Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer
Abstract
1. Introduction
2. Materials and Methods
3. Results
3.1. Characteristics of the Study Population
3.2. Genotype Distribution for rs1800795 (−174C>G) Polymorphism of the IL6 Gene
3.3. Genotype Distribution for rs2228145 (1073A>C) Polymorphism of the IL6R Receptor Gene
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Harada, S.; Morlote, D. Molecular pathology of colorectal cancer. Adv. Anat. Pathol. 2020, 27, 20–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, D.E.; O’Keefe, R.A.; Grandis, J.R. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. Nat. Rev. Clin. Oncol. 2018, 15, 234–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Hu, F.; Li, G.; Li, G.; Yang, X.; Liu, L.; Zhang, R.; Zhang, B.; Feng, Y. Human colorectal cancer-derived mesenchymal stem cells promote colorectal cancer progression through IL-6/JAK2/STAT3 signaling. Cell Death Dis. 2018, 9, 25. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Sun, Q.; Zhang, J.; Wang, H.; Liu, H. Classical signaling and trans-signaling pathways stimulated by Megalobrama amblycephala IL-6 and IL-6R. Int. J. Mol. Sci. 2022, 23, 2019. [Google Scholar] [CrossRef] [Scilit]
- Garbers, C.; Monhasery, N.; Aparicio-Siegmund, S.; Lokau, J.; Baran, P.; Nowell, M.A.; Jones, S.A.; Rose-John, S.; Scheller, J. The interleukin-6 receptor Asp358Ala single nucleotide polymorphism rs2228145 confers increased proteolytic conversion rates by ADAM proteases. Biochim. Biophys. Acta 2014, 1842, 1485–1494. [Google Scholar] [CrossRef] [Scilit]
- Terry, C.F.; Loukaci, V.; Green, F.R. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J. Biol. Chem. 2000, 275, 18138–18144. [Google Scholar] [CrossRef] [Scilit]
- Jurečeková, J.; Drobková, H.; Šarlinová, M.; Babušíková, E.; Sivoňová, M.K.; Matáková, T.; Kliment, J.; Halašová, E. The role of interleukin-6 polymorphism (rs1800795) in prostate cancer development and progression. Anticancer. Res. 2018, 38, 3663–3667. [Google Scholar] [CrossRef] [Scilit]
- Tumu, V.R.; Govatati, S.; Guruvaiah, P.; Deenadayal, M.; Shivaji, S.; Bhanoori, M. An interleukin-6 gene promoter polymorphism is associated with polycystic ovary syndrome in South Indian women. J. Assist. Reprod. Genet. 2013, 30, 1541–1546. [Google Scholar] [CrossRef] [Scilit]
- Salemi, R.; Gattuso, G.; Tomasello, B.; Lavoro, A.; Gaudio, A.; Libra, M.; Signorelli, S.S.; Candido, S. Co-occurrence of interleukin-6 receptor Asp358Ala variant and high plasma levels of IL-6: An evidence of IL-6 trans-signaling activation in deep vein thrombosis (DVT) patients. Biomolecules 2022, 12, 681. [Google Scholar] [CrossRef] [Scilit]
- Ríos-Hoyo, A.; Monzonís, X.; Vidal, J.; Linares, J.; Montagut, C. Unveiling acquired resistance to anti-EGFR therapies in colorectal cancer: A long and winding road. Front. Pharmacol. 2024, 15, 1398419. [Google Scholar] [CrossRef] [Scilit]
- Doleschal, B.; Petzer, A.; Rumpold, H. Current concepts of anti-EGFR targeting in metastatic colorectal cancer. Front. Oncol. 2022, 12, 1048166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ray, K.; Ujvari, B.; Ramana, V.; Donald, J. Cross-talk between EGFR and IL-6 drives oncogenic signaling and offers therapeutic opportunities in cancer. Cytokine Growth Factor. Rev. 2018, 41, 18–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.; He, Z.; Ye, J.; Liu, Z.; She, X.; Gao, X.; Liang, R. Progress in Understanding the IL-6/STAT3 Pathway in Colorectal Cancer. Onco Targets Ther. 2020, 13, 13023–13032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Li, C.; Tu, Z.; Cai, T.; Zhang, X.; Wang, L.; Tian, R.; Huang, J.; Gong, Y.; Yang, X.; et al. Off-label use of Baricitinib improves moderate and severe atopic dermatitis in China through inhibiting MAPK and PI3K/Akt/mTOR pathway via targeting JAK-STAT signaling of CD4+ cells. Front. Pharmacol. 2024, 15, 1324892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalinowski, S.T. HW-QuickCheck: A computer program for checking genotypes for agreement with Hardy-Weinberg expectations. Mol. Ecol. Notes 2006, 6, 974–979. [Google Scholar] [CrossRef] [Scilit]
- Horita, N.; Kaneko, T. Genetic model selection for a case-control study and a meta-analysis. Meta Gene 2015, 5, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Tabikhanova, L.E.; Osipova, L.P.; Churkina, T.V.; Kovalev, S.S.; Filipenko, M.L.; Voronina, E.N. Increased Frequencies of the—174G and —572C IL6 Alleles in Populations of Indigenous Peoples of Siberia Compared to Russians. Mol. Biol. 2023, 57, 329–337. [Google Scholar] [CrossRef] [Scilit]
- Shevchenko, A.V.; Prokof’ev, V.F.; Konenkov, V.I.; Chernykh, V.V.; Ermakova, O.V.; Trunov, A.N. Analysis of IL1B (rs1143627), IL4 (rs2243250), IL6 (rs1800795), IL8 (rs4073), IL10 (rs1800896, rs1800872), IL17A (rs227593) cytokines genes polymorphism and its complex genotypes among Caucasian patients of Western Siberia with primary open-angle glaucoma. Immunologiya 2021, 42, 211–221. [Google Scholar] [CrossRef] [Scilit]
- Peng, X.; Shi, J.; Sun, W.; Ruan, X.; Guo, Y.; Zhao, L.; Wang, J.; Li, B. Genetic polymorphisms of IL-6 promoter in cancer susceptibility and prognosis: A meta-analysis. Oncotarget 2018, 9, 12351–12364. [Google Scholar] [CrossRef] [Scilit]
- Slattery, M.L.; Wolff, R.K.; Herrick, J.S.; Caan, B.J.; Potter, J.D. IL6 genotypes and colon and rectal cancer. Cancer Causes Control 2007, 18, 1095–1105. [Google Scholar] [CrossRef] [Scilit]
- Banday, M.Z.; Balkhi, H.M.; Sameer, A.S.; Chowdri, N.A.; Haq, E. Strong association of interleukin-6-174G/C promoter single nucleotide polymorphism with a decreased risk of colorectal cancer in ethnic Kashmiri population: A case control study. Tumour Biol. 2017, 39, 1010428317695940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harun-Or-Roshid, M.; Ali, M.B.; Jesmin; Mollah, M.N.H. Statistical meta-analysis to investigate the association between the Interleukin-6 (IL-6) gene polymorphisms and cancer risk. PLoS ONE 2021, 16, e0247055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jafari-Nedooshan, J.; Dastgheib, S.A.; Kargar, S.; Zare, M.; Raee-Ezzabadi, A.; Heiranizadeh, N.; Sadeghizadeh-Yazdi, J.; Neamatzadeh, H. Association of IL-6-174 G>C Polymorphism with Susceptibility to Colorectal Cancer and Gastric Cancer: A Systematic Review and Meta-Analysis. Acta Med. 2019, 62, 137–146. [Google Scholar] [CrossRef] [Scilit]
- Topchieva, L.V.; Korneva, V.A.; Kurbatova, I.V. The relationship of the carriership of allelic variations in rs2228145 (A > C) of the IL6R gene with the levels of VCAM1 and ICAM1 gene transcripts in patients with essential hypertension. Vavilovskii Zhurnal Genet. Selektsii 2020, 24, 96–101. [Google Scholar] [CrossRef] [Scilit]
- Parisinos, C.A.; Serghiou, S.; Katsoulis, M.; George, M.J.; Patel, R.S.; Hemingway, H.; Hingorani, A.D. Variation in Interleukin 6 Receptor Gene Associates with Risk of Crohn’s Disease and Ulcerative Colitis. Gastroenterology 2018, 155, 303–306.e2. [Google Scholar] [CrossRef] [Scilit]
- Bondurant, K.L.; Lundgreen, A.; Herrick, J.S.; Kadlubar, S.; Wolff, R.K.; Slattery, M.L. Interleukin genes and associations with colon and rectal cancer risk and overall survival. Int. J. Cancer 2013, 132, 905–915. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Du, Z.; Wang, X.; Wang, G.; Li, W. Association of IL-6 Promoter and Receptor Polymorphisms with Multiple Myeloma Risk: A Systematic Review and Meta-Analysis. Genet. Test. Mol. Biomark. 2016, 20, 587–596. [Google Scholar] [CrossRef] [Scilit]
- Eulenfeld, R.; Dittrich, A.; Khouri, C.; Muller, P.J.; Mutze, B.; Wolf, A.; Schaper, F. Interleukin-6 signalling: More than Jaks and STATs. Eur. J. Cell Biol. 2012, 91, 486–495. [Google Scholar] [CrossRef] [Scilit]
- Costa-Pereira, A.P. Regulation of IL-6-type cytokine responses by MAPKs. Biochem. Soc. Trans. 2014, 42, 59–62. [Google Scholar] [CrossRef] [Scilit]
- Morkel, M.; Riemer, P.; Bläker, H.; Sers, C. Similar but different: Distinct roles for KRAS and BRAF oncogenes in colorectal cancer development and therapy resistance. Oncotarget 2015, 6, 20785–20800. [Google Scholar] [CrossRef] [Scilit]
| Target SNP | Primer Sequence 5′–3′ | Tm, °C | PCR Product (bp) |
|---|---|---|---|
| IL6 rs1800795 | FN TTCCCCCTAGTTGTGTCTTGCC | 60 | 195 |
| FM TTCCCCCTAGTTGTGTCTTGCG | |||
| R GAGCCTCAGACATCTCCAGTCCTAT | |||
| IL6R rs2228145 | FN TTTTTTAACCTAGTGCAAGA | 55 | 263 |
| FM TTTTTTAACCTAGTGCAAGC | |||
| R CATAATAGTAGGTGTTGTGTGT | |||
| KRAS 12 | F GGCCTGCTGAAAATGACTGAATAT | 58 | 118 |
| R biot-TGTTGGATCATATTCGTCCACA | |||
| Seq TAAACTTGTGGTAGTTGGAGCT | |||
| KRAS 61 | F biot-TGTTTCTCCCTTCTCAGGATTC | 60 | 155 |
| R GGCAAATACACAAAGAAAGCC | |||
| Seq GTCCCTCATTGCACTGTACTC | |||
| NRAS 12 | F CAGGTTCTTGCTGGTGTGAAAT | 58 | 178 |
| R biot-ACAAGTGAGAGACAGGATCAGGTC | |||
| Seq AACTGGTGGTGGTTGGAGCA | |||
| NRAS 61 | F GAAACCTGTTTGTTGGACATACTGG | 60 | 147 |
| R biot-CCTGTAGAGGTTAATATCCGCAAAT | |||
| Seq GGACATACTGGATACAGCTGGA | |||
| BRAF 600 | F biot-CACAGTAAAAATAGGTGATTTTGGT | 55 | 108 |
| R TCAATTCTTACCATCCACAAAAT | |||
| Seq GACCCACTCCATCGAGATTT | |||
| BRAF 464 | F biot-AGATTACAGTGGGACAAAGAATTGG | 58 | 167 |
| R CGAACAGTGAATATTTCCTTTGATG | |||
| Seq ATGCCACTTTCCCTTGTAGA |
| SNP | Genotypes | Control | CRC | p-Value | OR (CI 95%) | MAPK+ | MAPK− | p-Value Control vs. MAPK− |
|---|---|---|---|---|---|---|---|---|
| IL6 rs1800795 | n = 162 | n = 151 | n = 65 | n = 86 | ||||
| Allele G | 161 (0.50) | 185 (0.61) | 0.006 | 74 (0.57) | 111 (0.65) | 0.001 | ||
| Allele C | 163 (0.50) | 117 (0.39) | 0.006 | 56 (0.43) | 61 (0.35) | 0.001 | ||
| G/G | 42 (0.26) | 63 (0.42) | 0.003 | 2.05 (1.27–3.30) | 25 (0.38) | 38 (0.44) | 0.004 | |
| G/C | 77 (0.48) | 59 (0.39) | 0.109 | 24 (0.37) | 35 (0.41) | 0.292 | ||
| C/C | 43 (0.26) | 29 (0.19) | 0.139 | 16 (0.25) | 13 (0.15) | 0.047 | ||
| IL6R rs2228145 | Allele A | 216 (0.67) | 174 (0.58) | 0.020 | 84 (0.65) | 90 (0.52) | 0.001 | |
| Allele C | 108 (0.33) | 128 (0.42) | 0.020 | 46 (0.35) | 82 (0.48) | 0.001 | ||
| A/A | 76 (0.47) | 57 (0.38) | 0.108 | 29 (0.45) | 28 (0.32) | 0.023 | ||
| A/C | 64 (0.39) | 60 (0.40) | 0.857 | 26 (0.40) | 34 (0.40) | 0.878 | ||
| C/C | 22 (0.14) | 34 (0.22) | 0.065 | 1.85 (1.03–3.34) | 10 (0.15) | 24 (0.28) | 0.007 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smagina, E.; Polit’ko, D.; Kumeiko, V.; Gurina, L.; Stenkova, A. Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer. Gastroenterol. Insights 2025, 16, 6. https://doi.org/10.3390/gastroent16010006
Smagina E, Polit’ko D, Kumeiko V, Gurina L, Stenkova A. Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer. Gastroenterology Insights. 2025; 16(1):6. https://doi.org/10.3390/gastroent16010006
Chicago/Turabian StyleSmagina, Ekaterina, Dar’ya Polit’ko, Vadim Kumeiko, Lyudmila Gurina, and Anna Stenkova. 2025. "Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer" Gastroenterology Insights 16, no. 1: 6. https://doi.org/10.3390/gastroent16010006
APA StyleSmagina, E., Polit’ko, D., Kumeiko, V., Gurina, L., & Stenkova, A. (2025). Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer. Gastroenterology Insights, 16(1), 6. https://doi.org/10.3390/gastroent16010006
