Polydatin Ameliorates High Fructose-Induced Podocyte Oxidative Stress via Suppressing HIF-1α/NOX4 Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Blood and Tissue Sample Collection
2.3. Immunofluorescence Assay
2.4. Cell Culture and Treatment
2.5. Biochemical Analysis
2.6. RNA Isolation and qRT-PCR Analysis
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Polydatin Inhibits the Overexpression of HIF-1α in High Fructose-Cultured Podocytes
3.2. Polydatin Inhibits HIF-1α to Ameliorate Oxidative Stress in High Fructose-Cultured Podocytes
3.3. Polydatin Suppresses HIF-1α/NOX4 Pathway Activation in High Fructose-Induced Oxidative Stress Damage in Podocytes
3.4. Polydatin Prevents Glomeruli Oxidative Stress in High Fructose-Fed Rats with Kidney Dysfunction
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nagata, M. Podocyte injury and its consequences. Kidney. Int. 2016, 89, 1221–1230. [Google Scholar] [CrossRef] [PubMed]
- Ulu, R.; Gozel, N.; Tuzcu, M.; Orhan, C.; Yiğit, İ.P.; Dogukan, A.; Telceken, H.; Üçer, Ö.; Kemeç, Z.; Kaman, D.; et al. The effects of Mucuna pruriens on the renal oxidative stress and transcription factors in high-fructose-fed rats. Food. Chem. Toxicol. 2018, 118, 526–531. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.; Xu, L.; Tao, X.; Yin, L.; Qi, Y.; Xu, Y.; Han, X.; Tang, Z.; Ma, X.; Liu, K.; et al. Protective effects of dioscin against fructose-induced renal damage via adjusting Sirt3-mediated oxidative stress, fibrosis, lipid metabolism and inflammation. Toxicol. Lett. 2018, 284, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Gong, W.; Li, J.; Chen, Z.; Huang, J.; Chen, Q.; Cai, W.; Liu, P.; Huang, H. Polydatin promotes Nrf2-ARE anti-oxidative pathway through activating CKIP-1 to resist HG-induced up-regulation of FN and ICAM-1 in GMCs and diabetic mice kidneys. Free Radic. Biol. Med. 2017, 106, 393–405. [Google Scholar] [CrossRef]
- Zhao, X.J.; Yu, H.W.; Yang, Y.Z.; Wu, W.Y.; Chen, T.Y.; Jia, K.K.; Kang, L.L.; Jiao, R.Q.; Kong, L.D. Polydatin prevents fructose-induced liver inflammation and lipid deposition through increasing miR-200a to regulate Keap1/Nrf2 pathway. Redox. Biol. 2018, 18, 124–137. [Google Scholar] [CrossRef]
- Gu, T.T.; Zhang, D.M.; Wan, Z.Y.; Li, T.S.; Jiao, R.Q.; Chen, T.Y.; Zhao, X.J.; Kong, L.D. Polydatin enhances glomerular podocyte autophagy homeostasis by improving Nrf2-dependent antioxidant capacity in fructose-fed rats. Mol. Cell. Endocrinol. 2021, 520, 111079. [Google Scholar] [CrossRef]
- Shah, F.A.; Kury, L.A.; Li, T.; Zeb, A.; Koh, P.O.; Liu, F.; Zhou, Q.; Hussain, I.; Khan, A.U.; Jiang, Y.; et al. Polydatin attenuates neuronal loss via reducing neuroinflammation and oxidative stress in rat MCAO models. Front. Pharmacol. 2019, 10, 663. [Google Scholar] [CrossRef] [Green Version]
- Yu, L.; Li, Z.; Dong, X.; Xue, X.; Liu, Y.; Xu, S.; Zhang, J.; Han, J.; Yang, Y.; Wang, H. Polydatin protects diabetic heart against ischemia-reperfusion injury via notch1/hes1-mediated activation of pten/akt signaling. Oxid. Med. Cell. Longev. 2018, 2018, 2750695. [Google Scholar] [CrossRef] [Green Version]
- Movafagh, S.; Crook, S.; Vo, K. Regulation of hypoxia-inducible factor-1a by reactive oxygen species: New developments in an old debate. J. Cell. Biochem. 2015, 116, 696–703. [Google Scholar] [CrossRef]
- Stachurska, A.; Florczyk, U.; Józkowicz, A.; Dulak, J.; Łoboda, A. The new face of factors induced by hypoxia--HIF-1 and HIF-2 and oxidative stress. Postepy. Biochem. 2010, 56, 156–164. [Google Scholar]
- Hagen, T. Oxygen versus reactive oxygen in the regulation of HIF-1α: The balance tips. Biochem. Res. Int. 2012, 2012, 436981. [Google Scholar] [CrossRef] [PubMed]
- Baumann, B.; Hayashida, T.; Liang, X.; Schnaper, H.W. Hypoxia-inducible factor-1α promotes glomerulosclerosis and regulates COL1A2 expression through interactions with Smad3. Kidney. Int. 2016, 90, 797–808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, T.; Zhu, X.; Wu, H.; Jiang, K.; Zhao, G.; Shaukat, A.; Deng, G.; Qiu, C. Targeting the ROS/PI3K/AKT/HIF-1α/HK2 axis of breast cancer cells: Combined administration of Polydatin and 2-Deoxy-d-glucose. J. Cell. Mol. Med. 2019, 23, 3711–3723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sayyed, S.G.; Hägele, H.; Kulkarni, O.P.; Endlich, K.; Segerer, S.; Eulberg, D.; Klussmann, S.; Anders, H.J. Podocytes produce homeostatic chemokine stromal cell-derived factor-1/CXCL12, which contributes to glomerulosclerosis, podocyte loss and albuminuria in a mouse model of type 2 diabetes. Diabetologia 2009, 52, 2445–2454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tögel, F.; Isaac, J.; Hu, Z.; Weiss, K.; Westenfelder, C. Renal SDF-1 signals mobilization and homing of CXCR4-positive cells to the kidney after ischemic injury. Kidney. Int. 2005, 67, 1772–1784. [Google Scholar] [CrossRef] [Green Version]
- Ding, M.; Cui, S.; Li, C.; Jothy, S.; Haase, V.; Steer, B.M.; Marsden, P.A.; Pippin, J.; Shankland, S.; Rastaldi, M.P.; et al. Loss of the tumor suppressor Vhlh leads to upregulation of Cxcr4 and rapidly progressive glomerulonephritis in mice. Nat. Med. 2006, 12, 1081–1087. [Google Scholar] [CrossRef]
- Mo, H.; Wu, Q.; Miao, J.; Luo, C.; Hong, X.; Wang, Y.; Tang, L.; Hou, F.F.; Liu, Y.; Zhou, L. C-X-C chemokine receptor type 4 plays a crucial role in mediating oxidative stress-induced podocyte injury. Antioxid. Redox. Signal. 2017, 27, 345–362. [Google Scholar] [CrossRef]
- Ilatovskaya, D.V.; Staruschenko, A. TRPC6 channel as an emerging determinant of the podocyte injury susceptibility in kidney diseases. Am. J. Physiol. Renal. Physiol. 2015, 309, F393–F397. [Google Scholar] [CrossRef] [Green Version]
- Ma, R.; Chaudhari, S.; Li, W. Canonical transient receptor potential 6 channel: A new target of reactive oxygen species in renal physiology and pathology. Antioxid. Redox. Signal. 2016, 25, 732–748. [Google Scholar] [CrossRef] [Green Version]
- Ilatovskaya, D.V.; Blass, G.; Palygin, O.; Levchenko, V.; Pavlov, T.S.; Grzybowski, M.N.; Winsor, K.; Shuyskiy, L.S.; Geurts, A.M.; Cowley, A.W., Jr.; et al. A NOX4/TRPC6 pathway inpodocyte calcium regulation and renal damage in diabetic kidney disease. J. Am. Soc. Nephrol. 2018, 29, 1917–1927. [Google Scholar] [CrossRef] [Green Version]
- Jha, J.C.; Thallas-Bonke, V.; Banal, C.; Gray, S.P.; Chow, B.S.; Ramm, G.; Quaggin, S.E.; Cooper, M.E.; Schmidt, H.H.; Jandeleit-Dahm, K.A. Podocyte-specific Nox4 deletion affords renoprotection in a mouse model of diabetic nephropathy. Diabetologia 2016, 59, 379–389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prince, P.D.; Rodríguez Lanzi, C.; Fraga, C.G.; Galleano, M. Dietary (-)-epicatechin affects NF-κB activation and NADPH oxidases in the kidney cortex of high-fructose-fed rats. Food. Funct. 2019, 10, 26–32. [Google Scholar] [CrossRef] [PubMed]
- Bettaieb, A.; Jiang, J.X.; Sasaki, Y.; Chao, T.I.; Kiss, Z.; Chen, X.; Tian, J.; Katsuyama, M.; Yabe-Nishimura, C.; Xi, Y.; et al. Hepatocyte Nicotinamide Adenine Dinucleotide Phosphate Reduced Oxidase 4 Regulates Stress Signaling, Fibrosis, and Insulin Sensitivity During Development of Steatohepatitis in Mice. Gastroenterology 2015, 149, 468–480.e410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diebold, I.; Petry, A.; Hess, J.; Görlach, A. The NADPH oxidase subunit NOX4 is a new target gene of the hypoxia-inducible factor-1. Mol. Biol. Cell. 2010, 21, 2087–2096. [Google Scholar] [CrossRef] [Green Version]
- Zhang, T.; Chi, Y.; Kang, Y.; Lu, H.; Niu, H.; Liu, W.; Li, Y. Resveratrol ameliorates podocyte damage in diabetic mice via SIRT1/PGC-1α mediated attenuation of mitochondrial oxidative stress. J. Cell. Physiol. 2019, 234, 5033–5043. [Google Scholar] [CrossRef]
- Kanbay, M.; Ozkara, A.; Selcoki, Y.; Isik, B.; Turgut, F.; Bavbek, N.; Uz, E.; Akcay, A.; Yigitoglu, R.; Covic, A. Effect of treatment of hyperuricemia with allopurinol on blood pressure, creatinine clearence, and proteinuria in patients with normal renal functions. Int. Urol. Nephrol. 2007, 39, 1227–1233. [Google Scholar] [CrossRef]
- Goicoechea, M.; de Vinuesa, S.G.; Verdalles, U.; Ruiz-Caro, C.; Ampuero, J.; Rincón, A.; Arroyo, D.; Luño, J. Effect of allopurinol in chronic kidney disease progression and cardiovascular risk. Clin. J. Am. Soc. Nephrol. 2010, 5, 1388–1393. [Google Scholar] [CrossRef] [Green Version]
- Li, T.S.; Chen, L.; Wang, S.C.; Yang, Y.Z.; Xu, H.J.; Gu, H.M.; Zhao, X.J.; Dong, P.; Pan, Y.; Shang, Z.Q.; et al. Magnesium isoglycyrrhizinate ameliorates fructose-induced podocyte apoptosis through downregulation of miR-193a to increase WT1. Biochem. Pharmacol. 2019, 166, 139–152. [Google Scholar] [CrossRef]
- Gao, Y.; Zeng, Z.; Li, T.; Xu, S.; Wang, X.; Chen, Z.; Lin, C. Polydatin inhibits mitochondrial dysfunction in the renal tubular epithelial cells of a rat model of sepsis-induced acute kidney injury. Anesth. Analg. 2015, 121, 1251–1260. [Google Scholar] [CrossRef]
- Zeng, Z.; Chen, Z.; Xu, S.; Zhang, Q.; Wang, X.; Gao, Y.; Zhao, K.S. Polydatin protecting kidneys against hemorrhagic shock-induced mitochondrial dysfunction via SIRT1 activation and p53 deacetylation. Oxid. Med. Cell. Longev. 2016, 2016, 1737185. [Google Scholar] [CrossRef] [Green Version]
- Hongyan, L.; Suling, W.; Weina, Z.; Yajie, Z.; Jie, R. Antihyperuricemic effect of liquiritigenin in potassium oxonate-induced hyperuricemic rats. Biomed. Pharmacother. 2016, 84, 1930–1936. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.H.; Wang, C.Z.; Wang, S.Q.; Mi, C.; He, Y.; Zhang, J.; Zhang, Y.W.; Anderson, S.; Yuan, C.S. Anti-hyperuricemia effects of allopurinol are improved by Smilax riparia, a traditional Chinese herbal medicine. J. Ethnopharmacol. 2015, 162, 362–368. [Google Scholar] [CrossRef] [PubMed]
- Koop, K.; Eikmans, M.; Baelde, H.J.; Kawachi, H.; De Heer, E.; Paul, L.C.; Bruijn, J.A. Expression of podocyte-associated molecules in acquired human kidney diseases. J. Am. Soc. Nephrol. 2003, 14, 2063–2071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thilo, F.; Liu, Y.; Loddenkemper, C.; Schuelein, R.; Schmidt, A.; Yan, Z.; Zhu, Z.; Zakrzewicz, A.; Gollasch, M.; Tepel, M. VEGF regulates TRPC6 channels in podocytes. Nephrol. Dial. Transplant. 2012, 27, 921–929. [Google Scholar] [CrossRef] [Green Version]
- Gorin, Y.; Cavaglieri, R.C.; Khazim, K.; Lee, D.Y.; Bruno, F.; Thakur, S.; Fanti, P.; Szyndralewiez, C.; Barnes, J.L.; Block, K.; et al. Targeting NADPH oxidase with a novel dual Nox1/Nox4 inhibitor attenuates renal pathology in type 1 diabetes. Am. J. Physiol. Renal. Physiol. 2015, 308, F1276–F1287. [Google Scholar] [CrossRef] [Green Version]
- Cadenas, S. ROS and redox signaling in myocardial ischemia-reperfusion injury and cardioprotection. Free. Radic. Biol. Med. 2018, 117, 76–89. [Google Scholar] [CrossRef]
- Matsushima, S.; Kuroda, J.; Ago, T.; Zhai, P.; Ikeda, Y.; Oka, S.; Fong, G.H.; Tian, R.; Sadoshima, J. Broad suppression of NADPH oxidase activity exacerbates ischemia/reperfusion injury through inadvertent downregulation of hypoxia-inducible factor-1α and upregulation of peroxisome proliferator-activated receptor-α. Circ. Res. 2013, 112, 1135–1149. [Google Scholar] [CrossRef] [Green Version]
- Lanaspa, M.A.; Ishimoto, T.; Cicerchi, C.; Tamura, Y.; Roncal-Jimenez, C.A.; Chen, W.; Tanabe, K.; Andres-Hernando, A.; Orlicky, D.J.; Finol, E.; et al. Endogenous fructose production and fructokinase activation mediate renal injury in diabetic nephropathy. J. Am. Soc. Nephrol. 2014, 25, 2526–2538. [Google Scholar] [CrossRef] [Green Version]
- Mallipattu, S.K.; He, J.C. The podocyte as a direct target for treatment of glomerular disease? Am. J. Physiol. Renal. Physiol. 2016, 311, F46–F51. [Google Scholar] [CrossRef] [Green Version]
- Ni, Z.; Tao, L.; Xiaohui, X.; Zelin, Z.; Jiangang, L.; Zhao, S.; Weikang, H.; Hongchao, X.; Qiujing, W.; Xin, L. Polydatin impairs mitochondria fitness and ameliorates podocyte injury by suppressing Drp1 expression. J. Cell. Physiol. 2017, 232, 2776–2787. [Google Scholar] [CrossRef] [Green Version]
- Gu, L.; Liu, J.; Xu, D.; Lu, Y. Polydatin prevents LPS-induced acute kidney injury through inhibiting inflammatory and oxidative responses. Microb. Pathog. 2019, 137, 103688. [Google Scholar] [CrossRef] [PubMed]
- Guzy, R.D.; Hoyos, B.; Robin, E.; Chen, H.; Liu, L.; Mansfield, K.D.; Simon, M.C.; Hammerling, U.; Schumacker, P.T. Mitochondrial complex III is required for hypoxia-induced ROS production and cellular oxygen sensing. Cell. Metab. 2005, 1, 401–408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katwal, G.; Baral, D.; Fan, X.; Weiyang, H.; Zhang, X.; Ling, L.; Xiong, Y.; Ye, Q.; Wang, Y. SIRT3 a major player in attenuation of hepatic ischemia-reperfusion injury by reducing ROS via its downstream mediators: SOD2, CYP-D, and HIF-1α. Oxid. Med. Cell. Longev. 2018, 2018, 2976957. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.S.; Zhou, Y.N.; Li, L.; Li, S.F.; Long, D.; Chen, X.L.; Zhang, J.B.; Feng, L.; Li, Y.P. HIF-1α protects against oxidative stress by directly targeting mitochondria. Redox. Biol. 2019, 25, 101109. [Google Scholar] [CrossRef]
- Yang, L.; Xie, P.; Wu, J.; Yu, J.; Li, X.; Ma, H.; Yu, T.; Wang, H.; Ye, J.; Wang, J.; et al. Deferoxamine treatment combined with sevoflurane postconditioning attenuates myocardial ischemia-reperfusion injury by restoring HIF-1/BNIP3-mediated mitochondrial autophagy in GK rats. Front. Pharmacol. 2020, 11, 6. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.Y.; Kim, J.K.; Kim, H. ABCB7 simultaneously regulates apoptotic and non-apoptotic cell death by modulating mitochondrial ROS and HIF1α-driven NFκB signaling. Oncogene 2020, 39, 1969–1982. [Google Scholar] [CrossRef]
- Sun, R.; Meng, X.; Pu, Y.; Sun, F.; Man, Z.; Zhang, J.; Yin, L.; Pu, Y. Overexpression of HIF-1a could partially protect K562 cells from 1,4-benzoquinone induced toxicity by inhibiting ROS, apoptosis and enhancing glycolysis. Toxicol. In Vitro 2019, 55, 18–23. [Google Scholar] [CrossRef]
- Hasegawa, S.; Tanaka, T.; Saito, T.; Fukui, K.; Wakashima, T.; Susaki, E.A.; Ueda, H.R.; Nangaku, M. The oral hypoxia-inducible factor prolyl hydroxylase inhibitor enarodustat counteracts alterations in renal energy metabolism in the early stages of diabetic kidney disease. Kidney. Int. 2020, 97, 934–950. [Google Scholar] [CrossRef] [Green Version]
- Kang, M.K.; Kim, S.I.; Oh, S.Y.; Na, W.; Kang, Y.H. Tangeretin ameliorates glucose-Induced podocyte Injury through blocking epithelial to mesenchymal transition caused by oxidative stress and hypoxia. Int. J. Mol. Med. Sci. 2020, 21, 8577. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhu, Y.; Wang, X.; Gong, J.; Hu, C.; Guo, B.; Zhu, B.; Li, Y. Temporal regulation of HIF-1 and NF-κB in hypoxic hepatocarcinoma cells. Oncotarget 2015, 6, 9409–9419. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Lan, Z. Polydatin attenuates potassium oxonate-induced hyperuricemia and kidney inflammation by inhibiting NF-κB/NLRP3 inflammasome activation via the AMPK/SIRT1 pathway. Food. Funct. 2017, 8, 1785–1792. [Google Scholar] [CrossRef] [PubMed]
- Coulibaly, A.; Velásquez, S.Y.; Kassner, N.; Schulte, J.; Barbarossa, M.V.; Lindner, H.A. STAT3 governs the HIF-1α response in IL-15 primed human NK cells. Sci. Rep. 2021, 11, 7023. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.J.; Xu, W.H.; Fan, L.M.; Zhang, Y.Q.; Xu, W.; Chen, Y.P.; Chen, L.L.; Chen, L.; Xu, W.; Wang, Y.; et al. Polydatin alleviates DSS- and TNBS-induced colitis by suppressing Th17 cell differentiation via directly inhibiting STAT3. Phytother. Res. 2022, 36, 3662–3671. [Google Scholar] [CrossRef]
- Bohuslavova, R.; Cerychova, R.; Nepomucka, K.; Pavlinkova, G. Renal injury is accelerated by global hypoxia-inducible factor 1 alpha deficiency in a mouse model of STZ-induced diabetes. BMC. Endocr. Disord. 2017, 17, 48. [Google Scholar] [CrossRef] [Green Version]
- Brukamp, K.; Jim, B.; Moeller, M.J.; Haase, V.H. Hypoxia and podocyte-specific Vhlh deletion confer risk of glomerular disease. Am. J. Physiol. Renal. Physiol. 2007, 293, F1397–F1407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dryer, S.E.; Reiser, J. TRPC6 channels and their binding partners in podocytes: Role in glomerular filtration and pathophysiology. Am. J. Physiol. Renal. Physiol. 2010, 299, F689–F701. [Google Scholar] [CrossRef] [Green Version]
- Huber, T.B.; Kottgen, M.; Schilling, B.; Walz, G.; Benzing, T. Interaction with podocin facilitates nephrin signaling. J. Biol. Chem. 2001, 276, 41543–41546. [Google Scholar] [CrossRef] [Green Version]
- Dryer, S.E.; Roshanravan, H.; Kim, E.Y. TRPC channels: Regulation, dysregulation and contributions to chronic kidney disease. Biochim. Biophys. Acta Mol. Basis. Dis. 2019, 1865, 1041–1066. [Google Scholar] [CrossRef]
- Möller, C.C.; Wei, C.; Altintas, M.M.; Li, J.; Greka, A.; Ohse, T.; Pippin, J.W.; Rastaldi, M.P.; Wawersik, S.; Schiavi, S.; et al. Induction of TRPC6 channel in acquired forms of proteinuric kidney disease. J. Am. Soc. Nephrol. 2007, 18, 29–36. [Google Scholar] [CrossRef]
- Sonneveld, R.; van der Vlag, J.; Baltissen, M.P.; Verkaart, S.A.; Wetzels, J.F.; Berden, J.H.; Hoenderop, J.G.; Nijenhuis, T. Glucose specifically regulates TRPC6 expression in the podocyte in an AngII-dependent manner. Am. J. Pathol. 2014, 184, 1715–1726. [Google Scholar] [CrossRef]
- Sonneveld, R.; Hoenderop, J.G.; Isidori, A.M.; Henique, C.; Dijkman, H.B.; Berden, J.H.; Tharaux, P.L.; van der Vlag, J.; Nijenhuis, T. Sildenafil prevents podocyte injury via PPAR-γ-mediated TRPC6 inhibition. J. Am. Soc. Nephrol. 2017, 28, 1491–1505. [Google Scholar] [CrossRef] [PubMed]
- Ma, R.; Wang, Y.; Xu, Y.; Wang, R.; Wang, X.; Yu, N.; Li, M.; Zhou, Y. Tacrolimus protects podocytes from apoptosis via downregulation of TRPC6 in diabetic nephropathy. J. Diabetes Res. 2021, 2021, 8832114. [Google Scholar] [CrossRef] [PubMed]
- Yao, X.M.; Liu, Y.J.; Wang, Y.M.; Wang, H.; Zhu, B.B.; Liang, Y.P.; Yao, W.G.; Yu, H.; Wang, N.S.; Zhang, X.M.; et al. Astragaloside IV prevents high glucose-induced podocyte apoptosis via downregulation of TRPC6. Mol. Med. Rep. 2016, 13, 5149–5156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Romoli, S.; Angelotti, M.L.; Antonelli, G.; Kumar Vr, S.; Mulay, S.R.; Desai, J.; Anguiano Gomez, L.; Thomasova, D.; Eulberg, D.; Klussmann, S.; et al. CXCL12 blockade preferentially regenerates lost podocytes in cortical nephrons by targeting an intrinsic podocyte-progenitor feedback mechanism. Kidney Int. 2018, 94, 1111–1126. [Google Scholar] [CrossRef] [Green Version]
- Yang, Q.; Wu, F.R.; Wang, J.N.; Gao, L.; Jiang, L.; Li, H.D.; Ma, Q.; Liu, X.Q.; Wei, B.; Zhou, L.; et al. Nox4 in renal diseases: An update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef]
- Gao, X.; Liu, Y.; Wang, L.; Sai, N.; Liu, Y.; Ni, J. Morroniside inhibits H(2)O(2)-induced podocyte apoptosis by down-regulating NOX4 expression controlled by autophagy in vitro. Front. Pharmacol. 2020, 11, 533809. [Google Scholar] [CrossRef]
- Meng, D.; Mei, A.; Liu, J.; Kang, X.; Shi, X.; Qian, R.; Chen, S. NADPH oxidase 4 mediates insulin-stimulated HIF-1α and VEGF expression, and angiogenesis in vitro. PLoS ONE 2012, 7, e48393. [Google Scholar] [CrossRef]
- Helfinger, V.; Henke, N.; Harenkamp, S.; Walter, M.; Epah, J.; Penski, C.; Mittelbronn, M.; Schröder, K. The NADPH Oxidase Nox4 mediates tumour angiogenesis. Acta. Physiol. (Oxf). 2016, 216, 435–446. [Google Scholar] [CrossRef]
- Tang, K.S.; Tan, J.S. The protective mechanisms of polydatin in cerebral ischemia. Eur. J. Pharmacol. 2019, 842, 133–138. [Google Scholar] [CrossRef]
- Liu, H.B.; Meng, Q.H.; Huang, C.; Wang, J.B.; Liu, X.W. Nephroprotective Effects of Polydatin against Ischemia/Reperfusion Injury: A Role for the PI3K/Akt Signal Pathway. Oxid. Med. Cell. Longev. 2015, 2015, 362158. [Google Scholar] [CrossRef] [Green Version]
- Tang, D.; Zhang, Q.; Duan, H.; Ye, X.; Liu, J.; Peng, W.; Wu, C. Polydatin: A Critical Promising Natural Agent for Liver Protection via Antioxidative Stress. Oxid. Med. Cell. Longev. 2022, 2022, 9218738. [Google Scholar] [CrossRef]
- Zhao, X.; Li, R.; Liu, Y.; Zhang, X.; Zhang, M.; Zeng, Z.; Wu, L.; Gao, X.; Lan, T.; Wang, Y. Polydatin protects against carbon tetrachloride-induced liver fibrosis in mice. Arch. Biochem. Biophys. 2017, 629, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Wu, J.; Mo, J.; Guo, L.; Wu, X.; Bao, Y. Polydatin inhibits adipose tissue inflammation and ameliorates lipid metabolism in high-fat-fed Mice. Biochem. Res. Int. 2019, 2019, 7196535. [Google Scholar] [CrossRef]
- Zhang, J.; Tan, Y.; Yao, F.; Zhang, Q. Polydatin alleviates non-alcoholic fatty liver disease in rats by inhibiting the expression of TNF-α and SREBP-1c. Mol. Med. Rep. 2012, 6, 815–820. [Google Scholar] [CrossRef] [Green Version]
- Du, Q.H.; Peng, C.; Zhang, H. Polydatin: A review of pharmacology and pharmacokinetics. Pharm. Biol. 2013, 51, 1347–1354. [Google Scholar] [CrossRef] [PubMed]
- Vargas-Santos, A.B.; Peloquin, C.E.; Zhang, Y.; Neogi, T. Association of chronic kidney disease with allopurinol use in gout treatment. JAMA Intern. Med. 2018, 178, 1526–1533. [Google Scholar] [CrossRef] [Green Version]
- Ghane Sharbaf, F.; Assadi, F. Effect of allopurinol on the glomerular filtration rate of children with chronic kidney disease. Pediatr. Nephrol. 2018, 33, 1405–1409. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Chen, Y.; Wang, B.; Zhang, F.; Wang, D.; Wang, Y. Allopurinol treatment improves renal function in patients with type 2 diabetes and asymptomatic hyperuricemia: 3-year randomized parallel-controlled study. Clin. Endocrinol. 2015, 83, 475–482. [Google Scholar] [CrossRef]
- Doria, A.; Galecki, A.T.; Spino, C.; Pop-Busui, R.; Cherney, D.Z.; Lingvay, I.; Parsa, A.; Rossing, P.; Sigal, R.J.; Afkarian, M.; et al. Serum urate lowering with allopurinol and kidney function in type 1 diabetes. N. Engl. J. Med. 2020, 382, 2493–2503. [Google Scholar] [CrossRef] [PubMed]
- Badve, S.V.; Pascoe, E.M.; Tiku, A.; Boudville, N.; Brown, F.G.; Cass, A.; Clarke, P.; Dalbeth, N.; Day, R.O.; de Zoysa, J.R.; et al. Effects of allopurinol on the progression of chronic kidney disease. N. Engl. J. Med. 2020, 382, 2504–2513. [Google Scholar] [CrossRef] [PubMed]
- Mao, X.; Wang, T.; Liu, Y.; Irwin, M.G.; Ou, J.S.; Liao, X.L.; Gao, X.; Xu, Y.; Ng, K.F.; Vanhoutte, P.M.; et al. N-acetylcysteine and allopurinol confer synergy in attenuating myocardial ischemia injury via restoring HIF-1α/HO-1 signaling in diabetic rats. PLoS ONE 2013, 8, e68949. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; George, J.; Rocha, S. Dose-dependent effects of allopurinol on human foreskin fibroblast cells and human umbilical vein endothelial cells under hypoxia. PLoS ONE 2015, 10, e0123649. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.M.; Lee, S.H.; Kim, Y.G.; Kim, S.Y.; Seo, J.W.; Choi, Y.W.; Kim, D.J.; Jeong, K.H.; Lee, T.W.; Ihm, C.G.; et al. Hyperuricemia-induced NLRP3 activation of macrophages contributes to the progression of diabetic nephropathy. Am. J. Physiol. Renal. Physiol. 2015, 308, F993–F1003. [Google Scholar] [CrossRef] [PubMed]
ID | Sense Primer (5’→3’) | Antisense Primer (5’→3’) |
---|---|---|
HIF-1α (human) | ATCCATGTGACCATGAGGAAATG | TCGGCTAGTTAGGGTACACTTC |
β-actin (human) | CTACCTCATGAAGATCCTCACCGA | TTCTCCTTAATGTCACGCACGATT |
HIF-1α (rat) | CCTACTATGTCGCTTTCTTGG | TGTATGGGAGCATTAACTTCAC |
β-actin (rat) | GAGAGGGAAATCGTGCGT | GGAGGAAGAGGATGCGG |
HIF-1α siRNA | GCGAAGUAAAGAAUCUGAA | UUCAGAUUCUUUACUUCGC |
Group | Dose (mg/kg) | Serum | Urine | ||
---|---|---|---|---|---|
Uric Acid (μmol/L) | Creatinine (μmol/L) | Urea Nitrogen (mmol/L) | Creatinine (mmol/L) | ||
Normal control | - | 94.13 ± 3.90 | 81.08 ± 4.47 | 3.06 ± 0.05 | 19.68 ± 1.79 |
Fructose vehicle | - | 162.25 ± 9.29 +++ | 136.53 ± 7.72 +++ | 4.47 ± 0.18 +++ | 4.96 ± 0.40 +++ |
Polydatin | 7.5 | 157.63 ± 10.79 | 125.44 ± 9.10 | 3.98 ± 0.28 | 11.90 ± 0.59 *** |
Polydatin | 15 | 149.63 ± 9.95 | 113.59 ± 6.56 | 2.89 ± 0.15 *** | 16.12 ± 1.07 *** |
Polydatin | 30 | 116.25 ± 6.15 ** | 98.81 ± 7.33 ** | 2.69 ± 0.13 *** | 16.51 ± 0.99 *** |
Allopurinol | 5 | 117.00 ± 6.79 ** | 89.96 ± 3.24 *** | 2.55 ± 0.17 *** | 13.08 ± 0.43 *** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, H.; Tang, C.; Wang, W.; Pan, Y.; Jiao, R.; Kong, L. Polydatin Ameliorates High Fructose-Induced Podocyte Oxidative Stress via Suppressing HIF-1α/NOX4 Pathway. Pharmaceutics 2022, 14, 2202. https://doi.org/10.3390/pharmaceutics14102202
Ding H, Tang C, Wang W, Pan Y, Jiao R, Kong L. Polydatin Ameliorates High Fructose-Induced Podocyte Oxidative Stress via Suppressing HIF-1α/NOX4 Pathway. Pharmaceutics. 2022; 14(10):2202. https://doi.org/10.3390/pharmaceutics14102202
Chicago/Turabian StyleDing, Hong, Chuanfeng Tang, Wei Wang, Ying Pan, Ruiqing Jiao, and Lingdong Kong. 2022. "Polydatin Ameliorates High Fructose-Induced Podocyte Oxidative Stress via Suppressing HIF-1α/NOX4 Pathway" Pharmaceutics 14, no. 10: 2202. https://doi.org/10.3390/pharmaceutics14102202
APA StyleDing, H., Tang, C., Wang, W., Pan, Y., Jiao, R., & Kong, L. (2022). Polydatin Ameliorates High Fructose-Induced Podocyte Oxidative Stress via Suppressing HIF-1α/NOX4 Pathway. Pharmaceutics, 14(10), 2202. https://doi.org/10.3390/pharmaceutics14102202