positive for E. coli. In comparison, only 1 out of 15 apparently healthy males (6.6%) and 1 out of 10 apparently healthy females (10%) tested positive. Overall, among the 50 examined male samples, 23 (46%) were positive for E. coli, while 19 out of 50 examined female samples (38%) tested positive.
Although a higher proportion of males tested positive for E. coli compared to females, the difference is not statistically significant, as indicated by the p-value 0.356.
The frequency distribution of E. coli in humans with respect to age indicated that the highest incidence of diarrhea was observed in children < 10 years (Table 5).
In the animal fecal samples, the positivity rate was substantially lower, with only 7 out of 100 samples (7%) testing positive. Among these, cows had the highest rate of E. coli detection compared to sheep and goats (Table 3).
The distribution of E. coli among different animal types reveals varying prevalence rates: 11.4% in cows, 5.7% in sheep, and 3.33% in goats.
Animal-derived products showed a notable positivity rate of 15%, with 23 out of 153 samples testing positive (Table 3). Hamburger beef had the highest rate within this category, with 9 out of 35 samples (25.7%) testing positive, followed by raw cow milk at 18% (9 out of 50) and sheep milk at 11.42% (4 out 35). Pasteurized milk had a minimal positivity rate, with only 1 out of 33 samples testing positive (3.03%).

3.2. Occurrence of E. coli O157:H7

The serological test was employed by using the latex agglutination test for the screening of E. coli O157:H7; then, from 72 E. coli positive samples, 28 isolates were agglutinated in both tests and taken as E. coli O157:H7. This corresponds to an overall detection rate of 7.9% for E. coli O157:H7 across 353 samples collected from human, animal fecal, and animal product categories.
The distribution of E. coli O157:H7 isolates across the sample sources is shown in Table 6.
The human stool samples showed the highest occurrence of E. coli O157:H7, with 17 out of 100 samples testing positive. Diarrheic individuals represented the majority of these cases, with 16 out of 75 samples (21.33%) testing positive, compared to only 1 positive sample among the apparently healthy individuals (4%).
The animal fecal samples displayed a lower occurrence of E. coli O157:H7, at 3%. Positive samples were found across the cow, sheep, and goat feces, although in small numbers (one positive case for each).
The animal products demonstrated a moderate occurrence rate, with 8 out of 153 samples (5.22%) testing positive. Raw cow milk and hamburger beef had the highest contamination rates within this category. Raw cow milk showed a prevalence of 8% (4 out of 50), and hamburger beef displayed a prevalence of 8.57% (3 out of 35). Pasteurized milk showed no detection of E. coli O157:H7.

3.3. Antimicrobial Susceptibility Testing of E. coli O157:H7 Isolates

As presented in Table 7, the result of the antimicrobial sensitivity assay of the 28 E. coli O157:H7 isolates with the eight selected antimicrobial agents revealed high sensitivity to gentamicin (100%), ciprofloxacin (92.86%), ceftriaxone (85.71%), and amikacin (64.29%). Conversely, high resistance to tetracycline (85.71%), ampicillin (75.00%), sulfamethoxazol (71.43%), and streptomycin (67.86%) was reported.

3.4. Detection of Virulence Genes in E. coli O157:H7 Isolates

The presence of four virulence genes, stx1, stx2, eaeA, and hlyA, was assessed in the 28 E. coli O157:H7 isolates using single PCR assays.
All the E. coli O157:H7 strains isolated in this study were positive for stx1 and/or stx2, as well as the eaeA gene. These virulence markers are characteristic of enterohemorrhagic E. coli (EHEC) [10]. Accordingly, these strains are referred to as EHEC throughout the study.
All the isolates were positive for at least three of the examined genes. Eight (28.57%) isolates exhibited all four of the virulence genes tested. The virulence genes stx1, stx2, eaeA, and hlyA were detected in 64.28%, 67.85%, 100%, and 67.85% of the isolates, respectively.
To explore the genotypic variability among the EHEC E. coli O157:H7 strains, virulence profiles were used as a supplementary approach. Table 8 categorizes the EHEC E. coli O157:H7 strain collection into five virulence profiles (I–V) based on combinations of the genes stx1, stx2, eaeA, and hlyA.
The distribution of the virulence profiles among the EHEC E. coli O157:H7 strains differs across the human, animal fecal, and animal product sources (Table 9).
In the human stool samples, profile III was the most common and was identified in 10 out of 16 isolates from the patients with diarrhea. The remaining six isolates from these patients corresponded to profile I. Profile IV was detected in one strain from an apparently healthy individual.
In the animal fecal samples, the three isolates showed diversity, with profile II present in cow feces and profile V in both sheep and goat feces.
In the animal products, profile V was the most common, accounting for six of the eight isolates, and was primarily in the raw milk and hamburger beef. Additionally, two isolates from the animal products exhibited profile I.
Overall, profile III was closely associated with the diarrheic humans, while profile V was prevalent in the animal feces and products, emphasizing the need for the monitoring of these profiles to protect public health.

4. Discussion

4.1. Occurrence of E. coli

The occurrence of E. coli in human and animal samples is widespread. In humans, E. coli is commonly found in the gut from birth, acquired through food, water, and contact with other individuals [36]. In animals, particularly in livestock like cattle, E. coli can be present in large numbers in the gastrointestinal tract. The transfer of E. coli from animals to humans can occur through the consumption of undercooked meat, unpasteurized dairy products, or contaminated water or through contact with feces [37].
The high prevalence of E. coli recorded in the human stool samples was consistent with previous studies that have reported high prevalence rates of E. coli in human fecal samples, ranging from 35% to 55% in different populations [38,39]
Our study detected E. coli in both diarrheic and apparently healthy individuals. This aligns with findings from Nji et al. (2021) [40], who emphasized that pathogenic E. coli strains were found in both symptomatic and asymptomatic individuals. These results are supported by further studies investigating the prevalence of E. coli across different health conditions, including various pathotypes, such as enterohemorrhagic E. coli (EHEC) [41], enteropathogenic E. coli (EPEC) [42], and enteroaggregative E. coli (EAEC) [43].
The high prevalence of E. coli in diarrheic patients aligns with the established knowledge that E. coli, particularly pathogenic strains, are major causative agents of diarrheal diseases.
A study conducted by Mulu et al. in 2024 [44] emphasized that various pathogenic strains of E. coli, including enterotoxigenic, enteropathogenic, and enterohemorrhagic E. coli, are significant contributors to diarrheal illnesses in both developing and developed countries. Similarly, Robert et al.’s study [39] reported that pathogenic E. coli are often isolated from patients with acute diarrhea, highlighting their role in gastrointestinal infections.
In agreement with our finding, Shine et al. [45] indicated that most of the diarrheal children were within the age group < 2 years. It has been suggested that in developing countries the infection is usually acquired before five years of age [46].
The high incidence of diarrhea observed in children < 10 years (Table 5) is consistent with the results of other studies [47,48]. A multiple indicator survey performed by the National Centre for health information and UNICEF reported that the prevalence rate of diarrhea in children was 39.2% in children < two years old [49]. One of the reasons why the prevalence of diarrhea increases between the ages of 6 and 24 months could be the introduction of complementary food and the unsanitary preparation of weaning food [50]. As age increases, exposure to various infection sources increases, as does the ultimate rate of infection [51].
Cows exhibited the highest rate of E. coli detection compared to sheep and goats; this is a result that aligns with previous studies investigating the prevalence of Shiga toxin-producing E. coli (STEC) in livestock animals [52,53,54,55].
This high prevalence of E coli in cows compared to other livestock is attributed to the intensive farming practices and the natural gut flora of these animals [53].
Animals can contract the pathogen via the fecal–oral route by consuming contaminated feed or water, or through direct contact with the environment or other animals [56].
Shiga toxin-producing E. coli infections in animals generally do not lead to disease but are manifested through bacterial colonization of the lower gastrointestinal tract [56], from which the bacteria are excreted intermittently in animal feces [57].
Enterohemorrhagic E. coli can survive and multiply in animal excrement for over 20 months [58]. This pathogen can therefore persist in the environment, maintain itself, and be transmitted to humans through the consumption of products contaminated with animal excrement.
In this study, we investigated the contamination of beef hamburgers with E. coli. Out of 35 hamburger samples analyzed, 9 were found to be contaminated, resulting in a prevalence rate of 25.71%.
Compared to our findings, the occurrence of E. coli strains carrying intestinal pathogenic virulence factors or antibiotic resistance genes was lower in studies from Portugal (20%) [59] and Ethiopia (6%) [60]. Similarly, Abdel-Atty et al. [61] did not detect E. coli in any of the 25 beef burger samples they analyzed in Egypt. In contrast, our results were lower than those reported in Iran (48%) [62], Ghana (88%) [63], and northwest Spain, where E. coli was detected in 100% of various beef products, including meatballs, minced meat, hamburgers, and sausages [64].
The variation in E. coli contamination levels between kofta and beef burgers can be attributed to factors such as handling practices, processing operations, post-processing contamination, and storage conditions [20]. In developing countries like Iraq, traditional manual methods of slaughtering and evisceration often take place under unhygienic conditions, increasing the risk of contamination by gut microbes in ready-to-eat meat products. Previous research has shown that slaughterhouses with poor infrastructure and no automation face a higher risk of microbial contamination due to deficiencies in hygiene practices and sanitary policies [18,19,20].
Floors in slaughterhouses can harbor contaminants, which are then spread through workers’ footwear, transferring bacteria throughout the slaughterhouse. Furthermore, cleaning with high-pressure water can lead to the spread of germs through water droplets in the air [65].
Poor hygiene and improper evisceration can cause rapid bacterial growth on carcasses [66,67]. As a result, blades, cutting tools, and other equipment may become contaminated, allowing the spread of bacteria to other carcasses.
Several authors have underlined the importance of decontaminating knives between carcasses to prevent cross-contamination [68,69].
Meat can be contaminated during rinsing at slaughterhouses, where drinking water is used for cleaning and preparation [70,71]. Therefore, regular testing is necessary to ensure the water purity [72].
In most small-scale milk production farms in the Middle East and North Africa (MENA) region, there are no strict implementations of procedures for the cleaning and disinfection of materials used during production processes, from milking to the sale of final products.
Theoretically, raw milk from a healthy animal is considered safe for human consumption at the time of milking. However, contamination can arise through two primary routes. Endogenous contamination occurs when pathogens are transferred directly from an infected animal’s blood or udder into the milk. In contrast, exogenous contamination takes place during or after milking due to contact with animal feces, soil, air, water, feed, equipment, the exterior of the udder and teats, animal hides, and people [21,22,23].
Of the 85 raw milk samples collected, 15.29% (13/85) were found to be contaminated with E. coli strains. This rate is lower than the findings reported by Ranjbar et al. [73] in Iran, where Shiga toxin-producing E. coli prevalence in raw milk and traditional dairy products reached 30.16%, and by Ombarak et al. [74] in Egypt, where contamination in various dairy products ranged from 21% to 77%.
However, our results align more closely with studies reporting E. coli prevalence in raw milk ranging from 1% to 27%, with various pathotypes and serovars identified.
These include reports from Switzerland [75], Iran [76], and Italy [77] on Shiga toxin-producing strains, as well as from Ethiopia [23], Egypt [78], Turkey [79], China [80], and Spain [81], where E. coli O157 and toxigenic strains were detected.
The dairy farm environment can serve as a reservoir for foodborne pathogens, significantly contributing to the microbial contamination of raw milk.
At first, farmers, especially smallholders, used their hands and traditional equipment for milking, which increased the risk of bacterial contamination in milk and dairy products [21,22,23]. The use of unsterilized containers, along with unsanitized hands and poor udder hygiene, further exposes milk to harmful microorganisms [22].
Moreover, the improper storage of raw milk samples at temperatures below 4 °C allows bacteria to survive and proliferate [21,22,23]. The poor hygiene of animals and the condition of the housing floor may have contributed to the environmental contamination of milk with fecal and infected animal waste [21,22,23]. Additionally, the transmission of pathogens by infected milking personnel and farm workers is another potential risk factor [73].
The higher prevalence of E. coli in cow’s milk (18%) compared to sheep’s milk (11.42%) might be attributable to differences in farming practices, milking procedures, and the scale of production. Cows are generally raised in larger numbers and under more intensive farming conditions than sheep, particularly in dairy farming, which can increase the risk of contamination. As reported by Smith et al. [82], raw milk from cows can be a significant source of E. coli, particularly when hygiene practices are not rigorously maintained.
Of the 33 pasteurized milk samples tested, only one was positive for E. coli. This finding highlights the presence of E. coli in pasteurized milk. While pasteurization usually destroys most E. coli isolates in milk., studies like those of da Silva et al. (2001) [83] have reported prevalence rates as high as 40% in Brazil, demonstrating that contamination can occur under certain conditions. Indeed, inadequate pasteurization and/or post-pasteurization contamination from contaminated equipment or improper storage conditions can result in contaminated pasteurized milk, which may then act as a vehicle for transmitting diarrheagenic E. coli to consumers.

4.2. Occurrence of E. coli O157:H7

The findings on E. coli O157:H7 prevalence across human, animal, and animal product samples in Kirkuk align closely with previous studies in the Middle East and North Africa (MENA) region, where the prevalence varies widely by country and sample type [84].
In this study, the high prevalence of E. coli O157:H7 was found in human samples, particularly from diarrheal patients (21.33%). This result is much higher than the prevalence rates reported in different research. A lower prevalence of E. coli O157:H7 was reported in Egypt at 11% [85], while studies in Iran [86] and Nigeria showed rates of approximately 2% [87]. Shah et al. [88] from Kenya also indicated a low prevalence of 0.2% among hospitalized children with diarrhea. Research in Poland by Heiman et al. [89] did not detect E. coli O157:H7 in children with gastroenteritis, and a similar study in Italy by Muloi et al. [90] found no cases among 606 diarrhea samples. Conversely, a high prevalence of 50% was reported among children with acute diarrhea in Ethiopia [91].
These findings highlight the significant presence of E. coli O157:H7 in diarrheal patients and emphasize the need for surveillance and control measures to prevent outbreaks.
The examination of the collected fecal samples revealed that the occurrences of E. coli serotype O157 in cows, sheep, and goats were 2.85%, 2.85%, and 3.3%. This observed E. coli O157:H7 prevalence is in agreement with previous studies carried out in countries where the prevalences of E. coli O157:H7 were reported to be from <1 to 5% [88,89,90,91,92,93,94]. Isolating E. coli O157:H7 from feces is considered crucial for epidemiological insights. Since cattle typically excrete 20 to 50 kg of feces daily, this can introduce significant inoculums of E. coli O157:H7 into the farm environment, posing a risk of raw milk contamination [95].
Raw milk samples have been examined in several countries for the presence of E. coli O157:H7. In our study, E. coli O157:H7 was detected in 5.88% of raw milk samples. This rate closely aligns with the findings from Saudi Arabia, where a prevalence of 4.81% was reported [96]. Conversely, a study in Syria revealed a higher prevalence of 30.9% (34 out of 110 samples) [97]. Other studies show even greater variability; for instance, Iraq reported a range of 0.44% to 51.54% [84], indicating that some regions may have much higher rates of contamination. Two studies conducted in Turkey, meanwhile, report a prevalence rate of 0% [98,99], revealing no cases of E. coli O157:H7 in their raw milk samples. Additionally, the prevalence of E. coli O157:H7 was found to range from 0% to 1.04% in Iran, while a prevalence range of 0% to 6.9% was reported in Egypt [84]. These figures are both lower than the rates observed in our study. This overall comparison highlights the diverse prevalence of E. coli O157:H7 across various countries.
Contaminated milk, therefore, could act as a vector for the transmission of the E. coli O157:H7 serotype, particularly when inadequate heat treatment is applied during milk processing. For instance, fecal contamination in milking areas poses a potential concern that is intensified by poor hygiene practices.
The prevalence of E. coli O157:H7 in beef hamburgers varies across different regions and studies. In comparison to our study, which reported a prevalence of 8.57% (3/35), several studies show lower rates. For instance, studies conducted in both Turkey [100] and Greece [101] reported no cases of E. coli O157:H7.
The absence of E. coli O157:H7 in these regions could indeed be influenced by the dietary practices, such as the consumption of well-cooked meats, which would reduce the risk of infection. Additionally, the low incidence of E. coli O157:H7 in farm animals, coupled with their very low carriage rates, further minimizes the risk of contamination. The susceptibility of local E. coli strains to commonly used antibiotics may also play a significant role in limiting the spread of these pathogens.
Another study from Egypt found a prevalence of 3.33% [102]. Conversely, the prevalence in Saudi Arabia was slightly higher than in our study and was reported to be 10% [103]. In Iran, a variable prevalence ranging from 8% to 18% was observed among different types of hamburger samples, which aligns with our findings [104,105,106]. In contrast, the highest prevalence was reported in Libya, with a notable rate of 27.1% [107].
The variation in the prevalence rates of E. coli O157:H7 isolates in different studies may be caused by different samples, natural sources, the year, the employed techniques, seasonal effects, and/or the use of different laboratory methods [108]. The variation in prevalence rates highlights the complexity of tracking E. coli O157:H7, while its zoonotic potential emphasizes the need to understand the transmission pathways to create effective prevention and control strategies.

4.3. Antimicrobial Susceptibility Testing of E. coli O157:H7 Strains

In our study, we observed significant resistance among the E. coli O157:H7 strains, with tetracycline exhibiting an 85.71% resistance rate. This result is consistent with findings from Iran, where Momtaz et al. [109] reported an 86.88% resistance rate, and Ranjbar et al. [73] noted an even higher resistance at 96.87%. In Ethiopia, Welde et al. [110] and Ababu et al. [23] reported lower resistance rates of 77.8% and 63.3%, respectively. Conversely, several studies indicated high sensitivity to tetracycline. Bedasa et al. [111] reported a sensitivity rate of 97.5% in Bishoftu town. Additionally, Haile et al. [112], Bekele et al. [113], and Osaili et al. [114] found 100% sensitivity in Jimma, Addis Ababa, and Amman City, Jordan, respectively.
For ampicillin, our results indicated a 75.00% resistance rate. This is significantly different from the findings of Ranjbar et al. [73], who reported 100% resistance to ampicillin among their strains, suggesting a particularly high prevalence of resistance in their region. Conversely, several studies, including those by Abebe et al. [32], Reuben and Owuna [115], and Osaili et al. [114], reported 100% susceptibility to ampicillin.
Our isolates exhibited 71.43% resistance to sulfamethoxazole, compared to the 54.54% resistance reported by Ababu et al. [23].
For streptomycin, we found a 67.86% resistance rate, which is higher than the 54.91% reported by Momtaz et al. [109] and the 45.45% observed by Ababu et al. [23] in their study.
In our study, the E. coli O157:H7 isolates showed complete sensitivity to gentamicin (100%); this finding is supported by Ababu et al. [23], who also reported 100% susceptibility. In contrast, Osaili et al. [114] found a slightly lower susceptibility rate of 88%, and Bedasa et al. [95] observed 82.5% sensitivity in Bishoftu town. However, opposing results were reported by Ranjbar et al. [73] and Ababu et al. [23], both of whom documented 100% resistance to gentamicin among their isolates. Mahanti et al. [116] noted an intermediate pattern, with 41.67% of isolates showing resistance.
In our study, 92.86% of the isolates showed sensitivity to ciprofloxacin. This finding is consistent with Ababu et al.’s [23] study, which reported 100% susceptibility to ciprofloxacin. Sensitivity rates vary across studies and regions. Bekele et al. [113] in Addis Ababa and Reuben and Owuna [115] in Nasarawa State, Nigeria, reported somewhat lower sensitivity rates of 76.5% and 78.9%, respectively. Osaili et al. [114] observed a further reduced sensitivity rate of 72.0% to ciprofloxacin. In contrast, Ranjbar et al. [73] in Iran documented 57.81% resistance to ciprofloxacin, showing a notable decline in susceptibility.
In our study, E. coli O157:H7 isolates exhibited a high sensitivity to ceftriaxone, with an 85.71% sensitivity rate. This result is largely in line with findings from other studies, including those by Bedasa et al. [111], Atnafie et al. [93], and Haile et al. [112], who reported 100% sensitivity to ceftriaxone among isolates in Bishoftu, Hawassa, and Jimma towns, respectively. Additionally, Osaili et al. [114] documented 96.0% sensitivity to ceftriaxone. This broad sensitivity to ceftriaxone across different regions suggests that it remains a reliable treatment option for E. coli O157:H7 infections, although slight variations may reflect localized resistance patterns.
Our study identified a 64.29% sensitivity rate to amikacin. This rate is slightly lower than that reported in other studies, such as that by Abebe et al. [32], who reported a 72.0% sensitivity rate, and Msolo et al. [117], who observed a 70.0% sensitivity rate to amikacin in South Africa. In contrast, Mahanti et al. [116] reported that 54.17% of isolates were resistant to amikacin.
These findings highlight the geographical variability in antibiotic resistance, suggesting that local practices in antibiotic use and environmental factors may significantly influence resistance patterns in E. coli O157:H7 isolates.

4.4. Detection of stx1, stx2, eaeA, and hlyA Genes in E. coli O157:H7 Isolates

Using single PCR assays, the presence of four virulence genes, stx1, stx2, eaeA, and hlyA, was assessed in the 28 E. coli O157:H7 isolates.
Our findings revealed five distinct virulence profiles (I–V) based on the presence or absence of specific virulence genes. The distribution of E. coli O157:H7 strains varied among these profiles, with some strains from different sources clustering within the same profile, while others from the same source were found in different profiles.
Some isolates from both the clinical samples (n = 6) and animal products (n = 2) exhibited a similar virulence gene profile (stx1+, stx2+, eaeA+, and hlyA+), indicating their pathogenic potential as E. coli O157:H7 strains capable of causing disease in humans [118,119].
Most of the O157 clinical isolates (10/17) were identified as stx1−/stx2+, corresponding to profile III. This finding contrasts with those of Bumunang et al. [119], who reported that the majority of E. coli O157:H7 clinical isolates were stx1+/stx2+
All the animal-derived strains examined in this study harbored the stx1 gene, while only 58.82% (7/17) of the clinical isolates possessed this gene. This observation aligns with the findings of Bumunang et al. [119], who reported that the absence of stx1 was more common in clinical isolates compared to cattle strains, suggesting a potential host-associated relationship.
All the human isolates tested carried the stx2 gene, which encodes Shiga toxin 2 (Stx2). Unlike Stx1, which has a lower association with human disease, Stx2 is more commonly linked to severe illnesses, like hemorrhagic colitis (HC) and hemolytic-uremic syndrome (HUS) [7].
In our isolates from animals, stx2 was not detected. Nevertheless, in the cases in which stx2 is detected within some animal isolates, it seems to not cause the systemic vascular problems seen in humans, as ruminants do not have receptors for Stx [120]. The asymptomatic carriage of STEC in the gastrointestinal tract of animals, especially ruminants like cattle, enables them to act as reservoirs for these bacteria [121]. Therefore, the continuous shedding of these pathogens into the environment facilitates the zoonotic transmission of STEC to humans, mainly through the consumption of contaminated food and water [122].
Other than stx genes, most STEC isolates with a stx1+/stx2+ or stx1−/stx2+ profile possessed adhesin and attachment virulence factors encoded by the LEE (locus of enterocyte effacement) pathogenicity island [123]. This pathogenicity island is an accessory set of virulence genes that enhances STEC pathogenicity in human disease [124].
STEC strains that simultaneously harbor genes for Stx production and LEE are classified as enterohemorrhagic Escherichia coli (EHEC) [10].
Adhesin proteins play a crucial role in the colonization and biofilm formation of EHEC on both abiotic and biological surfaces [12]. The initial attachment of EHEC to intestinal epithelial cells is mediated through the interaction between the pathogen’s long polar fimbriae (encoded by the lfp gene) and the host extracellular membrane proteins, like fibronectin, collagen IV, and laminin [125]. The attachment is further strengthened by the A/E effect resulting from interactions between intimin (encoded by the eae gene located on the LEE pathogenicity island) and the host cell receptors (Tir, nucleolin, and β1-integrins) [126]. This interaction enables EHEC to bind to and alter the intestinal epithelial lining. Other adhesion-related genes, including efa1 (EHEC factor for adherence 1), iha (IrgA homolog adhesin), paa (porcine A/E associated protein), and saa (STEC auto-agglutinating adhesin) have been reported [127,128]. Plasmid-associated virulence factors, including enterohemolysin (ehxA), catalase-peroxidase (katP), and serine protease (espP), also help STEC to colonize the human intestinal tract [82,129].
The hlyA gene was another gene studied in the present research. The product of this gene is hemolysin A, which is effective on eukaryotic cells and leads to erythrocyte lysis [106,130]. In our findings, the prevalence of the hlyA gene was 67.85% among strains from various sources. Similar prevalence rates have been reported in studies involving both human and animal samples [131,132].
The distribution of this gene among strains from various sources may be related to the fact that the hlyA gene is encoded by plasmids and can therefore be easily transferred among bacterial isolates [133].

5. Conclusions

The results of this study underline the significant risk posed by E. coli O157:H7 to public health, in both humans and animals, particularly in regions where consumption of raw or undercooked animal products is high. The presence of key virulence factors, such as stx1, stx2, eaeA, and hlyA in E. coli O157:H7 isolates further underlines the pathogenic potential of this strain, which contributes to serious diseases, such as hemorrhagic colitis and hemolytic uremic syndrome. High levels of antibiotic resistance underline the need for better surveillance, stricter food safety regulations, and prudent use of antibiotics in humans and animals. These findings underline the importance of ongoing surveillance and public health interventions to reduce the incidence of E. coli-related diseases and to enhance food safety in Kirkuk and similar areas.

Author Contributions

Conceptualization, H.A.A.A. and M.G.B.A.; methodology, H.A.A.A.; validation, R.G. and B.A.M.; formal analysis, H.A.A.A.; investigation, H.A.A.A.; writing—original draft preparation, H.A.A.A. and M.G.B.A.; writing—review and editing, M.G.B.A.; supervision, R.G. and B.A.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was approved by the Ethical Committee at Alkitab University, Kirkuk, Iraq. The research adhered to ethical principles aimed at protecting animal well-being and human subjects, ensuring confidentiality, and respecting cultural sensitivities specific to Iraq.

Informed Consent Statement

Informed consent was taken from adults as well as from parents of children before enrolment in the study. With the consent of the field owners, non-invasive sampling of the animals was carried out in order to minimize stress and preserve their well-being.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

This study was conducted in the Department of Medical Laboratory Techniques, College of Medical Technology, Alkitab University. The authors would like to thank the staff for their logistic support and their help with the sampling.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Allocati, N.; Masulli, M.; Alexeyev, M.F.; Di Ilio, C. Escherichia coli in Europe: An overview. Int. J. Environ. Res. Public Health 2013, 10, 6235–6254. [Google Scholar] [CrossRef]
  2. Adzitey, F. Antibiotic Resistance of Escherichia coli Isolated from Beef and its Related Samples in Techiman Municipality of Ghana. Asian J. Anim. Sci. 2015, 9, 233–240. [Google Scholar] [CrossRef]
  3. Stromberg, Z.R.; Goor, A.V.; Redweik, G.A.J.; Brand, M.J.W.; Wannemuehler, M.J.; Mellata, M. Pathogenic and Non-Pathogenic Escherichia coli Colonization and Host Inflammatory Response in a Defined Microbiota Mouse Model. Dis. Model Mech. 2018, 11, dmm035063. [Google Scholar] [CrossRef] [PubMed]
  4. Collins, J.; Tack, D.; Pindyck, T.; Griffin, P. Escherichia coli, Diarrheagenic. Centre for Disease Control and Prevention. Available online: https://wwwnc.cdc.gov/travel/yellowbook/2024/infections-diseases/escherichia-coli-diarrheagenic (accessed on 20 December 2024).
  5. Lee, W.; Kim, M.-H.; Sung, S.; Kim, E.; An, E.S.; Kim, S.H.; Kim, S.H.; Kim, H.-Y. Genome-Based Characterization of Hybrid Shiga Toxin-Producing and Enterotoxigenic Escherichia coli (STEC/ETEC) Strains Isolated in South Korea, 2016–2020. Microorganisms 2023, 11, 1285. [Google Scholar] [CrossRef]
  6. Croxen, M.A.; Finlay, B.B. Molecular mechanisms of Escherichia coli pathogenicity. Nat. Rev. Microbiol. 2010, 8, 26–38. [Google Scholar] [CrossRef]
  7. Melton-Celsa, A.R. Shiga toxin (Stx) classification, structure, and function. Microbiol. Spectr. 2014, 2, 10–1128. [Google Scholar] [CrossRef]
  8. Sandvig, K. Pathways Followed by Ricin and Shiga Toxin into Cells. Histochem. Cell Biol. 2002, 117, 131–141. [Google Scholar] [CrossRef]
  9. Dhaka, P.; Vijay, D.; Vergis, J.; Negi, M.; Kumar, M.; Mohan, V.; Doijad, S.; Poharkar, K.V.; Malik, S.S.; Barbuddhe, S.B.; et al. Genetic Diversity and Antibiogram Profile of Diarrhoeagenic Escherichia coli Pathotypes Isolated from Human, Animal, Foods, and Associated Environmental Sources. Infect. Ecol. Epidemiol. 2016, 6, 31055. [Google Scholar] [CrossRef] [PubMed]
  10. Fedorchuk, C. Enterohemhorrhagic Escherichia coli O157:H7 Initial Adherence Factors and the Role of the Polymeric Immunoglobulin Receptor during Adherence to Intestinal Epithelial Cells. Ph.D. Thesis, The Pennsylvania State University, University Park, PA, USA, 2018. [Google Scholar]
  11. Makhado, U.G.; Foka, F.E.T.; Tchatchouang, C.K.; Ateba, C.N.; Manganyi, M.C. Detection of virulence gene of Shiga toxin producing Escherichia coli (STEC) strains from animals with diarrhoea and water samples in the North-West Province, South Africa. Gene Rep. 2022, 27, 101617, ISSN 2452-0144. [Google Scholar] [CrossRef]
  12. Schwidder, M.; Heinisch, L.; Schmidt, H. Genetics, Toxicity, and Distribution of Enterohemorrhagic Escherichia coli Hemolysin. Toxins 2019, 11, 502. [Google Scholar] [CrossRef]
  13. Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef]
  14. Karch, H.; Tarr, P.I.; Bielaszewska, M. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol. 2005, 295, 405–418. [Google Scholar] [CrossRef] [PubMed]
  15. Iguchi, A.; Shirai, H.; Seto, K.; Ooka, T.; Ogura, Y.; Hayashi, T.; Osawa, R. Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli. PLoS ONE 2011, 6, e23250. [Google Scholar] [CrossRef] [PubMed]
  16. Goulart, D.B.; Mellata, M. Escherichia coli Mastitis in Dairy Cattle: Etiology, Diagnosis, and Treatment Challenges. Front. Microbiol. 2022, 13, 928346. [Google Scholar] [CrossRef]
  17. Rangel, J.M.; Sparling, P.H.; Crowe, C.; Griffin, P.M.; Swerdlow, D.L. Epidemiology of Escherichia coli O157 Outbreaks, United States, 1982–2002. Emerg. Infect. Dis. 2005, 11, 603–609. [Google Scholar] [CrossRef]
  18. Albuqami, S.A.; Dawoud, T.M.; Moussa, I.M.; Elbehiry, A.; Alsubki, R.A.; Hemeg, H.A.; Alhaji, J.H. The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia. Appl. Sci. 2023, 13, 13037. [Google Scholar] [CrossRef]
  19. Collobert, J.-F.; Dorey, F.; Dieuleveux, V.; Quillien, N. Qualité bactériologique de surface de carcasses de bovins. Sci. Des. Aliment. 2002, 22, 327–334. [Google Scholar] [CrossRef]
  20. Niyonzima, E.; Ongol, M.P.; Kimonyo, A.; Sindic, M. Risk Factors and Control Measures for Bacterial Contamination in the Bovine Meat Chain: A Review on Salmonella and Pathogenic E. coli. J. Food Res. 2015, 4, 98. [Google Scholar] [CrossRef]
  21. Verraes, C.; Vlaemynck, G.; Van Weyenberg, S.; De Zutter, L.; Daube, G.; Sindic, M.; Uyttendaele, M.; Herman, L. A review of the microbiological hazards of dairy products made from raw milk. Int. Dairy J. 2015, 50, 32–44. [Google Scholar] [CrossRef]
  22. Owusu-Kwarteng, J.; Akabanda, F.; Agyei, D.; Jespersen, L. Microbial safety of milk production and fermented dairy products in Africa. Microorganisms 2020, 8, 752. [Google Scholar] [CrossRef]
  23. Ababu, A.; Endashaw, D.; Fesseha, H. Isolation and antimicrobial susceptibility profile of Escherichia coli O157:H7 from raw milk of dairy cattle in Holeta district, Central Ethiopia. Int. J. Microbiol. 2020, 2020, 6626488. [Google Scholar] [CrossRef]
  24. Pakdel, M.; Olsen, A.; Bar, E.M.S. A review of food contaminants and their pathways within food processing facilities using open food processing equipment. J. Food Prot. 2023, 86, 100184. [Google Scholar] [CrossRef]
  25. Luna, S. Outbreak of E. coli O157 Infections Associated with Exposure to Animal Manure in a Rural Community—Arizona and Utah, June–July 2017. MMWR Morb. Mortal. Wkly. Rep. 2018, 67, 659–662. [Google Scholar] [CrossRef] [PubMed]
  26. Helke, K.L.; McCrackin, M.A.; Galloway, A.M.; Poole, A.Z.; Salgado, C.D.; Marriott, B.P. Effects of Antimicrobial Use in Agricultural Animals on Drug-Resistant Foodborne Salmonellosis in Humans: A Systematic Literature Review. Crit. Rev. Food Sci. Nutr. 2017, 57, 472–488. [Google Scholar] [CrossRef]
  27. Pornsukarom, S.; van Vliet, A.H.; Thakur, S. Whole Genome Sequencing Analysis of Multiple Salmonella Serovars Provides Insights into Phylogenetic Relatedness, Antimicrobial Resistance, and Virulence Markers Across Humans, Food Animals, and Agricultural Environmental Sources. BMC Genom. 2018, 19, 801. [Google Scholar] [CrossRef]
  28. Goncuoglu, M.; Bilir Ormanci, F.S.; Ayaz, N.D.; Erol, I. Antibiotic Resistance of Escherichia coli O157 Isolated from Cattle and Sheep. Ann. Microbiol. 2010, 60, 489–494. [Google Scholar] [CrossRef]
  29. Haile, A.F.; Alonso, S.; Berhe, N.; Atoma, T.B.; Boyaka, P.N.; Grace, D. Prevalence, Antibiogram, and Multidrug-Resistant Profile of E. coli O157 in Retail Raw Beef in Addis Ababa, Ethiopia. Front. Vet. Sci. 2022, 9, 734896. [Google Scholar] [CrossRef]
  30. Quinn, P.J.; Markey, B.K.; Carter, M.E.; Donnelly, W.J.; Leonard, F.C. Veterinary Microbiology and Microbial Disease; Blackwell Science Ltd.: Malden, MA, USA, 2002; pp. 465–475. [Google Scholar]
  31. Harrigan, W.F.; McCance, M.E. Laboratory Methods in Microbiology; Academic Press: London, UK, 2014. [Google Scholar]
  32. Abebe, E.; Gugsa, G.; Ahmed, M.; Awol, N.; Tefera, Y.; Abegaz, S.; Sisay, T. Occurrence and Antimicrobial Resistance Pattern of E. coli O157 isolated from Foods of Bovine Origin in Dessie and Kombolcha Towns, Ethiopia. PLoS Negl. Trop. Dis. 2023, 17, e0010706. [Google Scholar] [CrossRef] [PubMed]
  33. Abdulmajeed, M.A.; Jafar, N.B.; Hamada, Y.H. Investigation and Molecular Characterization of Shiga Toxin-Producing E. coli O157 from Meat and Dairy Products in Kirkuk Province, Iraq. J. Hyg. Eng. Des. 2023, 42, 65–74. [Google Scholar]
  34. Approved Standard M100-S13; Performance Standards for Antimicrobial Disk Susceptibility Testing. 13th Informational Supplement. National Committee for Clinical Laboratory Standards (NCCLS): Wayne, PA, USA, 2012.
  35. CLSI Document M100-S25; Performance Standards for Antimicrobial Susceptibility Testing. Twenty-Fifth Informational Supplement. Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2015.
  36. Basavaraju, M.; Gunashree, B.S. Escherichia coli: An Overview of Main Characteristics. In Escherichia coli; IntechOpen: London, UK, 2022; p. 21. [Google Scholar] [CrossRef]
  37. Meng, J.; LeJeune, J.T.; Zhao, T.; Doyle, M.P. Enterohemorrhagic Escherichia coli. In Food Microbiology: Fundamentals and Frontiers; ASM Press: Washington, DC, USA, 2012; pp. 287–309. [Google Scholar]
  38. Okeke, I.N.; Lamikanra, A.; Edelman, R. Socioeconomic and Behavioral Factors Leading to Acquired Bacterial Resistance to Antibiotics in Developing Countries. Emerg. Infect. Dis. 1999, 5, 18. [Google Scholar] [CrossRef] [PubMed]
  39. Robert, E.; Grippa, M.; Nikiema, D.E.; Kergoat, L.; Koudougou, H.; Auda, Y.; Rochelle-Newall, E. Environmental Determinants of E. coli, Link with Diarrheal Diseases, and Vulnerability Criteria in Tropical West Africa (Kapore, Burkina Faso). PLoS Negl. Trop. Dis. 2021, 15, e0009634. [Google Scholar] [CrossRef]
  40. Nji, E.; Kazibwe, J.; Hambridge, T.; Joko, C.A.; Larbi, A.A.; Damptey, L.A.O.; Nkansa-Gyamfi, N.A.; Stålsby Lundborg, C.; Lien, L.T.Q. High Prevalence of Antibiotic Resistance in Commensal Escherichia coli from Healthy Human Sources in Community Settings. Sci. Rep. 2021, 11, 3372. [Google Scholar] [CrossRef] [PubMed]
  41. Abdulmajeed, M.A.; Jafar, N.B.; Hamada, Y.H. Isolation and Identification of E. coli O157 Strains Among Diarrheal Samples in Relation with the Presence of Stx1, Stx2, Hlya, and Eaea Genes. HIV Nurs. 2022, 22, 2799–2806. [Google Scholar]
  42. Dah-Nouvlessounon, D.; Sina, H.; Yakoubou, A.; Boya, B.; Azatassou, S.; N’tcha, C.; Noumavo, A.D.P.; Assouma, F.F.; Adjanohoun, A.; Baba-Moussa, L. Potential Pathogenicity of Escherichia coli Isolated from the Stools of Healthy Children Suffering from Diarrhea Admitted to Hospitals in Southern Benin. J. Adv. Microbiol. 2023, 23, 15–29. [Google Scholar] [CrossRef]
  43. Jabur, S.G.; Abed, M.H. Genetic Survey of Enteroaggregative E. coli in Diarrheic Children Under 5 Years in Thi-Qar Governorate. Indian J. Forensic Med. Toxicol. 2020, 14, 1434–1439. [Google Scholar]
  44. Mulu, B.M.; Belete, M.A.; Demlie, T.B.; Tassew, H.; Sisay Tessema, T. Characteristics of Pathogenic Escherichia coli Associated with Diarrhea in Children Under Five Years in Northwestern Ethiopia. Trop. Med. Infect. Dis. 2024, 9, 65. [Google Scholar] [CrossRef] [PubMed]
  45. Shine, S.; Muhamud, S.; Adanew, S.; Demelash, A.; Abate, M. Prevalence and Associated Factors of Diarrhea Among Under-Five Children in Debre Berhan Town, Ethiopia, 2018: A Cross-Sectional Study. BMC Infect. Dis. 2020, 20, 174. [Google Scholar] [CrossRef]
  46. Dev, R.; Williams-Nguyen, J.; Adhikari, S.P.; Dev, U.; Deo, S.; Hillan, E. Impact of Maternal Decision-Making Autonomy and Self-Reliance in Accessing Health Care on Childhood Diarrhea and Acute Respiratory Tract Infections in Nepal. Public Health 2021, 198, 89–95. [Google Scholar] [CrossRef] [PubMed]
  47. Keto, T.; Alemu, Y.; Mamo, A. Mothers’ Perception and Management Preference of Acute Diarrheal Disease. Int. J. Public Health 2020, 9, 338–346. [Google Scholar] [CrossRef]
  48. Sarker, A.R.; Sultana, M.; Mahumud, R.A.; Ali, N.; Huda, T.M.; Uzzaman, M.S.; Haider, S.; Rahman, H.; Islam, Z.; Khan, J.A.M.; et al. Economic Costs of Hospitalized Diarrheal Disease in Bangladesh: A Societal Perspective. Glob. Health Res. Policy 2018, 3, 1–12. [Google Scholar] [CrossRef]
  49. World Health Organization (WHO). Nurturing Care for Early Childhood Development: A Framework for Helping Children Survive and Thrive to Transform Health and Human Potential; WHO: Geneva, Switzerland, 2018.
  50. Tadesse, A.; Walelign Fentaye, F.; Mekonen, A.M.; et Yasine, T. The Impact of Ethiopian Community-Based Health Extension Program on Diarrheal Diseases Among Under-Five Children and Factors Associated with Diarrheal Diseases in the Rural Community of Kalu District, Northeast Ethiopia: A Cross-Sectional Study. BMC Health Serv. Res. 2022, 22, 168. [Google Scholar] [CrossRef]
  51. Angasu, K.; Dame, K.T.; Negash, A. Diarrheal Morbidity and Associated Factors Among Under-Five Children in Southwest Ethiopia. Research Square 2022. [Google Scholar] [CrossRef]
  52. Blanco, M.; Blanco, J.E.; Mora, A.; Rey, J.; Alonso, J.M.; Hermoso, M.; Hermoso, J.; Alonso, M.P.; Dahbi, G.; González, E.A.; et al. Serotypes, Virulence Genes, and Intimin Types of Shiga Toxin (Verotoxin)-Producing Escherichia coli Isolates from Healthy Sheep in Spain. J. Clin. Microbiol. 2003, 41, 1351–1356. [Google Scholar] [CrossRef] [PubMed]
  53. Iweriebor, B.C.; Iwu, C.J.; Obi, L.C.; Nwodo, U.U.; Okoh, A.I. Multiple Antibiotic Resistances Among Shiga Toxin-Producing Escherichia coli O157 in Feces of Dairy Cattle Farms in Eastern Cape of South Africa. BMC Microbiol. 2015, 15, 213. [Google Scholar] [CrossRef] [PubMed]
  54. Renter, D.G.; Sargeant, J.M.; Oberst, R.D.; Samadpour, M. Diversity, Frequency, and Persistence of Escherichia coli O157 Strains from Range Cattle Environments. Appl. Environ. Microbiol. 2003, 69, 542–547. [Google Scholar] [CrossRef] [PubMed]
  55. Tabaran, A.; Soulageon, V.; Chirila, F.; Reget, O.L.; Mihaiu, M.; Borzan, M.; Dan, S.D. Pathogenic E. coli from Cattle as a Reservoir of Resistance Genes to Various Groups of Antibiotics. Antibiotics 2022, 11, 404. [Google Scholar] [CrossRef] [PubMed]
  56. Bibbal, D.; Loukiadis, E.; Kérourédan, M.; Ferré, F.; Dilasser, F.; Peytavin de Garam, C.; Cartier, P.; Oswald, E.; Gay, E.; Auvray, F.; et al. Prevalence of Carriage of Shiga Toxin-Producing Escherichia coli Serotypes O157, O26, O103, O111, and O145 Among Slaughtered Adult Cattle in France. Appl. Environ. Microbiol. 2015, 81, 1397–1405. [Google Scholar] [CrossRef] [PubMed]
  57. Hale, C.R.; Scallan, E.; Cronquist, A.B.; Dunn, J.; Smith, K.; Robinson, T.; Lathrop, S.; Tobin-D’Angelo, M.; Clogher, P. Estimates of Enteric Illness Attributable to Contact with Animals and Their Environments in the United States. Clin. Infect. Dis. 2012, 54, S472–S479. [Google Scholar] [CrossRef]
  58. Beutin, L. Emerging Enterohaemorrhagic Escherichia coli, Causes and Effects of the Rise of a Human Pathogen. J. Vet. Med. Series B 2006, 53, 299–305. [Google Scholar] [CrossRef]
  59. Campos, J.; Gil, J.; Mourão, J.; Peixe, L.; Antunes, P. Ready-to-Eat Street-Vended Food as a Potential Vehicle of Bacterial Pathogens and Antimicrobial Resistance: An Exploratory Study in Porto Region, Portugal. Int. J. Food Microbiol. 2015, 206, 1–6. [Google Scholar] [CrossRef]
  60. Zelalem, A.; Sisay, M.; Vipham, J.L.; Abegaz, K.; Kebede, A.; Terefe, Y. The Prevalence and Antimicrobial Resistance Profiles of Bacterial Isolates from Meat and Meat Products in Ethiopia: A Systematic Review and Meta-Analysis. Int. J. Food Contam. 2019, 6, 1. [Google Scholar] [CrossRef]
  61. Abdel-Atty, N.S.; Abdulmalek, E.M.; Taha, R.M.; Hassan, A.H.; Adawy, A.A. Predominance and Antimicrobial Resistance Profiles of Salmonella and E. coli from Meat and Meat Products. J. Adv. Vet. Res. 2023, 13, 647–655. [Google Scholar]
  62. Rajaei, M.; Moosavy, M.H.; Gharajalar, S.N.; Khatibi, S.A. Antibiotic Resistance in the Pathogenic Foodborne Bacteria Isolated from Raw Kebab and Hamburger: Phenotypic and Genotypic Study. BMC Microbiol. 2021, 21, 272. [Google Scholar] [CrossRef]
  63. Adzitey, F. Incidence and Antimicrobial Susceptibility of Escherichia coli Isolated from Beef (Meat Muscle, Liver, and Kidney) Samples in Wa Abat Toir, Ghana. Cogent Food Agric. 2020, 6, 1718269. [Google Scholar] [CrossRef]
  64. González Gutiérrez, M.; García Fernández, C.; Alonso Calleja, C.; Capita, R. Microbial Load and Antibiotic Resistance in Raw Beef Preparations from Northwest Spain. Food Sci. Nutr. 2020, 8, 777–785. [Google Scholar] [CrossRef]
  65. Eisel, W.; Linton, R.; Muriana, P. A survey of microbial levels for incoming raw beef, environmental sources, and ground beef in a red meat processing plant. Food Microbiol. 1997, 14, 273–282. [Google Scholar] [CrossRef]
  66. Sulieman, A.M.E.; Abu Zeid, I.M.; Haddad, A. Contamination of Halal Beef Carcasses by Bacteria That Grow or Survive During Cold Storage. In Halal and Kosher Food: Integration of Quality and Safety for Global Market Trends; Springer: Berlin/Heidelberg, Germany, 2023; pp. 201–214. [Google Scholar]
  67. Korkmaz, B.; Maaz, D.; Reich, F.; Gremse, C.; Haase, A.; Mateus-Vargas, R.H.; Mader, A.; Rottenberger, I.; Schafft, H.A.; Bandick, N. Cause and effect analysis between influencing factors related to environmental conditions, hunting and handling practices, and the initial microbial load of game carcasses. Foods 2022, 11, 3726. [Google Scholar] [CrossRef] [PubMed]
  68. Nastasijevic, I.; Boskovic, M.; Glisic, M. Abattoir hygiene. In Present Knowledge in Food Safety; Elsevier: Amsterdam, The Netherlands, 2023; pp. 412–438. [Google Scholar]
  69. Kelbert, L.; Stephan, R. Knife Decontamination by Cold Water Treatment Supplemented with InspexxTM 210—A Validation Study in an Abattoir. Hygiene 2023, 3, 248–255. [Google Scholar] [CrossRef]
  70. Hauge, S.J.; Nafstad, O.; Røtterud, O.-J.; Nesbakken, T. The hygienic impact of categorisation of cattle by hide cleanliness in the abattoir. Food Control 2012, 27, 100–107. [Google Scholar] [CrossRef]
  71. Antic, D.; Houf, K.; Michalopoulou, E.; Blagojevic, B. Beef abattoir interventions in a risk-based meat safety assurance system. Meat Sci. 2021, 182, 108622. [Google Scholar] [CrossRef]
  72. Adebowale, O.; Alonge, D.; Agbede, S.; Adeyemo, O. Bacteriological assessment of quality of water used at the Bodija municipal abattoir, Ibadan, Nigeria. Sahel J. Vet. Sci. 2010, 9, 63–67. [Google Scholar]
  73. Ranjbar, R.; Dehkordi, F.S.; Shahreza, M.H.S.; Rahimi, E. Prevalence, identification of virulence factors, O-sero groups and antibiotic resistance properties of shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products. Antimicrob. Resist. Infect. Control 2018, 7, 53. [Google Scholar] [CrossRef]
  74. Ombarak, R.A.; Hinenoya, A.; Awasthi, S.P.; Iguchi, A.; Shima, A.; Elbagory, A.R.M.; Yamasaki, S. Prevalence and Pathogenic Potential of Escherichia coli Isolates from Raw Milk and Raw Milk Cheese in Egypt. Int. J. Food Microbiol. 2016, 221, 69–76. [Google Scholar] [CrossRef]
  75. Stephan, R.; Schumacher, S.; Corti, S.; Krause, G.; Danuser, J.; Beutin, L. Prevalence and Characteristics of Shiga Toxin Producing Escherichia coli in Swiss Raw Milk Cheeses Collected at Producer Level. J. Dairy Sci. 2008, 91, 2561–2565. [Google Scholar] [CrossRef]
  76. Mohammadi, P.; Abiri, R.; Rezaei, M.; Salmanzadeh Ahrabi, S. Isolation of Shiga Toxin-Producing Escherichia coli from Raw Milk in Kermanshah, Iran. Iran. J. Microbiol. 2013, 5, 233. [Google Scholar]
  77. Nobili, G.; Franconieri, I.; Basanisi, M.G.; La Bella, G.; Tozzoli, R.; Caprioli, A.; La Salandra, G. Isolation of Shiga Toxin-Producing Escherichia coli in Raw Milk and Mozzarella Cheese in Southern Italy. J. Dairy Sci. 2016, 99, 7877–7880. [Google Scholar] [CrossRef] [PubMed]
  78. Zeinhom, M.M.A.; Abdel-Latef, G.K. Public Health Risk of Some Milk-Borne Pathogens. Beni-Suef Univ. J. Basic Appl. Sci. 2014, 3, 209–215. [Google Scholar] [CrossRef]
  79. Öksüz, Ö.; Arici, M.; Kurultay, S.; Gümüs, T. Incidence of Escherichia coli O157 in Raw Milk and White Pickled Cheese Manufactured from Raw Milk in Turkey. Food Control 2004, 15, 453–456. [Google Scholar] [CrossRef]
  80. Xi, M.; Feng, Y.; Li, Q.; Yang, Q.; Zhang, B.; Li, G.; Shi, C.; Xia, X. Prevalence, Distribution, and Diversity of Escherichia coli in Plants Manufacturing Goat Milk Powder in Shaanxi, China. J. Dairy Sci. 2015, 98, 2260–2267. [Google Scholar] [CrossRef] [PubMed]
  81. Quinto, E.J.; Cepeda, A. Incidence of Toxigenic Escherichia coli in Soft Cheese Made with Raw or Pasteurized Milk. Lett. Appl. Microbiol. 1997, 24, 291–295. [Google Scholar] [CrossRef] [PubMed]
  82. Smith, J.L.; Fratamico, P.M.; Gunther, N.W., IV. Shiga Toxin-Producing Escherichia coli. Adv. Appl. Microbiol. 2014, 86, 145–197. [Google Scholar]
  83. da Silva, Z.N.; da Cunha, A.S.; Lins, M.C.; Carneiro, L.D.A.; Almeida, A.C.D.F.; Queiroz, M.L. Isolation and Serological Identification of Enteropathogenic Escherichia coli in Pasteurized Milk in Brazil. Revista de Saúde Pública 2001, 35, 375–379. [Google Scholar] [CrossRef] [PubMed]
  84. Jaradat, Z.W.; Abulaila, S.; Al-Rousan, E.; Ababneh, Q.O. Prevalence of Escherichia coli O157 in Foods in the MENA Region Between Years 2000 and 2022: A Review. Arab J. Basic Appl. Sci. 2024, 31, 104–120. [Google Scholar] [CrossRef]
  85. Abdel-Aziz, M.A.; Eid, R.A. Detection of Escherichia coli O157 from Patients with Gastroenteritis. Egypt. J. Med. Microbiol. 2024, 33, 145–152. [Google Scholar] [CrossRef]
  86. Bonyadian, M.; Haidari, F.I.; Sami, M. Virulence Genes and Pulsed-Field Gel Electrophoresis Profiles of Shiga Toxin-Producing Escherichia coli Isolated from Different Food Samples and Patients with Acute Diarrhea. Iran. J. Microbiol. 2024, 16, 329–336. [Google Scholar] [CrossRef] [PubMed]
  87. Esumeh, F.; Isibor, J.; Egbagbe, I. Screening for E. coli O157 in Diarrheic Patients in Zarya City, Nigeria. J. Microbiol. Biotech. Res. 2011, 1, 1–4. [Google Scholar]
  88. Shah, M.; Kathiiko, C.; Wada, A.; Odoyo, E.; Bundi, M.; Miringu, G.; Guyo, S.; Karama, M.; Ichinose, Y. Prevalence, Seasonal Variation, and Antibiotic Resistance Pattern of Enteric Bacterial Pathogens Among Hospitalized Diarrheic Children in Suburban Regions of Central Kenya. Trop. Med. Health 2016, 44, 39. [Google Scholar] [CrossRef]
  89. Heiman, K.E.; Mody, R.K.; Johnson, S.D.; Griffin, P.M.; Gould, L.H. Escherichia coli O157 Outbreaks in the United States, 2003–2012. Emerg. Infect. Dis. 2015, 21, 1293. [Google Scholar] [CrossRef] [PubMed]
  90. Muloi, D.M.; Hassell, J.M.; Wee, B.A.; Ward, M.J.; Bettridge, J.M.; Kivali, V.; Kiyong’a, A.; Ndinda, C.; Gitahi, N.; Ouko, T.; et al. Genomic Epidemiology of Escherichia coli: Antimicrobial Resistance Through a One Health Lens in Sympatric Humans, Livestock, and Peri-Domestic Wildlife in Nairobi, Kenya. BMC Med. 2022, 20, 471. [Google Scholar] [CrossRef]
  91. Adugna, A.; Kibret, M.; Abera, B.; Nibret, E.; Adal, M. Antibiogram of E. coli Serotypes Isolated from Children Aged Under Five with Acute Diarrhea in Bahir Dar Town. Afr. Health Sci. 2015, 15, 656–664. [Google Scholar] [CrossRef]
  92. Sanchez, S.; Lee, M.D.; Harmon, B.G.; Maurer, J.J.; Doyle, M.P. Animal Issues Associated with Escherichia coli O157. J. Am. Vet. Med. Assoc. 2002, 221, 1122–1126. [Google Scholar] [CrossRef]
  93. Atnafie, B.; Paulos, D.; Abera, M.; Tefera, G.; Hailu, D.; Kasaye, S.; Amenu, K. Occurrence of Escherichia coli O157 in Cattle Feces and Contamination of Carcass and Various Contact Surfaces in Abattoir and Butcher Shops of Hawassa, Ethiopia. BMC Microbiol. 2017, 17, 24. [Google Scholar] [CrossRef]
  94. Mesele, F.; Leta, S.; Amenu, K.; Abunna, F. Occurrence of Escherichia coli O157 in Lactating Cows and Dairy Farm Environment and the Antimicrobial Susceptibility Pattern at Adami Tulu Jido Kombolcha District, Ethiopia. BMC Vet. Res. 2023, 19, 6. [Google Scholar] [CrossRef] [PubMed]
  95. Matthews, R.; Sapers, M.; Gerba, P. The Produce Contamination Problem: Causes and Solutions, 2nd ed.; Elsevier: London, UK, 2014; ISBN 978-0-12-404611-5. [Google Scholar]
  96. Al-Zogibi, O.G.; Mohamed, M.I.; Hessain, A.M.; El-Jakee, J.K.; Kabli, S.A. Molecular and Serotyping Characterization of Shiga Toxogenic Escherichia coli Associated with Food Collected from Saudi Arabia. Saudi J. Biol. Sci. 2015, 22, 438–442. [Google Scholar] [CrossRef]
  97. Daood, N. Detection and Antimicrobial Susceptibility of E. coli O157 in Raw Bovine Milk, Some Dairy Products and Water Samples. Damascus Univ. J. Basic Sci. 2007, 23, 21–35. [Google Scholar]
  98. Gökmen, M.; İlhan, Z.; Tavşanlı, H.; Önen, A.; Ektik, N.; Göçmez, E.B. Prevalence and Molecular Characterization of Shiga Toxin-Producing Escherichia coli in Animal Source Foods and Green Leafy Vegetables. Food Sci. Technol. Int. 2024, 30, 30–36. [Google Scholar] [CrossRef] [PubMed]
  99. Sancak, Y.C.; Sancak, H.; Isleyici, O. Presence of Escherichia coli O157 and O157 in Raw Milk and Van Herby Cheese. Bull. Vet. Inst. Pulawy 2015, 59, 511–514. [Google Scholar] [CrossRef]
  100. Noveir, M.R.; Dogan, H.B.; Halkman, A.K. A Note on Escherichia coli O157 Serotype in Turkish Meat Products. Meat Sci. 2000, 56, 331–335. [Google Scholar] [CrossRef]
  101. Dontorou, C.; Papadopoulou, C.; Filioussis, G.; Economou, V.; Apostolou, I.; Zakkas, G.; Salamoura, A.; Kansouzidou, A.; Levidiotou, S. Isolation of Escherichia coli O157 from Foods in Greece. Int. J. Food Microbiol. 2003, 82, 273–279. [Google Scholar] [CrossRef] [PubMed]
  102. Sallam, K.I.; Mohammed, M.A.; Ahdy, A.M.; Tamura, T. Prevalence, Genetic Characterization and Virulence Genes of Sorbitol-Fermenting Escherichia coli O157:H- and E. coli O157 Isolated from Retail Beef. Int. J. Food Microbiol. 2013, 165, 295–301. [Google Scholar] [CrossRef] [PubMed]
  103. Hessain, A.M.; Al-Arfaj, A.A.; Zakri, A.M.; El-Jakee, J.K.; Al-Zogibi, O.G.; Hemeg, H.A.; Ibrahim, I.M. Molecular Characterization of Escherichia coli O157 Recovered from Meat and Meat Products Relevant to Human Health in Riyadh, Saudi Arabia. Saudi J. Biol. Sci. 2015, 22, 725–729. [Google Scholar] [CrossRef] [PubMed]
  104. Hosseini, S.; Ezzatpanah, H.; Aminlari, M.; Mazaheri, A.M. Investigating the Contamination of E. coli O157 in Processed Meat Products Produced in Two Factories at Shiraz and Tehran. J. Food Technol. Nutr. 2011, 8, 37–45. [Google Scholar]
  105. Miri, A.; Rahimi, E.; Mirlohi, M.; Mahaki, B.; Jalali, M.; Safaei, H.G. Isolation of Shiga Toxin-Producing Escherichia coli O157/NM from Hamburger and Chicken Nugget. Int. J. Environ. Health Eng. 2014, 3, 20. [Google Scholar]
  106. Sheikh, A.F.; Rostami, S.; Amin, M.; Abbaspour, A.; Goudarzi, H.; Hashemzadeh, M. Isolation and Identification of Escherichia coli O157 from Ground Beef Hamburgers in Khuzestan Province, Iran. Afr. J. Microbiol. Res. 2013, 7, 413–417. [Google Scholar]
  107. El Shrek, Y.M.; Madi, N.S.; El Bakoush, E.A.A.; El Tawil, A.M. Microbiological Studies of Spiced Beef Burgers in Tripoli City, Libyan Arab Jamahiriya. East. Mediterr. Health J. 2008, 14, 172–178. [Google Scholar]
  108. Ferens, W.A.; Hovde, C.J. Escherichia coli O157:H7: Animal Reservoir and Sources of Human Infection. Foodborne Pathog. Dis. 2011, 8, 465–487. [Google Scholar] [CrossRef]
  109. Momtaz, H.; Farzan, R.; Rahimi, E.; Safarpoor Dehkordi, F.; Souod, N. Molecular Characterization of Shiga Toxin-Producing Escherichia coli Isolated from Ruminant and Donkey Raw Milk Samples and Traditional Dairy Products in Iran. Sci. World J. 2012, 2012, 231342. [Google Scholar] [CrossRef] [PubMed]
  110. Welde, N.; Abunna, F.; Wodajnew, B. Isolation, identification, and antimicrobial susceptibility profiles of E. coli O157 from raw cow milk in and around Modjo Town, Ethiopia. J. Am. Sci. 2020, 16, 62–79. [Google Scholar]
  111. Bedasa, S.; Shiferaw, D.; Abraha, A.; Moges, T. Occurrence and antimicrobial susceptibility profile of Escherichia coli O157 from food of animal origin in Bishoftu town, central Ethiopia. Int. J. Food Contam. 2018, 5, 2. [Google Scholar] [CrossRef]
  112. Haile, F.A.; Kebede, D.; Wubshet, K.A. Prevalence and antibiogram of Escherichia coli O157 isolated from bovine in Jimma, Ethiopia: Abattoir-based survey. Ethiop. Vet. J. 2017, 21, 109–120. [Google Scholar] [CrossRef]
  113. Bekele, T.; Zewde, G.; Tefera, G.; Feleke, A.; Zerom, K. Escherichia coli O157 in raw meat in Addis Ababa, Ethiopia: Prevalence at an abattoir and retailers and antimicrobial susceptibility. Int. J. Food Contam. 2014, 1, 4. [Google Scholar] [CrossRef]
  114. Osaili, T.M.; Alaboudi, A.R.; Rahahlah, M. Prevalence and antimicrobial susceptibility of Escherichia coli O157 on beef cattle slaughtered in Amman abattoir. Meat Sci. 2013, 93, 463–468. [Google Scholar] [CrossRef]
  115. Reuben, R.C.; Owuna, G. Antimicrobial resistance patterns of Escherichia coli O157 from Nigerian fermented milk samples in Nasarawa State, Nigeria. Int. J. Pharm. Sci. Inven. 2013, 2, 38–44. [Google Scholar]
  116. Mahanti, A.; Samanta, I.; Bandopaddhay, S.; Joardar, S.N.; Dutta, T.K.; Batabyal, S.; Sar, T.K.; Isore, D.P. Isolation, molecular characterization and antibiotic resistance of Shiga Toxin-producing Escherichia coli (STEC) from buffalo in India. Lett. Appl. Microbiol. 2013, 56, 291–298. [Google Scholar] [CrossRef]
  117. Msolo, L.; Igbinosa, E.O.; Okoh, A.I. Prevalence and antibiogram profiles of Escherichia coli O157 isolates recovered from three selected dairy farms in the Eastern Cape Province, South Africa. Asian Pac. J. Trop. Dis. 2016, 6, 990–995. [Google Scholar] [CrossRef]
  118. Mashak, Z. Virulence genes and phenotypic evaluation of the antibiotic resistance of Vero toxin-producing Escherichia coli recovered from milk, meat, and vegetables. Jundishapur J. Microbiol. 2018, 11, e62288. [Google Scholar] [CrossRef]
  119. Bumunang, E.W.; Zaheer, R.; Stanford, K.; Laing, C.; Niu, D.; Guan, L.L.; Chui, L.; Tarr, G.A.M.; McAllister, T.A. Genomic analysis of Shiga toxin-producing E. coli O157 cattle and clinical isolates from Alberta, Canada. Toxins 2022, 14, 603. [Google Scholar] [CrossRef] [PubMed]
  120. Akomoneh, E.A.; Esemu, S.N.; Kfusi, J.; Ndip, R.N.; Ndip, L.M. Prevalence and virulence gene profiles of Escherichia coli O157 from cattle slaughtered in Buea, Cameroon. PLoS ONE 2020, 15, e0235583. [Google Scholar] [CrossRef] [PubMed]
  121. Irshad, H.; Ahsan, A.; Yousaf, A.; Kanchanakhan, N.; Pumpaibool, T.; Siriwong, W.; Salman, M. Genetic Diversity and Zoonotic Potential of Shiga Toxin-Producing E. coli (STEC) in Cattle and Buffaloes from Islamabad, Pakistan. Agriculture 2024, 14, 1537. [Google Scholar] [CrossRef]
  122. Sapountzis, P.; Segura, A.; Desvaux, M.; Forano, E. An Overview of the Elusive Passenger in the Gastrointestinal Tract of Cattle: The Shiga Toxin-Producing Escherichia coli. Microorganisms 2020, 8, 877. [Google Scholar] [CrossRef]
  123. Bai, X.; Zhang, J.; Hua, Y.; Jernberg, C.; Xiong, Y.; French, N.; Löfgren, S.; Hedenström, I.; Ambikan, A.; Mernelius, S.; et al. Genomic insights into clinical Shiga toxin-producing Escherichia coli strains: A 15-year period survey in Jönköping, Sweden. Front. Microbiol. 2021, 12, 627861. [Google Scholar] [CrossRef]
  124. Lee, W.; Ha, J.; Choi, J.; Jung, Y.; Kim, E.; An, E.S.; Kim, H.Y. Genetic and virulence characteristics of hybrid Shiga toxin-producing and atypical enteropathogenic Escherichia coli strains isolated in South Korea. Front. Microbiol. 2024, 15, 1398262. [Google Scholar] [CrossRef]
  125. Huang, C.-R.; Kuo, C.-J.; Huang, C.-W.; Chen, Y.-T.; Liu, B.-Y.; Lee, C.-T.; Chen, P.-L.; Chang, W.-T.; Chen, Y.-W.; Lee, T.-M. Host CDK-1 and formin mediate microvillar effacement induced by enterohemorrhagic Escherichia coli. Nat. Commun. 2021, 12, 90. [Google Scholar] [CrossRef] [PubMed]
  126. Donnenberg, M.S.; Tzipori, S.; McKee, M.L.; O’Brien, A.D.; Alroy, J.; Kaper, J.B. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J. Clin. Investig. 1993, 92, 1418–1424. [Google Scholar] [CrossRef] [PubMed]
  127. Thomas, R.R.; Brooks, H.J.L.; O’Brien, R. Prevalence of Shiga toxin-producing and enteropathogenic Escherichia coli marker genes in diarrhoeic stools in a New Zealand catchment area. J. Clin. Pathol. 2017, 70, 81–84. [Google Scholar] [CrossRef]
  128. Ferdous, M.; Friedrich, A.W.; Grundmann, H.; de Boer, R.F.; Croughs, P.D.; Islam, M.A.; Kluytmans-van den Bergh, M.F.; Kooistra-Smid, A.M.; Rossen, J.W. Molecular characterization and phylogeny of Shiga toxin–producing Escherichia coli isolates obtained from two Dutch regions using whole genome sequencing. Clin. Microbiol. Infect. 2016, 22, 642.e1–642.e9. [Google Scholar] [CrossRef]
  129. Lim, J.Y.; Yoon, J.W.; Hovde, C.J. A brief overview of Escherichia coli O157 and its plasmid O157. J. Microbiol. Biotechnol. 2010, 20, 5. [Google Scholar] [CrossRef]
  130. Islam, M.A.; Mondol, A.S.; De Boer, E.; Beumer, R.R.; Zwietering, M.H.; Talukder, K.A.; Heuvelink, A.E. Prevalence and genetic characterization of shiga toxin-producing Escherichia coli isolates from slaughtered animals in Bangladesh. Appl. Environ. Microbiol. 2008, 74, 5414–5421. [Google Scholar] [CrossRef]
  131. Adamu, M.S.; Ugochukwu, I.C.I.; Idoko, S.I.; Kwabugge, Y.A.; Abubakar, N.S.; Ameh, J.A. Virulent gene profile and antibiotic susceptibility pattern of Shiga toxin-producing Escherichia coli (STEC) from cattle and camels in Maiduguri, north-eastern Nigeria. Trop. Anim. Health Prod. 2018, 50, 1327–1341. [Google Scholar] [CrossRef] [PubMed]
  132. Ateba, C.N.; Bezuidenhout, C.C. Characterisation of Escherichia coli O157 strains from humans, cattle and pigs in the North-West Province, South Africa. Int. J. Food Microbiol. 2008, 128, 181–188. [Google Scholar] [CrossRef]
  133. Burgos, Y.; Beutin, L. Common origin of plasmid encoded alpha-hemolysin genes in Escherichia coli. BMC Microbiol. 2010, 10, 193. [Google Scholar] [CrossRef]
Table 1. Antibiotic disks and their concentrations for testing E. coli O157: H7, with corresponding interpretation criteria [35].
Table 1. Antibiotic disks and their concentrations for testing E. coli O157: H7, with corresponding interpretation criteria [35].
Antimicrobial AgentConcentration (µg)Interpretation Categories
Zone Diameter (mm)
RIS
Tetracycline30≤1112–14≥15
Ampicillin10≤1314–16≥17
Amikacin30≤1415–16≥17
Sulfamethoxazole100≤1213–16≥17
Ciprofloxacin5≤1516–20≥21
Gentamycin10≤1213–14>15
Ceftriaxone30≤1920–22≥23
Streptomycin10≤1112–14≥15
R = resistant; I = intermediate; S = susceptible.
Table 2. Primers used for detection of key virulence genes in E. coli O157:H7 strains.
Table 2. Primers used for detection of key virulence genes in E. coli O157:H7 strains.
Targeted GenePrimer NameSequence 5′–3′Annealing Temp. (°C)Product Size (bp)Reference
stx1Stx1-FAGTTAATGTGGTGGCGAAGG58347[33]
Stx1-RCACCAGACAATGTAACCGC
stx2Stx2-FTTCGGTATCCTATTCCCGG58592
Stx2-RCGTCATCGTATACACAGGAG
eaeAeaeA-FCACACGAATAAACTGACTAAAATG55376
eaeA-RAAAAACGCTGACCCGCACCTAAAT
hlyAhlyA-FACGATGTGGTTTATTCTGGA50167
hlyA-RCTTCACGTGACCATACATAT
Table 3. Occurrence of E. coli isolated from human, animal, and animal product samples.
Table 3. Occurrence of E. coli isolated from human, animal, and animal product samples.
Samples SourcesNo. of Samples TestedNo. Positive/Sample Tested (%)
Human stoolDiarrheic7540/75 (53.3%)
Apparently healthy252/25 (8%)
Sub-total N (%)10042/100 (42%)
Animal fecalCow354/35 (11.4%)
Sheep352/35 (5.7%)
Goat301/30 (3.33%)
Sub-total N (%)1007/100 (7%)
Animal productRaw cow milk509/50 (18%)
Raw sheep milk354/35 (11.42%)
Pasteurized milk331/33 (3.03%)
Hamburger beef359/35 (25.7%)
Sub-total N (%)15323/153 (15.03%)
Total N (%)35372/353 (20.4%)
Table 4. Frequency distribution of E. coli in humans in relation to gender.
Table 4. Frequency distribution of E. coli in humans in relation to gender.
GenderNumber of Examined SamplesNo. Positive E. coli (%)
DiarrheicApparently
Healthy		TotalDiarrheicApparently
Healthy		Total
Male35155022 (62.8%)1 (6.6%)23 (46%)
Female40105018 (45%)1 (10%)19 (38%)
Total7525100 40 (53.3%)2 (8%)42 (42%)
Table 5. Frequency distribution of E. coli in humans with respect to age.
Table 5. Frequency distribution of E. coli in humans with respect to age.
Age RangeNumber of Diarrheic PatientsNo. Positive E. coli (%)
From 1 to 10 years2017/20 (85%)
From 11 to 25 years2012/20 (60%)
From 26 to 40 years153/15 (20%)
From 41 to 60 years208/20 (40%)
Total7540 (53.3%)
Table 6. Overview of the distribution of E. coli and E. coli O157:H7 across various sources.
Table 6. Overview of the distribution of E. coli and E. coli O157:H7 across various sources.
Samples SourcesNo. of Samples TestedNo. of Positive SamplesPositive/
Sample Tested
Other E. coli Serotype N (%)E. coli O157: H7
N (%)
Human stoolDiarrheic7524 (32%)16 (21.33%)40/75
Apparently healthy251 (4%)1 (4%)2/25
Sub-total N (%)10025 (25%)17 (17%)42/100 (42%)
Animal fecalCow353 (8.57%)1 (2.85%)4/35
Sheep351 (2.85%)1 (2.85%)2/35
Goat300 (0.0%)1 (3.33%)1/30
Sub-total N (%)1004 (4%)3 (3%)7/100 (7%)
Animal productRaw cow milk505 (10%)4 (8%)9/50
Raw sheep milk353 (8.57%)1 (2.85%)4/35
Pasteurized milk331 (3.03%)0 (0.0%)1/33
Hamburger beef356 (17.14%)3 (8.57%)9/35
Sub-total N (%)15315 (9.8%)8 (5.22%)23/153 (15.03%)
Total N (%)35344 (12.5%)28 (7.9%)72/353 (20.4%)
Table 7. Antimicrobial susceptibility pattern of 28 E. coli O157:H7 isolates.
Table 7. Antimicrobial susceptibility pattern of 28 E. coli O157:H7 isolates.
Antimicrobial AgentNo. of Strains (%)
SusceptibleIntermediateResistant
Tetracycline2 (7.14%)2 (7.14%)24 (85.71%)
Ampicillin3 (10.71%)4 (14.29%)21 (75.00%)
Amikacin18 (64.29%)5 (17.86%)5 (17.86%)
Sulfamethoxazole0 (0.00%)8 (28.57%)20 (71.43%)
Ciprofloxacin26 (92.86%)2 (7.14%)0 (0.00%)
Gentamicin28 (100.00%)0 (0.00%)0 (0.00%)
Ceftriaxone24 (85.71%)3 (10.71%)1 (3.57%)
Streptomycin2 (7.14%)7 (25.00%)19 (67.86%)
Table 8. Virulence profiles of 28 EHEC E. coli O157:H7 isolates.
Table 8. Virulence profiles of 28 EHEC E. coli O157:H7 isolates.
Virulence Profilesstx1stx2eaeAhlyANo. (%) of Strains
I++++8
II+−++1
III−+++10
IV+++−1
V+−+−8
+: present; −: absent.
Table 9. Total distribution of virulence profiles of EHEC E. coli O157:H7 strain collection (n = 28) across various sources.
Table 9. Total distribution of virulence profiles of EHEC E. coli O157:H7 strain collection (n = 28) across various sources.
Samples SourcesNo. EHEC E. coli O157:H7 StrainsNo. of Strains Belonging to Each Virulence Profile
IIIIIIIVV
Human stoolDiarrheic166-10--
Apparently healthy1---1-
Sub-total N 176-101
Animal fecalCow1-1---
Sheep1----1
Goat1----1
Sub-total N 3-1- 2
Animal productRaw cow milk41---3
Raw sheep milk1----1
Pasteurized milk0-----
Hamburger Beef31---2
Sub-total N 82---6
Total N (%)28
(100%)		8
(28.57%)		1
(3.57%)		10
(35.71%)		1
(3.57%)		8
(28.57%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Altaie, H.A.A.; Gdoura Ben Amor, M.; Mohammed, B.A.; Gdoura, R. Detection and Characterization of Escherichia coli and Escherichia coli O157:H7 in Human, Animal, and Food Samples from Kirkuk Province, Iraq. Microbiol. Res. 2025, 16, 20. https://doi.org/10.3390/microbiolres16010020

AMA Style

Altaie HAA, Gdoura Ben Amor M, Mohammed BA, Gdoura R. Detection and Characterization of Escherichia coli and Escherichia coli O157:H7 in Human, Animal, and Food Samples from Kirkuk Province, Iraq. Microbiology Research. 2025; 16(1):20. https://doi.org/10.3390/microbiolres16010020

Chicago/Turabian Style

Altaie, Hayman Abdullah Ameen, Maroua Gdoura Ben Amor, Burhan Ahmed Mohammed, and Radhouane Gdoura. 2025. "Detection and Characterization of Escherichia coli and Escherichia coli O157:H7 in Human, Animal, and Food Samples from Kirkuk Province, Iraq" Microbiology Research 16, no. 1: 20. https://doi.org/10.3390/microbiolres16010020

APA Style

Altaie, H. A. A., Gdoura Ben Amor, M., Mohammed, B. A., & Gdoura, R. (2025). Detection and Characterization of Escherichia coli and Escherichia coli O157:H7 in Human, Animal, and Food Samples from Kirkuk Province, Iraq. Microbiology Research, 16(1), 20. https://doi.org/10.3390/microbiolres16010020

Article Metrics

Back to TopTop