Functionalized Polymeric Microneedles for Transdermal Delivery of Ovalbumin Protein Antigen
Abstract
1. Introduction
2. Materials
2.1. Reagents and Materials
2.2. Cell Culture and Biological Reagents
3. Methods
3.1. Mold Preparation
3.2. β-Glucan and HA Composite Soluble MN Preparation
3.3. Characterization of Soluble MNs
3.4. Effects of β-Glucan and Fucoidan on ROS Production in HDF Cells
3.5. Local Application of Soluble MN
3.6. Quantitative Polymerase Chain Reaction (q-PCR) Analysis
3.7. Laser Confocal Microscopy Observation
3.8. Preparation of Drug-Loaded Microneedles (MNs) and Evaluation of Lymph Node Accumulation of Antigen Delivered via MNs
4. Results and Discussion
4.1. Microneedle Mold
4.2. Microneedles Characterization
4.3. Effect of β-Glucan and Fucoidan on ROS Production in HDF Cells
4.4. Quantitative Polymerase Chain Reaction (q-PCR) Analysis
4.5. Laser Confocal Microscopy Observation
4.6. Lymph Node Accumulation of Protein Delivered via MN
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Prausnitz, M.R.; Langer, R. Transdermal drug delivery. Nat. Biotechnol. 2008, 26, 1261–1268. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.C.; Park, J.H.; Prausnitz, M.R. Microneedles for drug and vaccine delivery. Adv. Drug Deliv. Rev. 2012, 64, 1547–1568. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.H.; Kathuria, H.; Amir, M.H.B.; Zhang, X.; Duong, H.T.T.; Ho, P.C.; Kang, L. High resolution photopolymer for 3D printing of personalised microneedle for transdermal delivery of anti-wrinkle small peptide. J. Control. Release 2021, 329, 907–918. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Zhao, W.; Zhang, L.; He, L.; Wang, S.; Wang, J.; Xiang, M.; Yuan, X.; Gou, M. Intradermal Delivery of Cell Vaccine via Ice Microneedles for Cancer Treatment. Adv. Healthc. Mater. 2025, 14, e2400678. [Google Scholar] [CrossRef]
- Chang, H.; Wen, X.; Li, Z.; Ling, Z.; Zheng, Y.; Xu, C. Co-delivery of dendritic cell vaccine and anti-PD-1 antibody with cryomicroneedles for combinational immunotherapy. Bioeng. Transl. Med. 2023, 8, e10457. [Google Scholar] [CrossRef]
- Dahri, M.; Beheshtizadeh, N.; Seyedpour, N.; Nakhostin-Ansari, A.; Aghajani, F.; Seyedpour, S.; Masjedi, M.; Farjadian, F.; Maleki, R.; Adibkia, K. Biomaterial-based delivery platforms for transdermal immunotherapy. Biomed. Pharmacother. 2023, 165, 115048. [Google Scholar] [CrossRef]
- Cole, G.; Ali, A.A.; McErlean, E.; Mulholland, E.J.; Short, A.; McCrudden, C.M.; McCaffrey, J.; Robson, T.; Kett, V.L.; Coulter, J.A.; et al. DNA vaccination via RALA nanoparticles in a microneedle delivery system induces a potent immune response against the endogenous prostate cancer stem cell antigen. Acta Biomater. 2019, 96, 480–490. [Google Scholar] [CrossRef]
- D’Amico, C.; Fusciello, M.; Hamdan, F.; D’Alessio, F.; Bottega, P.; Saklauskaite, M.; Russo, S.; Cerioni, J.; Elbadri, K.; Kemell, M.; et al. Transdermal delivery of PeptiCRAd cancer vaccine using microneedle patches. Bioact. Mater. 2025, 45, 115–127. [Google Scholar] [CrossRef]
- Edwards, C.; Shah, S.A.; Gebhardt, T.; Jewell, C.M. Exploiting Unique Features of Microneedles to Modulate Immunity. Adv. Mater. 2023, 35, e2302410. [Google Scholar] [CrossRef]
- Sousa, P.; Tavares-Valente, D.; Amorim, M.; Azevedo-Silva, J.; Pintado, M.; Fernandes, J. β-Glucan extracts as high-value multifunctional ingredients for skin health: A review. Carbohydr. Polym. 2023, 322, 121329. [Google Scholar] [CrossRef]
- Silva, A.C.Q.; Silvestre, A.J.D.; Vilela, C.; Freire, C.S.R. Natural Polymers-Based Materials: A Contribution to a Greener Future. Molecules 2021, 27, 94. [Google Scholar] [CrossRef] [PubMed]
- Chan, G.C.; Chan, W.K.; Sze, D.M. The effects of beta-glucan on human immune and cancer cells. J. Hematol. Oncol. 2009, 2, 25. [Google Scholar] [CrossRef] [PubMed]
- Fallacara, A.; Baldini, E.; Manfredini, S.; Vertuani, S. Hyaluronic Acid in the Third Millennium. Polymers 2018, 10, 701. [Google Scholar] [CrossRef] [PubMed]
- Zhu, D.; Yan, H.; Zhou, Y.; Nack, L.M.; Liu, J.; Parak, W.J. Design of disintegrable nanoassemblies to release multiple small-sized nanoparticles. Adv. Drug Deliv. Rev. 2023, 197, 114854. [Google Scholar] [CrossRef]
- Han, Y.; Qin, X.; Lin, W.; Wang, C.; Yin, X.; Wu, J.; Chen, Y.; Chen, X.; Chen, T. Microneedle-Based Approaches for Skin Disease Treatment. Nano-Micro Lett. 2025, 17, 132. [Google Scholar] [CrossRef]
- Keating, S.T.; Groh, L.; van der Heijden, C.; Rodriguez, H.; Dos Santos, J.C.; Fanucchi, S.; Okabe, J.; Kaipananickal, H.; van Puffelen, J.H.; Helder, L.; et al. The Set7 Lysine Methyltransferase Regulates Plasticity in Oxidative Phosphorylation Necessary for Trained Immunity Induced by β-Glucan. Cell Rep. 2020, 31, 107548. [Google Scholar] [CrossRef]
- Iqbal, S.; Andersson, S.; Nesta, E.; Pentinmikko, N.; Kumar, A.; Kumar Jha, S.; Borshagovski, D.; Webb, A.; Gebert, N.; Viitala, E.W.; et al. Fetal-like reversion in the regenerating intestine is regulated by mesenchymal asporin. Cell Stem Cell 2025, 32, 613–626.e8. [Google Scholar] [CrossRef]
- Sies, H.; Mailloux, R.J.; Jakob, U. Fundamentals of redox regulation in biology. Nat. Rev. Mol. Cell Biol. 2024, 25, 701–719. [Google Scholar] [CrossRef]
- Lv, H.; Gao, N.; Zhou, Q.; Wang, Y.; Ling, G.; Zhang, P. Collagen-Based Dissolving Microneedles with Flexible Pedestals: A Transdermal Delivery System for Both Anti-Aging and Skin Diseases. Adv. Healthc. Mater. 2023, 12, e2203295. [Google Scholar] [CrossRef]
- Makadia, H.K.; Siegel, S.J. Poly Lactic-co-Glycolic Acid (PLGA) as Biodegradable Controlled Drug Delivery Carrier. Polymers 2011, 3, 1377–1397. [Google Scholar] [CrossRef]
- Bhatnagar, S.; Bankar, N.G.; Kulkarni, M.V.; Venuganti, V.V.K. Dissolvable microneedle patch containing doxorubicin and docetaxel is effective in 4T1 xenografted breast cancer mouse model. Int. J. Pharm. 2019, 556, 263–275. [Google Scholar] [CrossRef] [PubMed]
- Abbas, M.F.; Karim, D.K.; Kareem, H.R.; Kamil, M.M.; Al-Musawi, M.H.; Asker, M.H.; Ghanami, M.; Shahriari-Khalaji, M.; Sattar, M.; Mirhaj, M.; et al. Fucoidan and its derivatives: From extraction to cutting-edge biomedical applications. Carbohydr. Polym. 2025, 357, 123468. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Guo, L.; Wen, P. Arrested proliferation and signal transduction of ERK5 in β-Glucan treated RAW264.7 macrophage cell line. J. Jiangsu Univ. 2008, 18, 248. [Google Scholar]
- Hao, W.; Zhao, C.; Li, G.; Wang, H.; Li, T.; Yan, P.; Wei, S. Blue LED light induces cytotoxicity via ROS production and mitochondrial damage in bovine subcutaneous preadipocytes. Environ. Pollut. 2023, 322, 121195. [Google Scholar] [CrossRef]
- Roth, G.A.; Picece, V.; Ou, B.S.; Luo, W.; Pulendran, B.; Appel, E.A. Designing spatial and temporal control of vaccine responses. Nat. Rev. Mater. 2022, 7, 174–195. [Google Scholar] [CrossRef]







| Forward Primer | Reverse Primer | |
|---|---|---|
| IL-6 | CTCTGCAAGAGACTTCCATCCAGT | GAAGTAGGGAAGGCCGTGG |
| IL-12 | TCTTAGCCAGTCCCGAAACC | TTGGTCCCGTGTGATGTCTTC |
| CXCL10 | GCCGTCATTTTCTGCCTCA | CGTCCTTGCGAGAGGGATC |
| IL-1β | ATGGCAGAAGTACCTGAGCTCGC | TCAGACAGCCCAGGTCAAAGG |
| β-actin | GTGGCATCCATGAAACTACAT | GGCATAGAGGTCTTTACGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Tan, F.; Zhao, D.; Zhang, L.; Zhang, N.; Bai, C.; Guo, Z.; Guan, X.; Chen, G. Functionalized Polymeric Microneedles for Transdermal Delivery of Ovalbumin Protein Antigen. Pharmaceutics 2025, 17, 737. https://doi.org/10.3390/pharmaceutics17060737
Liu Y, Tan F, Zhao D, Zhang L, Zhang N, Bai C, Guo Z, Guan X, Chen G. Functionalized Polymeric Microneedles for Transdermal Delivery of Ovalbumin Protein Antigen. Pharmaceutics. 2025; 17(6):737. https://doi.org/10.3390/pharmaceutics17060737
Chicago/Turabian StyleLiu, Yi, Feng Tan, Decheng Zhao, Liwen Zhang, Nianni Zhang, Chengwei Bai, Ziyang Guo, Xiongjian Guan, and Guanyu Chen. 2025. "Functionalized Polymeric Microneedles for Transdermal Delivery of Ovalbumin Protein Antigen" Pharmaceutics 17, no. 6: 737. https://doi.org/10.3390/pharmaceutics17060737
APA StyleLiu, Y., Tan, F., Zhao, D., Zhang, L., Zhang, N., Bai, C., Guo, Z., Guan, X., & Chen, G. (2025). Functionalized Polymeric Microneedles for Transdermal Delivery of Ovalbumin Protein Antigen. Pharmaceutics, 17(6), 737. https://doi.org/10.3390/pharmaceutics17060737

