Next Article in Journal
The Effect of Inspiratory Muscle Training on Gastroesophageal Reflux Disease Characteristics: A Systematic Review
Next Article in Special Issue
A Novel Approach to H. pylori Eradication: A Narrative Review of Vonoprazan-Based Therapies
Previous Article in Journal
MicroRNA 133A Regulates Squalene Epoxidase Expression in Colorectal Cancer Cells to Control Cell Proliferation and Cholesterol Production
Previous Article in Special Issue
Resection of the Inferior Vena Cava Due to Tumor Involvement Allows Long-Term Survival in Different Neoplasms
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer

1
School of Medicine and Life Sciences, Far Eastern Federal University, 690922 Vladivostok, Russia
2
Primorsky Regional Oncological Dispensary, 690105 Vladivostok, Russia
3
Medical Center, Far Eastern Federal University, 690922 Vladivostok, Russia
*
Author to whom correspondence should be addressed.
Gastroenterol. Insights 2025, 16(1), 6; https://doi.org/10.3390/gastroent16010006
Submission received: 5 December 2024 / Revised: 8 January 2025 / Accepted: 3 February 2025 / Published: 6 February 2025
(This article belongs to the Collection Advances in Gastrointestinal Cancer)

Abstract

Background: Chronic inflammation is an important factor in the development and progression of colorectal cancer (CRC). One of the key participants of chronic inflammation is interleukin-6 (IL-6), which enhances tumor malignancy. Some of the genetic markers characterizing the IL-6/STAT3/JAK pathway are functional polymorphisms in IL6 and IL6R genes. Hyperexpression of IL-6 and increasing concentrations of the soluble form, IL-6R, may be one possible option for cross-activation of MAPK signaling. Methods: Detection of rs1800795 and rs2228145 SNPs was carried out using allele-specific PCR. The mutations of RAS and BRAF genes in tumors were determined by pyrosequencing. Results: The allele and genotype distributions of IL6 rs1800795 (−174C>G) and IL6R rs2228145 (1073A>C) were significantly different between the CRC and control groups. Thus, the risks of CRC developing in carriers of the homozygous G/G rs1800795 and C/C rs2228145 genotypes were 2.05- and 1.85-fold higher. Also, we identified a relationship between the studied SNPs and somatic activating mutations in the RAS and BRAF genes. It was found that the G/G rs1800795 and C/C rs2228145 genotypes are significantly more common in the group of patients without activating mutations in the RAS and BRAF genes. Conclusions: Understanding the impact of genetic factors not only on cancer predisposition but the evolution of cancer cells will help to derive novel predictive markers and therapy options.

1. Introduction

According to the World Health Organization, colorectal cancer (CRC) is the third most common cancer worldwide and the second leading cause of cancer-related deaths in the world. The long-term development and courses of CRC include the transition from normal intestinal mucosa to benign precancerous adenomas, carcinomas, and, finally, to metastatic cancer. In most cases, this transition is asymptomatic and is the result of a complex interaction between environmental factors and genetic changes [1].
Chronic inflammation is an important factor in the occurrence and progression of tumors. One of the major players of chronic inflammation is interleukin-6 (IL-6), which is detected in significant concentrations in the microenvironment of many types of tumors, enhancing malignancy and increasing tumor survival, growth, and invasion [2]. Intracellular IL-6 signaling activates the JAK/STAT3 pathway, but cross-activation of MAPK/RAS and PI3K/AKT is also possible [3]. In classical signaling, the effect of IL-6 is strictly limited to target cells containing the selective transmembrane interleukin-6 receptor (IL-6R), which is expressed in immune effector cells as well as on pancreatic cells and hepatocytes. To initiate intracellular signaling, the IL-6/IL-6R complex binds to the ubiquitously expressed gp130 receptor. The classical IL-6 pathway mainly induces anti-inflammatory effects during the acute-phase response and the regenerative process [4].
Subsequently, a trans-signaling pathway was discovered that is mediated by the soluble form of the IL-6R receptor (sIL-6R). The soluble form of the receptor is formed by proteolysis by membrane proteinases ADAM10 and ADAM17, and partly by alternative splicing of mRNA [5]. The IL-6/sIL-6R complex interacts with high affinity with the membrane glycoprotein gp130, which is exposed on the surface of many cells. That significantly expands the spectrum of IL-6 target cells. The IL-6 trans-signaling pathway mainly promotes an inflammatory response and neoplastic transformation of the cells [4].
Potential genetic markers characterizing the IL-6 trans-signaling pathway may be functional polymorphisms in IL6 and its selective receptor IL6R genes. One of them is the polymorphism rs1800795 (−174C>G) of the promoter IL6 gene, which increases the level of IL6 expression and leads to elevation of the IL-6 in the blood [6]. The rs1800795 is located in the binding site of the transcription factor GATA-1. The G allele enhances affinity for GATA-1, which promotes hyperexpression of the IL6 gene. The polymorphism −174C>G is also located within a region with partial sequence homology to the Smad4-binding element. It was suggested that the C allele may bind Smad4 more efficiently and inhibit IL6 transcription [7,8]. A functional SNP, rs2228145 (1073A>C), was identified in the IL6R gene. It causes an amino acid substitution of aspartic acid (Asp) to alanine (Ala) at position 358, which is located in a proteolytic site for cleavage by metalloproteinases ADAM10 and ADAM17. This substitution leads to a higher rate of receptor proteolytic conversion, producing a two-fold higher level of the receptor soluble form (sIL-6R) in plasma [4,9].
According to clinical guidelines, all patients with metastatic colorectal cancer with the wild-type KRAS and NRAS genes are recommended to receive anti-EGFR therapy. However, the objective response rate (ORR) of treatment with anti-EGFR monoclonal antibodies (anti-EGFR mAbs) and chemotherapy is about 40–50% [10,11]. Unsuccessful therapy may be associated with the development of tumor resistance and/or cross-activation of the MAPK/RAS signaling pathway through the participants of other pathways such as IL-6 [12,13]. The complex IL-6/IL-6R activates the JAK/STAT signaling pathway. In turn, it has been demonstrated that the JAK-STAT signaling pathway can activate the classical Ras-Raf-MEK-ERK signaling cascade of the MAPK pathway. Conversely, inhibiting the JAK-STAT pathway leads to a decrease in activation of the MAPK cascade [14].
Germline polymorphisms of IL6 and IL6R genes that are associated with the hyperactivation of IL-6 trans-signaling can be predictors of the response to anti-EGFR therapy. Thus, genetic variability of IL6 and IL6R genes can determine individual characteristics of tumor development, progression, and response to treatment. In this regard, an urgent task is to study the distribution of genotypes of polymorphisms rs1800795 (−174C>G) of the IL6 gene and rs2228145 (1073A>C) of the IL6R gene in a group of patients with CRC and in relation to the mutational status of the RAS and BRAF genes.

2. Materials and Methods

Study population. This study included 151 patients with diagnosed colorectal cancer and 162 healthy cancer-free control subjects. The patients with CRC were recruited from the Department of Anticancer Drug Therapy at the Medical Center of Far Eastern Federal University and Primorsky Regional Oncology Dispensary. Histopathological examination of formalin-fixed paraffin-embedded (FFPE) tissues from patients was conducted, and all the studied material was represented by adenocarcinomas of varying degrees of differentiation. The study was carried out in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Far Eastern Federal University, School of Medicine and Life Science (protocol no. 12, 14 June 2024). Both patients and healthy subjects gave their informed consent to participate in the study.
Genomic DNA isolation. DNA from tissue blocks with tumor cellularity (≥30%) was extracted using a blackPREP FFPE DNA Kit (Analytik Jena, Hamburg, Germany) according to the manufacturer’s protocol. The quality and concentration of DNA were assessed by real-time PCR using a QuantumDNA-211 kit (Evrogen, Moscow, Russia) according to the manufacturer’s instructions. Genomic DNA from peripheral blood mononuclear cells was extracted using an ExtractDNA Blood&Cells kit (Evrogen, Moscow, Russia).
Allele-specific PCR. Detection of single-nucleotide polymorphisms rs1800795 and rs2228145 and subsequent genotyping were performed by allele-specific PCR (AS-PCR). Specific primers were designed using Vector NTI v.11 software and optimized in this study (Table 1). SNPdetect polymerase (Evrogen, Moscow, Russia) was used to perform AS-PCR. A final reaction mix contained 1×SNPdetect buffer and 2u of SNPdetect polymerase, 0.2 mM dNTP mixture, 0.5 mM primers each, deionized water, and 10–15 ng DNA. The cycling conditions for PCR were as follows: one cycle at 95 °C for 3 min; 30 cycles at 95 °C for 20 s; 55/60 °C for 15 s; and 72 °C for 30 s. After PCR, the amplicons were visualized on 2% agarose gel using ethidium bromide by gel electrophoresis.
Sanger sequencing. To validate the allele-specific PCR, Sanger sequencing was performed for the GC and AC genotypes of the rs1800795 and rs2228145 polymorphisms. The sequencing reaction was performed according to the BigDyeTM Terminator v3.1 kit protocol (Thermo FS, Waltham, MA, USA). The sequencing reaction was purified using D-pure magnetic particles (NimaGen, Nijmegen, The Netherlands) according to the manufacturer’s protocol.
Pyrosequencing. Detection of somatic mutations in 12, 13, and 61 codons of the KRAS and NRAS genes, and in 600 and 464–469 codons of the BRAF gene, was performed by pyrosequencing using a PyroMark Q24 device (Qiagen, Hamburg, Germany). Specific primers were designed using Vector NTI v.11 software and optimized in this study (Table 1). The PCR mixture contained 1× HS Taq Turbo buffer and 1 u of HS Taq polymerase (Eurogen, Moscow, Russia), 0.2 mM dNTP mixture (Eurogen, Moscow, Russia), 0.5 mM primers each, deionized water, and 10–15 ng DNA. Amplification program: one cycle at 95 °C for 15 min, followed by 42 cycles at 95 °C for 15 s, 55/58/60 °C for 15 s, and 72 °C for 20 s. Further sample preparation was performed with a PyroGold Q96 Reagent kit (Qiagen, Hamburg, Germany).
Data analysis. All statistical analyses were performed using STATISTICA v10. The two-tailed chi-square test was used to compare the genotype frequencies in CRC patients and healthy controls. Additionally, Hardy–Weinberg equilibrium for genotype frequencies was assessed using the computer program HW-QuickCheck [15]. Also, statistical analysis focused on assessing Odds ratios (ORs) with 95% confidence intervals (CIs) and p-values. A significance level of p ≤ 0.05 was used.

3. Results

3.1. Characteristics of the Study Population

In this investigation, we explored potential associations between two specific SNPs (rs1800795 and rs2228145), located within IL6 and IL6R genes, and their possible correlations with CRC and somatic mutations in KRAS, NRAS, and BRAF. A total of 151 patients with diagnosed colorectal cancer and 162 control subjects without cancer at the time of the study were included in the study. All participants were of Russian ethnicity. The mean age of CRC patients was 63.58 ± 11.4 years in the range of 25–84 years. According to gender distribution, men accounted for 48.34% and women for 51.66%. The average age in the control group was 51.24 ± 9.1, where 51.44% were men and 48.56% were women. DNA samples from FFPE blocks of tumor tissue from patients were genotyped for somatic mutations in KRAS, NRAS, and BRAF genes. According to histological data, all tumors were represented by adenocarcinomas G1–G3.

3.2. Genotype Distribution for rs1800795 (−174C>G) Polymorphism of the IL6 Gene

The distribution of allele and genotype frequencies of the IL6 rs1800795 (−174C>G) polymorphism was analyzed in a group of patients with CRC (n = 151) and a control group (n = 162) (Table 2). The genotype distribution of the SNP was consistent with Hardy–Weinberg equilibrium. The allele frequency in the control group was C = 0.50 and G = 0.50, and in the group of patients with CRC was C = 0.39 and G = 0.61, which is significantly different between groups (p = 0.01). The distribution of genotype frequencies C/C, C/G, and G/G was 0.26/0.48/0.26 in the control group and 0.19/0.39/0.42 in the group with CRC. The frequency of the G/G genotype in the CRC group was 1.6-fold higher than in the control group (p = 0.006). We employed a dominant genetic model to explore the potential association of the presence of the G/G genotype with CRC risk. This model was selected by the four-model strategy described by Horita and Kaneko [16]. Analysis showed a 2.05-fold more risk of developing colorectal cancer in carriers of the G/G genotype (adjusted OR = 2.05, 95% CI = 1.27–3.30, p = 0.003).
For further analysis, the group of patients with CRC was divided into two subgroups based on the presence or absence of activating mutations in KRAS, NRAS, and BRAF genes. It is known that these somatic mutations in tumor tissue lead to hyperactivation of the MAPK signaling pathway, which makes anti-EGFR therapy ineffective. A total of 65 (43.05%) cases of MAPK-activating mutations were detected in the tumor tissue of the CRC group: 53 (35.10%) in the KRAS gene, 7 (4.64%) in the NRAS gene, and 5 (3.31%) in the BRAF gene. This subgroup was named MAPK+. The subgroup with wild-type KRAS, NRAS, and BRAF was named MAPK−. Next, the distribution of allele and genotype frequencies of the rs1800795 (−174C>G) polymorphism was analyzed in the subgroups (Table 2). The allele frequencies in MAPK+ were C = 0.43 and G = 0.57, and those in MAPK− were C = 0.35 and G = 0.65. An increase in the occurrence of the G allele in the MAPK− group is observed, but the difference was insignificant (p = 0.11). A similar picture is observed when comparing the frequencies of the G/G, G/C, and C/C genotypes. These were 0.38/0.37/0.25 in the MAPK+ subgroup and 0.44/0.41/0.15 in the MAPK− subgroup, demonstrating an increase in homozygotes G/G (p = 0.48). Then, the genotype frequencies of the MAPK− subgroup were compared with the control group. It was found that the frequency of the G/G genotype was significantly higher in the MAPK− group (p = 0.004). So, a significant small negative correlation is observed between mutations in RAS/BRAF genes and the G/G genotype of rs1800795 polymorphism (r = −0.192, p = 0.002).

3.3. Genotype Distribution for rs2228145 (1073A>C) Polymorphism of the IL6R Receptor Gene

The allele and genotype distributions of the rs2228145 polymorphism were compared between the CRC and control groups (Table 2). The genotype frequencies were consistent with Hardy–Weinberg equilibrium. The allele frequencies in the control group were A = 0.67 and C = 0.33, and those in the group of patients with CRC were A = 0.58 and C = 0.42, which were significantly different between groups (p = 0.02). The distribution of genotypes A/A, A/C, and C/C in the control group was 0.47/0.39/0.14 and 0.38/0.40/0.22 in the CRC group. Herewith, the frequency of C/C was insignificantly higher in the CRC group (p = 0.065). The relationship between the presence of the C/C genotype and the risk of developing colorectal cancer was assessed using the recessive genetic model. It was found that the risk of developing CRC in people with the C/C genotype is 1.85-fold higher compared to the control (adjusted OR = 1.85, 95% CI = 1.03–3.34, p = 0.041).
The allele frequencies in MAPK+ were A = 0.65 and C = 0.35, and those in MAPK− were A = 0.52 and C = 0.48. The obtained differences in the allele distribution were significant (p = 0.020). The distribution of the A/A, A/C, and C/C genotypes of the rs2228145 polymorphism in the MAPK+ and MAPK− subgroups was 0.45/0.40/0.15 and 0.32/0.40/0.28, respectively (Table 2). Comparison of the genotype distribution between the control and MAPK− groups revealed a significant increase in the C/C homozygote in the last (p = 0.007). So, there was a significant small negative correlation between mutations in the RAS/BRAF genes and the C/C genotype of the rs2228145 polymorphism (r = −0.184, p = 0.004).

4. Discussion

The SNP rs1800795 (−174C>G) of the promoter IL6 gene is located in the binding site of the transcription factor GATA-1 and is associated with an increased level of IL6 expression. Our genotyping data of rs1800795 in the control group, consisting of subjects of Russian ethnicity, corresponded to the data for Russian and other European ethnic groups [17,18]. It should be noted that the allele distribution of this polymorphism varies considerably among different ethnic groups. So, in the indigenous population of Africa the frequency of the G allele is 100%; also, high occurrence is observed in Asian populations (90–100%); in the European population, it is significantly lower (50–58%). Some authors associate a decrease in the frequency of the G allele in European groups with adaptation to a moderate climate with a reduced infectious load [17]. Follow-up analysis of the patients with CRC showed that the G/G genotype of IL6 rs1800795 significantly affects the risk of cancer developing. Individuals with the G/G genotype had a 2.05-fold higher risk of CRC developing. According to a meta-analysis including 97 studies from 16 countries and considering participants’ ethnicity, the rs1800795 was significantly associated with a predisposition to the development of various types of cancer, including CRC [19]. Another study showed a weak association of the G/G genotype with an increased risk of developing rectal cancer [20]. In a study of the Kashmiri population, there was a reduced risk of developing CRC with C/C and C/C + G/C genotypes [21]. Another 2021 meta-analysis showed a nonsignificant association of the IL6 rs1800795 polymorphism with overall cancer risk but a significant association with an increased risk of cervical and prostate cancer [22]. Most studies show a significant or weak association with the carriage of the G/G variant and the development of various types of cancer. There are some studies showing no association with the development of cancer, including CRC [23]. These controversial data may be due to the remarkable variability of G allele frequency in different ethnic groups, and this is especially true for studies where the authors do not take this aspect into account.
Unlike the IL6 gene rs1800795 polymorphism, the differences in the allele distribution of the rs2228145 (Asp358Ala) IL6R receptor gene in different populations are similar. Thus, according to dbSNP NCBI data, the general population distribution of alleles was A = 0.612 and C = 0.388; in Europeans, A = 0.604 and C = 0.395; and in Asians, A = 0.592 and C = 0.408. In our data, for the control group, the distribution was A = 0.665 and C = 0.335, which corresponded to the population data and was consistent with studies in other regions of Russia [24]. Our results show that the C/C genotype of rs2228145 (Asp358Ala) significantly increases the risk of developing CRC. Individuals with the C/C genotype had a 1.85-fold higher risk. Many studies on the Asp358Ala polymorphism found a focus on the development of chronic-inflammation diseases. In the study by Parisinos et al. [25], they showed a connection between the decreased risk of developing inflammatory bowel diseases and a decrease in systemic inflammation, which occurs with an increase in the concentration of the IL-6 receptor’s soluble form (sIL-6R). To the authors’ knowledge, very few publications are available that address the association of rs2228145 (Asp358Ala) with cancers. One of them discussed the relationship of some polymorphisms in proinflammatory and anti-inflammatory interleukins with the risk of developing CRC and overall survival rate [26]. The authors identified a link between single-nucleotide polymorphisms in the IL3, IL6R, IL8, and IL15 genes and an increased risk of colon cancer. A meta-analysis also showed a significant link between rs2228145 (Asp358Ala) and an increased risk of developing multiple myeloma [27]. In our opinion, the studies of the IL6R rs2228145 (Asp358Ala) polymorphism in oncology research may be of interest due to the dual role of the polymorphism. This substitution led to an increase in the concentration of the soluble IL-6 receptor form (sIL-6R), which reduces the amount of membrane-bound receptors (mIL-6R). As a result, the classical IL-6 signaling in target cells switched to the trans-signaling pathway through the interaction of IL-6/sIL-6R complexes with the gp130 receptor, which is expressed by cells of many tissues, including colonocytes. Thus, hyperactivation of the trans-signaling pathway can reduce general systemic inflammation but disrupt the local immune response and cause tissue-specific inflammatory reactions [4].
The IL-6 initiates intracellular signaling through the JAK/STAT signaling pathway. But, additionally to the main pathway, JAK1 phosphorylates SHP-2, promoting the activation of the MAPK signaling pathway [28,29]. These and other studies suggested that some cross-talk occurs between the IL-6/JAK/STAT and MAPK pathways [14]. In this study, we hypothesized a link between somatic activating mutations in RAS/BRAF genes and the germline polymorphisms in IL6 and IL6R genes. It was found that the G/G rs1800795 and C/C rs2228145 genotypes are significantly more common in the group of patients without activating mutations in RAS/BRAF genes. It is possible that the simultaneous presence of the studied polymorphisms with mutations in the MAPK signaling pathway, as well as the simultaneous presence of mutations in the RAS and BRAF genes, does not provide a selective advantage in oncogenesis [30]. The studied polymorphisms of the IL6 and IL6R genes affect the trans-signaling activation of the IL-6/JAK/STAT pathway, which could lead to additional stimulation of the MAPK and PI3K signaling pathways by IL-6 and may contribute to the lack of clinical effect when treating wild-type RAS patients with IL6 G/G rs1800795 or IL6R C/C rs2228145 polymorphisms using EGFR inhibitors. This finding requires more serious evidence, but data might be applicable for further studies.

5. Conclusions

The details of the cross-talk between the RAS/RAF/MAPK and IL-6/JAK/STAT3 pathways in tumor cells are valuable and could lead to the development of new therapy regimens. Thus, hyperexpression of IL-6 and increasing concentrations of the soluble form, IL-6R, may be one possible option for the cross-activation of MAPK signaling bypassing EGFR. We have explored the genotype distribution and possible correlation of the rs1800795 (−174C>G) IL6 gene and the rs2228145 (1073A>C) IL6R gene polymorphisms with somatic mutations in RAS/BRAF in a group of patients with colorectal cancer. Our findings demonstrate a significant prevalence of the homozygotes G/G rs1800795 (−174C>G) IL6 gene and C/C rs2228145 (1073A>C) IL6R gene in a group of patients with CRC. Also, a weak negative correlation was found between the studied polymorphisms and the mutation status in RAS and BRAF genes. The G/G rs1800795 and C/C rs2228145 genotypes were significantly more common in the group of patients without activating mutations in KRAS, NRAS, or BRAF. Understanding the impact of genetic factors not only on cancer predisposition but also on the evolution of cancer cells could possibly lead to more effective and personalized therapy options. Nevertheless, further studies involving larger group of patients with treatment data are necessary to validate these findings.

Author Contributions

Conceptualization, A.S. and E.S.; methodology, E.S. and D.P.; validation, A.S., L.G. and V.K.; formal analysis, E.S. and D.P.; resources, V.K. and A.S.; data curation, A.S.; writing—original draft preparation, E.S.; writing—review and editing, A.S. and E.S.; supervision, V.K. and L.G.; project administration, A.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Higher Education of the Russian Federation (project FZNS-2023-0017).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Far Eastern Federal University, School of Medicine and Life Science (protocol no. 12 from 14 June 2024).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study. Written informed consent has been obtained from the patients to publish this paper.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Harada, S.; Morlote, D. Molecular pathology of colorectal cancer. Adv. Anat. Pathol. 2020, 27, 20–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Johnson, D.E.; O’Keefe, R.A.; Grandis, J.R. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. Nat. Rev. Clin. Oncol. 2018, 15, 234–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Zhang, X.; Hu, F.; Li, G.; Li, G.; Yang, X.; Liu, L.; Zhang, R.; Zhang, B.; Feng, Y. Human colorectal cancer-derived mesenchymal stem cells promote colorectal cancer progression through IL-6/JAK2/STAT3 signaling. Cell Death Dis. 2018, 9, 25. [Google Scholar] [CrossRef] [Scilit]
  4. Wang, J.; Sun, Q.; Zhang, J.; Wang, H.; Liu, H. Classical signaling and trans-signaling pathways stimulated by Megalobrama amblycephala IL-6 and IL-6R. Int. J. Mol. Sci. 2022, 23, 2019. [Google Scholar] [CrossRef] [Scilit]
  5. Garbers, C.; Monhasery, N.; Aparicio-Siegmund, S.; Lokau, J.; Baran, P.; Nowell, M.A.; Jones, S.A.; Rose-John, S.; Scheller, J. The interleukin-6 receptor Asp358Ala single nucleotide polymorphism rs2228145 confers increased proteolytic conversion rates by ADAM proteases. Biochim. Biophys. Acta 2014, 1842, 1485–1494. [Google Scholar] [CrossRef] [Scilit]
  6. Terry, C.F.; Loukaci, V.; Green, F.R. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J. Biol. Chem. 2000, 275, 18138–18144. [Google Scholar] [CrossRef] [Scilit]
  7. Jurečeková, J.; Drobková, H.; Šarlinová, M.; Babušíková, E.; Sivoňová, M.K.; Matáková, T.; Kliment, J.; Halašová, E. The role of interleukin-6 polymorphism (rs1800795) in prostate cancer development and progression. Anticancer. Res. 2018, 38, 3663–3667. [Google Scholar] [CrossRef] [Scilit]
  8. Tumu, V.R.; Govatati, S.; Guruvaiah, P.; Deenadayal, M.; Shivaji, S.; Bhanoori, M. An interleukin-6 gene promoter polymorphism is associated with polycystic ovary syndrome in South Indian women. J. Assist. Reprod. Genet. 2013, 30, 1541–1546. [Google Scholar] [CrossRef] [Scilit]
  9. Salemi, R.; Gattuso, G.; Tomasello, B.; Lavoro, A.; Gaudio, A.; Libra, M.; Signorelli, S.S.; Candido, S. Co-occurrence of interleukin-6 receptor Asp358Ala variant and high plasma levels of IL-6: An evidence of IL-6 trans-signaling activation in deep vein thrombosis (DVT) patients. Biomolecules 2022, 12, 681. [Google Scholar] [CrossRef] [Scilit]
  10. Ríos-Hoyo, A.; Monzonís, X.; Vidal, J.; Linares, J.; Montagut, C. Unveiling acquired resistance to anti-EGFR therapies in colorectal cancer: A long and winding road. Front. Pharmacol. 2024, 15, 1398419. [Google Scholar] [CrossRef] [Scilit]
  11. Doleschal, B.; Petzer, A.; Rumpold, H. Current concepts of anti-EGFR targeting in metastatic colorectal cancer. Front. Oncol. 2022, 12, 1048166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Ray, K.; Ujvari, B.; Ramana, V.; Donald, J. Cross-talk between EGFR and IL-6 drives oncogenic signaling and offers therapeutic opportunities in cancer. Cytokine Growth Factor. Rev. 2018, 41, 18–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Lin, Y.; He, Z.; Ye, J.; Liu, Z.; She, X.; Gao, X.; Liang, R. Progress in Understanding the IL-6/STAT3 Pathway in Colorectal Cancer. Onco Targets Ther. 2020, 13, 13023–13032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Chen, S.; Li, C.; Tu, Z.; Cai, T.; Zhang, X.; Wang, L.; Tian, R.; Huang, J.; Gong, Y.; Yang, X.; et al. Off-label use of Baricitinib improves moderate and severe atopic dermatitis in China through inhibiting MAPK and PI3K/Akt/mTOR pathway via targeting JAK-STAT signaling of CD4+ cells. Front. Pharmacol. 2024, 15, 1324892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Kalinowski, S.T. HW-QuickCheck: A computer program for checking genotypes for agreement with Hardy-Weinberg expectations. Mol. Ecol. Notes 2006, 6, 974–979. [Google Scholar] [CrossRef] [Scilit]
  16. Horita, N.; Kaneko, T. Genetic model selection for a case-control study and a meta-analysis. Meta Gene 2015, 5, 1–8. [Google Scholar] [CrossRef] [Scilit]
  17. Tabikhanova, L.E.; Osipova, L.P.; Churkina, T.V.; Kovalev, S.S.; Filipenko, M.L.; Voronina, E.N. Increased Frequencies of the—174G and —572C IL6 Alleles in Populations of Indigenous Peoples of Siberia Compared to Russians. Mol. Biol. 2023, 57, 329–337. [Google Scholar] [CrossRef] [Scilit]
  18. Shevchenko, A.V.; Prokof’ev, V.F.; Konenkov, V.I.; Chernykh, V.V.; Ermakova, O.V.; Trunov, A.N. Analysis of IL1B (rs1143627), IL4 (rs2243250), IL6 (rs1800795), IL8 (rs4073), IL10 (rs1800896, rs1800872), IL17A (rs227593) cytokines genes polymorphism and its complex genotypes among Caucasian patients of Western Siberia with primary open-angle glaucoma. Immunologiya 2021, 42, 211–221. [Google Scholar] [CrossRef] [Scilit]
  19. Peng, X.; Shi, J.; Sun, W.; Ruan, X.; Guo, Y.; Zhao, L.; Wang, J.; Li, B. Genetic polymorphisms of IL-6 promoter in cancer susceptibility and prognosis: A meta-analysis. Oncotarget 2018, 9, 12351–12364. [Google Scholar] [CrossRef] [Scilit]
  20. Slattery, M.L.; Wolff, R.K.; Herrick, J.S.; Caan, B.J.; Potter, J.D. IL6 genotypes and colon and rectal cancer. Cancer Causes Control 2007, 18, 1095–1105. [Google Scholar] [CrossRef] [Scilit]
  21. Banday, M.Z.; Balkhi, H.M.; Sameer, A.S.; Chowdri, N.A.; Haq, E. Strong association of interleukin-6-174G/C promoter single nucleotide polymorphism with a decreased risk of colorectal cancer in ethnic Kashmiri population: A case control study. Tumour Biol. 2017, 39, 1010428317695940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Harun-Or-Roshid, M.; Ali, M.B.; Jesmin; Mollah, M.N.H. Statistical meta-analysis to investigate the association between the Interleukin-6 (IL-6) gene polymorphisms and cancer risk. PLoS ONE 2021, 16, e0247055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Jafari-Nedooshan, J.; Dastgheib, S.A.; Kargar, S.; Zare, M.; Raee-Ezzabadi, A.; Heiranizadeh, N.; Sadeghizadeh-Yazdi, J.; Neamatzadeh, H. Association of IL-6-174 G>C Polymorphism with Susceptibility to Colorectal Cancer and Gastric Cancer: A Systematic Review and Meta-Analysis. Acta Med. 2019, 62, 137–146. [Google Scholar] [CrossRef] [Scilit]
  24. Topchieva, L.V.; Korneva, V.A.; Kurbatova, I.V. The relationship of the carriership of allelic variations in rs2228145 (A > C) of the IL6R gene with the levels of VCAM1 and ICAM1 gene transcripts in patients with essential hypertension. Vavilovskii Zhurnal Genet. Selektsii 2020, 24, 96–101. [Google Scholar] [CrossRef] [Scilit]
  25. Parisinos, C.A.; Serghiou, S.; Katsoulis, M.; George, M.J.; Patel, R.S.; Hemingway, H.; Hingorani, A.D. Variation in Interleukin 6 Receptor Gene Associates with Risk of Crohn’s Disease and Ulcerative Colitis. Gastroenterology 2018, 155, 303–306.e2. [Google Scholar] [CrossRef] [Scilit]
  26. Bondurant, K.L.; Lundgreen, A.; Herrick, J.S.; Kadlubar, S.; Wolff, R.K.; Slattery, M.L. Interleukin genes and associations with colon and rectal cancer risk and overall survival. Int. J. Cancer 2013, 132, 905–915. [Google Scholar] [CrossRef] [Scilit]
  27. Li, Y.; Du, Z.; Wang, X.; Wang, G.; Li, W. Association of IL-6 Promoter and Receptor Polymorphisms with Multiple Myeloma Risk: A Systematic Review and Meta-Analysis. Genet. Test. Mol. Biomark. 2016, 20, 587–596. [Google Scholar] [CrossRef] [Scilit]
  28. Eulenfeld, R.; Dittrich, A.; Khouri, C.; Muller, P.J.; Mutze, B.; Wolf, A.; Schaper, F. Interleukin-6 signalling: More than Jaks and STATs. Eur. J. Cell Biol. 2012, 91, 486–495. [Google Scholar] [CrossRef] [Scilit]
  29. Costa-Pereira, A.P. Regulation of IL-6-type cytokine responses by MAPKs. Biochem. Soc. Trans. 2014, 42, 59–62. [Google Scholar] [CrossRef] [Scilit]
  30. Morkel, M.; Riemer, P.; Bläker, H.; Sers, C. Similar but different: Distinct roles for KRAS and BRAF oncogenes in colorectal cancer development and therapy resistance. Oncotarget 2015, 6, 20785–20800. [Google Scholar] [CrossRef] [Scilit]
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Target SNPPrimer Sequence 5′–3′Tm, °CPCR Product (bp)
IL6 rs1800795FN TTCCCCCTAGTTGTGTCTTGCC60195
FM TTCCCCCTAGTTGTGTCTTGCG
R GAGCCTCAGACATCTCCAGTCCTAT
IL6R rs2228145FN TTTTTTAACCTAGTGCAAGA55263
FM TTTTTTAACCTAGTGCAAGC
R CATAATAGTAGGTGTTGTGTGT
KRAS 12F GGCCTGCTGAAAATGACTGAATAT58118
R biot-TGTTGGATCATATTCGTCCACA
Seq TAAACTTGTGGTAGTTGGAGCT
KRAS 61F biot-TGTTTCTCCCTTCTCAGGATTC60155
R GGCAAATACACAAAGAAAGCC
Seq GTCCCTCATTGCACTGTACTC
NRAS 12F CAGGTTCTTGCTGGTGTGAAAT58178
R biot-ACAAGTGAGAGACAGGATCAGGTC
Seq AACTGGTGGTGGTTGGAGCA
NRAS 61F GAAACCTGTTTGTTGGACATACTGG60147
R biot-CCTGTAGAGGTTAATATCCGCAAAT
Seq GGACATACTGGATACAGCTGGA
BRAF 600F biot-CACAGTAAAAATAGGTGATTTTGGT55108
R TCAATTCTTACCATCCACAAAAT
Seq GACCCACTCCATCGAGATTT
BRAF 464F biot-AGATTACAGTGGGACAAAGAATTGG58167
R CGAACAGTGAATATTTCCTTTGATG
Seq ATGCCACTTTCCCTTGTAGA
Table 2. Allele and genotype frequencies of IL6 and IL6R gene polymorphisms in colorectal cancer patients and controls.
Table 2. Allele and genotype frequencies of IL6 and IL6R gene polymorphisms in colorectal cancer patients and controls.
SNPGenotypesControlCRCp-ValueOR (CI 95%)MAPK+MAPK−p-Value
Control vs. MAPK−
IL6
rs1800795
n = 162n = 151 n = 65n = 86
Allele G161 (0.50)185 (0.61)0.006 74 (0.57)111 (0.65)0.001
Allele C163 (0.50)117 (0.39)0.006 56 (0.43)61 (0.35)0.001
G/G42 (0.26)63 (0.42)0.0032.05 (1.27–3.30)25 (0.38)38 (0.44)0.004
G/C77 (0.48)59 (0.39)0.109 24 (0.37)35 (0.41)0.292
C/C43 (0.26)29 (0.19)0.139 16 (0.25)13 (0.15)0.047
IL6R
rs2228145
Allele A216 (0.67)174 (0.58)0.020 84 (0.65)90 (0.52)0.001
Allele C108 (0.33)128 (0.42)0.020 46 (0.35)82 (0.48)0.001
A/A76 (0.47)57 (0.38)0.108 29 (0.45)28 (0.32)0.023
A/C64 (0.39)60 (0.40)0.857 26 (0.40)34 (0.40)0.878
C/C22 (0.14)34 (0.22)0.0651.85 (1.03–3.34)10 (0.15)24 (0.28)0.007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Smagina, E.; Polit’ko, D.; Kumeiko, V.; Gurina, L.; Stenkova, A. Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer. Gastroenterol. Insights 2025, 16, 6. https://doi.org/10.3390/gastroent16010006

AMA Style

Smagina E, Polit’ko D, Kumeiko V, Gurina L, Stenkova A. Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer. Gastroenterology Insights. 2025; 16(1):6. https://doi.org/10.3390/gastroent16010006

Chicago/Turabian Style

Smagina, Ekaterina, Dar’ya Polit’ko, Vadim Kumeiko, Lyudmila Gurina, and Anna Stenkova. 2025. "Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer" Gastroenterology Insights 16, no. 1: 6. https://doi.org/10.3390/gastroent16010006

APA Style

Smagina, E., Polit’ko, D., Kumeiko, V., Gurina, L., & Stenkova, A. (2025). Correlation Between Interleukin IL-6/IL-6 Receptor Polymorphisms (IL6–174C>G and IL6R 1073A>C) and RAS/BRAF Mutations in Patients with Colorectal Cancer. Gastroenterology Insights, 16(1), 6. https://doi.org/10.3390/gastroent16010006

Article Metrics

Back to TopTop