Next Article in Journal
Predictive Factors and Clinical Markers of Recurrent Wheezing and Asthma After RSV Infection
Previous Article in Journal
Virome Survey of Banana Plantations and Surrounding Plants in Malawi
Previous Article in Special Issue
Thirteenth International Foamy Virus Conference—Meeting Report
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 17
Issue 8
10.3390/v17081072
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Simian Foamy Virus Prevalence and Evolutionary Relationships in Two Free-Living Lion Tamarin Populations from Rio de Janeiro, Brazil

by
Déa Luiza Girardi
1,
Thamiris Santos Miranda
1,
Matheus Augusto Calvano Cosentino
1,
Caroline Carvalho de Sá
2,
Talitha Mayumi Francisco
3,4,
Bianca Cardozo Afonso
4,
Flávio Landim Soffiati
3,4,
Suelen Sanches Ferreira
3,
Silvia Bahadian Moreira
5,
Alcides Pissinatti
5,
Carlos Ramon Ruiz-Miranda
3,4,
Valéria Romano
6,
Marcelo Alves Soares
2,
Mirela D’arc
1,* and
André Felipe Santos
1,*
1
Departamento de Genética, Universidade Federal do Rio de Janeiro, Rio de Janeiro 21941-617, RJ, Brazil
2
Programa de Genética e Virologia Tumoral, Instituto Nacional de Câncer (INCA), Rio de Janeiro 0230-130, RJ, Brazil
3
Associação Mico-Leão-Dourado, Silva Jardim, Rio de Janeiro 28820-000, RJ, Brazil
4
Campos dos Goytacazes, Laboratório de Ciências Ambientais, Centro de Biociências e Biotecnologia, Universidade Estadual do Norte Fluminense Darcy Ribeiro-UENF, Rio de Janeiro 28013-602, RJ, Brazil
5
Centro de Primatologia do Rio de Janeiro, Instituto Estadual do Ambiente, Guapimirim 25948-395, RJ, Brazil
6
IMBE, Aix Marseille University, Avignon University, CNRS, IRD, 13397 Marseille, France
*
Authors to whom correspondence should be addressed.
Viruses 2025, 17(8), 1072; https://doi.org/10.3390/v17081072
Submission received: 18 March 2025 / Revised: 15 July 2025 / Accepted: 18 July 2025 / Published: 31 July 2025
(This article belongs to the Special Issue Spumaretroviruses: Research and Applications)
Browse Figures
Review Reports Versions Notes

Abstract

Simian foamy virus (SFV) is a retrovirus that infects primates. However, epidemiological studies of SFV are often limited to captive populations. The southeastern Brazilian Atlantic Forest is home to both an endemic, endangered species, Leontopithecus rosalia, and an introduced species, Leontopithecus chrysomelas, to which no data on SFV exist. In this study, we assessed the molecular prevalence of SFV, their viral load, and their phylogenetic relationship in these two species of primates. Genomic DNA was extracted from 48 oral swab samples of L. chrysomelas and 102 of L. rosalia. Quantitative PCR (qPCR) was performed to diagnose SFV infection and quantify viral load. SFV prevalence was found to be 23% in L. chrysomelas and 33% in L. rosalia. No age-related differences in prevalence were observed; however, L. rosalia showed a higher mean viral load (3.27 log10/106 cells) compared to L. chrysomelas (3.03 log10/106 cells). The polymerase gene sequence (213 pb) of L. rosalia (SFVlro) was clustered within a distinct SFV lineage found in L. chrysomelas. The estimated origin of SFVlro dated back approximately 0.0836 million years ago. Our study provides the first molecular prevalence data for SFV in free-living Leontopithecus populations while offering insights into the complex evolutionary history of SFV in American primates.

1. Introduction

Simian foamy virus (SFV) is a retrovirus classified within the Simiispumavirus genus under the subfamily Spumaretrovirinae [1,2]. SFV was first described in 1954 [3] and isolated in 1955 [4], and, since then, numerous non-human primates have been described as hosts, including prosimians, Afro-Eurasian primates (formerly known as Old World primates) [5,6,7], and American primates (AP, formerly known as neotropical primates) [8,9,10,11]. AP are highly diverse, with approximately 187 species distributed within 23 genera under five families (Aotidae, Atelidae, Callitrichidae, Cebidae, and Pitheciidae), according to molecular analyses [12,13]. Among AP, the first SFV was detected in 1973, in a culture of brain cells from Ateles sp. [14]. Nevertheless, it was only after 34 years that the complete genome of this virus was obtained [15,16,17]. A total of 41 species of AP (~22% of the total number of AP) have molecular evidence of SFV infection; however only five of them have complete viral genomes sequenced [10]. The available sequences include, in addition to the one that infects Ateles sp. (SFVasp) [10,17], the SFV infecting Callithrix jacchus (SFVcja) [18], Sapajus xanthosternos (SFVsxa) [15], Brachyteles arachnoides (SFVbar) [16], and Saimiri sciureus (SFVssc) [18].
In terms of prevalence in AP, still little is known. It is estimated that the mean prevalence of SFV in captive AP ranges from 23 to 61% [8,11,14,19,20], and among the free-living AP, it ranges from 16 to 29% [8,9,20]. The scarce studies on natural SFV infections are a limiting factor in our understanding of the virus’ epidemiology [10]. Furthermore, although only a few complete and partial SFV genomes from AP are currently available in literature, phylogenetic analyses suggest that SFV generally follows a co-speciation model, as observed in Afro-Eurasian primates [7,9,11,20]. AP arrived in the Americas approximately 40 million years ago [21], diverging between 41.1–22.7 million years ago [21]. Due to the relatively recent speciation of AP and the ecological overlap among extant species—characterized by shared habitats—there is evidence of cross-species transmission events of SFV between AP species and genera [7,20,22,23].
Over 40% of AP species are endangered, including lion tamarins (genus Leontopithecus) [24]. The Leontopithecus genus is composed of four species: L. rosalia (golden lion tamarins), L. chrysomelas (golden-faced lion tamarins), L. chrysopygus (black lion tamarins), and L. caissara (black-faced lion tamarins) [25]. L. rosalia is endemic to the Atlantic Forest in Rio de Janeiro, Brazil [26]. They are arboreal and territorial primates, living in small familial groups. Classified as endangered by the International Union for Conservation of Nature in 2022 [13], the non-governmental organization Associação Mico-Leão-Dourado (AMLD) has been working since 1992 on the conservation of this species in Rio de Janeiro [27]. The L. rosalia population was considered almost extinct in 1960, a situation that led to the creation of the first biological reserve in Brazil, Poço das Antas. Since then, long-term research has been implemented to understand the behaviors of these primates [26]. In 1983, the reintroduction of captive-born primates began, and in 2003, the status of L. rosalia changed from critically endangered to endangered [28]. Nowadays, 19 groups of L. rosalia are monitored by AMLD in order to understand where and how they live [29].
L. chrysomelas also inhabit the Atlantic Forest, being native to the state of Bahia, Brazil, and are considered endangered in this location. Despite that, some L. chrysomelas have been found in the city of Niterói, Rio de Janeiro, Brazil, as a result of an introduction by a collector in the mid-1990s [28]. These primates have been established in fragments of the Atlantic Forest in this city, being considered an introduced species. In Niterói, free-living L. chrysomelas are monitored, captured, and transported to centers of preservation in their natural habitat in Bahia by institutions such as Centro de Primatologia do Rio de Janeiro (CPRJ), Fundação Pri-Matas, Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio), and Instituto Estadual do Ambiente (Inea) [27]. Leontopithecus primates usually feed from fruits, insects, and small vertebrates and may occasionally consume bird eggs [30]. L. rosalia usually live in groups composed of a breeding pair and their offspring, and their family groups are composed of seven individuals on average [26]. They are arboreal and can be found between 3 to 10 m above the ground and tend to sleep in tree holes abandoned by other species [30]. L. chrysomelas form groups of 4 to 8 individuals [31]. They are also arboreal and select tall forests for sleeping at night [32]. Both species have ecological importance and are threatened by deforestation, habitat fragmentation, illegal trafficking, and diseases. They also face threats in competition for territory and resources or exposure to pathogens due to interactions with other primate species, like those from the Callithrix genus [33]. Although there are studies demonstrating the infection and prevalence of SFV in lion tamarins, they are limited to a few individuals and/or captive animals [8,11,20,34]. The objective of this study is to describe new data on the prevalence of SFV in free-living L. rosalia and L. chrysomelas, as well their viral load and their phylogenetic relationship.

2. Materials and Methods

2.1. Sample Collection

We collected oral swabs from 102 individuals of L. rosalia (48 females and 54 males) in Silva Jardim and from 48 individuals of L. chrysomelas (19 females and 29 males) in Niterói, both cities in the state of Rio de Janeiro, Brazil. Captures of L. rosalia and L. chrysomelas were organized and managed by specialists of Associação Mico-Leão-Dourado (AMLD) and by the Centro de Primatologia do Rio de Janeiro (CPRJ), respectively, which have years of fieldwork experience. Sample collection occurred between February and September 2021 from animals that were habituated to human presence. Animals were captured individually with Tomahawk® traps with banana baits, as described in [35]. All captured tamarins from Silva Jardim/RJ were taken to the AMLD field laboratory for routine veterinary examinations before release. Free-living L. chrysomelas, after capture, were placed in appropriate enclosures until their transportation to centers of preservation in their natural habitat in Bahia at CPRJ. The collection was made immediately after the capture. Animals were anesthetized with an injection of ketamine (10–15 mg/kg) in the caudal region, and general information was collected for all sampled animals, such as identification number, group, species, age, sex, weight, and clinical conditions. While the animals were still anesthetized, samples of oral swabs were collected. Animals aged four to nine months were considered juveniles, nine to twelve months as subadults, and aged >twelve months as adults. For estimating age from animals whose birth dates were unknown, measurements such as body size and weight, identification pattern, and postnatal ossification were also used [36,37,38]. The health status of the animals was obtained through observations made by the veterinarians. They mainly observed respiratory conditions, animal weight, and the presence of dysbiosis.
This project was approved by the Ethics Committee on the Use of Animals (CEUA) of UFRJ (reference number 037/14). All procedures were conducted in full compliance with federal permits issued by the Brazilian Ministry of the Environment (SISBIO 75941-4), and samples were collected following the national guidelines and provisions of IBAMA (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis, Brazil; permanent license number 11375–1). We did not provide the geographic coordinates of individuals or groups for safety reasons.

2.2. Sample Processing and Analysis of Genomic DNA Integrity

Collected swabs were placed in 1.5 mL microcentrifuge tubes (Kasvi, Curitiba, PR, Brazil) containing 500 µL of RNAlater (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). All samples were stored at room temperature and sent to the Laboratory of Diversity and Viral Diseases (LDDV) at the Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil, to be stored at −80 °C until processing. Genomic DNA (gDNA) was extracted from oral swabs using the PureLink® Genomic DNA kit (ThermoFisher Scientific, Grand Island, NY, USA) according to the manufacturer’s specifications. After extraction, samples had their contaminants (PCR inhibitors) removed with the PureLink™ PCR Purification Kit (Invitrogen). Samples were then quantified using Nanodrop ND-1000 (ThermoFisher Scientific) and stored at −20 °C. gDNA integrity for PCR analysis was checked by PCR amplification of the mitochondrial constitutive gene cytochrome B (cytB), as previously described [8]. cytB-positive samples were considered suitable for performing quantitative real-time PCR (qPCR) diagnostic for AP SFV.

2.3. Diagnostic qPCR

As described by Muniz and collaborators [39], a qPCR assay was used to simultaneously detect and quantify AP SFV DNA of the oral mucosa epithelium cells, obtained through oral swabs. TaqMan (Thermo Fisher Scientific) was used with primers and a probe for the amplification of a 124 bp fragment located in the virus polymerase (pol) gene (integrase region) [39]. The construction of the standard curve was performed through serial dilutions of 108 down to 101 copies of a pCR4-TOPO plasmid containing an insert corresponding to a 6400 bp genomic fragment of the Saimiri SFV (SFVssc) containing the pol gene. The plasmid was purified with the QIAGEN™ Plasmid Midi Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol.
All reactions were set up in a total volume of 21 μL containing 10 μL of GoTaq® Probe qPCR Master Mix 20X (Promega, São Paulo, Brazil), 1 μL of primers and probe, and 10 μL of gDNA. Reactions were carried out in 96-well optical microtiter plates on a 7500 Real-Time PCR platform (Applied Biosystems, Waltham, MA, USA), following uniform cycling parameters previously described [34]. The sensitivity of the assay was 100 copies of SFV/reaction, as determined previously [34]. Samples with more than 100 viral copies per 106 cells were considered positive for SFV infection in the qPCR. To calculate the integrated viral load in 106 cells, the amount of DNA was converted from nanograms to picograms (pg) and multiplied by 1 million cells, with a cell having a mean of 6 pg of DNA [40].

2.4. PCR of the Pol Region

A nested PCR was performed to amplify a larger fragment of SFV pol in Leontopithecus for subsequent sequencing and phylogenetic analysis. The first PCR round aimed to amplify a 486 bp fragment of the pol gene, and the second round amplified a 404 bp fragment internal to the first round. The primers used were specific for SFV pol infecting the Cebidae and Callitrichidae families, and conditions were the same as those previously reported for other generic PCRs for SFV pol [11], as can be seen in the table below (Table 1). Successfully amplified fragments were purified with the E-Gel CloneWellTM (Invitrogen) according to manufacturer instructions.
Purified samples were submitted to sequencing using the Big Dye Terminator Cycle Sequencing kit v3.1 (Life Technologies, Van Allen Way, Carlsbad, CA, USA). The plate was precipitated and stored at −20 °C, protected from light until sequencing in an 3130XL genetic analyzer (Life Technologies, Foster City, CA, USA). The obtained sequences were assembled and edited in SeqMan 7.0 (DNASTAR, Madison, WI, USA).

2.5. Phylogenetic and Timescale Analyses

The assembled sequences were analyzed with the Basic Local Alignment Search Tool (BLAST) against the complete GenBank dataset available as of 1 September 2024. Up to 100 SFV pol sequences were retrieved, and, with the removal of identical sequences, a dataset of 90 sequences was built for subsequent evolutionary analyses. The SFV pol sequence of Prosimiispumavirus otocrafo (Brown greater galago prosimian foamy virus, accession number: NC_039023.1) was added to this dataset to root the phylogeny. Sequences were aligned with sequences representing different SFV strains, comprising a comprehensive dataset of 92 pol sequences with 213 nucleotide positions (Supplementary File S1, Supplementary Table S2).
Sequences were aligned with MAFFT v7.505 [41] and subsequently trimmed with TrimAl v.1.4 [42] with a gap threshold of 0.9, removing sites from alignments composed of gaps in 10% or more sequences. The multiple sequences alignment had its phylogenetical signal evaluated by the following analyses: likelihood mapping plots with a random sample of 1000 in IQ-Tree v.2.1.4 [43], alignment confidence inferred by the Guidance 2 webserver [44], and verification of substitution saturation with DAMBE v.7.3.32 [45]. Maximum likelihood trees were inferred with IQ-Tree v.2.1.4 [46], with the best fit model suggested by ModelFinder [47]. Node supports were estimated using the SH-type approximate likelihood ratio test (SH-aLRT) [48] and ultrafast bootstrap [49] with 10,000 replicates.
As the phylogenetic pattern for the SFV observed at the SFVlro clade was not consistent with the ancient within-species diversity model expected, we inferred a time-scaled phylogenetic tree using RelTime-ML [50,51,52] to obtain chronological information. This analysis was performed in MEGA11, and estimated host divergence dates were used to calibrate internal nodes of the viral tree, following [21]. The calibration dates were chosen considering the host evolutionary history, in points found in our SFV phylogeny, which mirrors the primates’ major splits found by Kuderna [21].
A Jukes–Cantor substitution model with a Gamma distribution, invariable rate variation model (JC+G4+I), and six calibration constraints were used to build the time tree. The ancestral node of the Macaca SFV was calibrated with a normal distribution centered at 5.49 million years ago (Mya) and a standard deviation of 0.35 (95% CI 4.9 to 6.08). Similarly, the ancestral clade of the Pongo SFV was calibrated with a normal distribution of mean 1.55 Mya and a standard deviation of 0.15 (95% CI 1.26 to 1.84). For the Pan SFV ancestral node, a calibration of 8.01 Mya with a standard deviation of 0.45 (95% CI 7.13 to 8.89) was applied. The shared ancestral node of the Pan and Pongo SFVs was calibrated at 20.32 Mya with a standard deviation of 0.85 (95% CI 18.65 to 21.99), while the shared ancestral node of the Cercopithecidae, Hylobatidae, and Hominidae SFVs was set to 31.08 Mya, with a standard deviation of 0.95 (95% CI 29.12 to 33.04). Finally, the ancestral node of Platyrrhini and Catarrhini SFVs was calibrated at 39.03 Mya, with a standard deviation of 1.1 (95% CI 36.87 to 41.19). All calibration points and standard deviations were calculated following [21].
The phylogenetic tree and time tree were visualized using ggtree v.3.10 [53] in R v.4.3.2. The original nucleotide dataset, final alignment file, generated tree files, and timescale files are provided in Supplementary File S1.

2.6. Statistical Analyses

Similar to Ref. [54], we applied linear mixed-effect models to test whether morphological variables (age, sex, and body weight) correlated with proviral load, including species as a random effect to control for pseudoreplication. The model was performed using the “lmer” function in the “lme4” package [55] in R. To evaluate the validity of the model, we performed a series of diagnostic tests, including assessments of residual homoscedasticity, normality of the data distribution, and variance inflation factors (VIF), which were consistently near or below 1. The diagnostic results confirmed that the data followed a normal distribution, and no influential observations were detected.

3. Results

3.1. Study Population

Oral swab samples were collected from 150 Leontopithecus specimens, 48 of which were L. chrysomelas housed at CPRJ, and 102 were L. rosalia captured at AMLD. While for L. rosalia, the distribution of samples was similar between sexes (48 females and 54 males), for L. chrysomelas, there was a predominance of samples from male animals (n = 29, 60%). The age categories were obtained for both species. In L. rosalia, a predominance of adults was observed (n = 48, 47%), as well as morphological information and field data, all described in Table 2. For the L. chrysomelas population, there was also a predominance of adults (n = 42, 87%).
The L. rosalia were in good physical condition, with a median weight of 521 g, and no changes were observed in the physical examination. L. chrysomelas were also in good condition and had a median weight of 603 g. All information is summarized in Table 2.

3.2. SFV Prevalence

All samples successfully underwent PCR amplification of the constitutive cytB gene and were deemed suitable for SFV diagnosis via qPCR. The overall prevalence of SFV infection in the Leontopithecus genus was 30% (45 cases of 150 total individuals). In L. chrysomelas, the overall prevalence of SFV was 23% (11/48, Figure 1A), with 31% of females (6/19) and 17% of males (5/29) testing positive (Figure 1B). The overall SFV prevalence of L. rosalia was 33% (34/102) (Figure 1A), with both females (16/48) and males (18/54) showing the same prevalence of 33% (Figure 1B). There was no statistical difference between SFV prevalence in L. rosalia and L. chrysomelas (X2 = 1.23, p = 0.27).
In both species, prevalence varied by age category. In L. chrysomelas, juveniles exhibited a 50% prevalence, though only two individuals were sampled, with a female infected and a male uninfected. Subadults also had a 50% prevalence, based on a sample of four individuals, with no females (n = 2) infected and the males (n = 2) testing positive. Adult females had a prevalence of 28% (5/18), while adults males had a prevalence of 8% (2/24). In the L. rosalia population, juveniles had a prevalence of 29% (9/31), subadults had 22% (5/23), and adults showed a prevalence of 42% (20/48) (Figure 1C). There was no signifincant difference in SFV prevalence between the age categories (X2 = 3.15, p = 0.21). When comparing the prevalence between females and males within each category for L. rosalia, juveniles showed a prevalence of 31% (4/13) in females and 26% (5/19) in males, with an overall prevalence of 29% (9/31). Among subadults, females had a prevalence of 17% (2/12), and males had 27% (3/11), with an overall prevalence of 22% (5/23). In adults, females had a prevalence of 43% (10/23), and males had 40% (10/25), with an overall adult prevalence of 42% (20/48). L. rosalia individuals were organized into groups at different geographic locations, and, in this study, animals belonging to 12 locations and 31 groups were sampled. The prevalence varied between 0% to 100% in the collection points (Figure 2 and Table 3). Most of the collections happened in the municipality of Silva Jardim—RJ, and one collection happened in Rio Bonito—RJ (Figure 2). Some of the points were well sampled, as were the cases of Afetiva, with 26 animals, and Nova Esperança, with 19 animals, while others were poorly represented, as in the cases of Ribeirão, Sítio Quelinho, and Tertúlio, which had only two animals sampled (Table 3). The mean viral load per location ranged from 2.74 log to 4.56 log (Table 3). The collection points that had the largest number of sampled groups were Afetiva, Nova Esperança, and Rio Vermelho, with six, five, and four groups, respectively (Supplementary File S1, Table S1). One of Afetiva’s groups, Afetiva 2, was the most sampled, with 12 animals. In total, 31 groups were represented, belonging to 12 locations (Supplementary File S1, Table S1). The average viral load varied between 1.88 log to 4.34 log (Supplementary File S1, Table S1).
Information regarding SFV prevalence and viral load according to the location of data collection for Leontopithecus rosalia can be found in Supplementary File S1 and Supplementary Table S1.

3.3. SFV Viral Load

We observed a mean viral load of 4.37 log copies per 106 cells (log10 3.03; range: 1.29 log to 5.89 log). In L. rosalia, the mean SFV viral load was 4.48 log per 106 cells (log 3.17; range: 1.43 log to max 5.89 log), while in L. chrysomelas, the mean SFV viral load was 4.37 log copies per 106 cells (log10 3.03; range: 1.29 log to 3.30 log) (Figure 3A). While the maximum viral load in L. chrysomelas was 3.3 log, in L. rosalia, 17 individuals had viral loads exceeding 3.3 log, with 12 of them above 3.5 log and 7 above 4. Finally, our linear mixed-effect models revealed that any of the morphological traits (age, sex, or body weight) significantly explained viral load in our studied species (Table 4). However, the random effect of species showed a significant contribution (p = 0.007), suggesting differences in the SFV viral load per species.

3.4. Phylogenetic and Timescale Analyses

All samples positive for SFV infection in the qPCR diagnosis (n = 50), 34 from L. rosalia and 16 from L. chrysomelas, were subjected to PCR of the larger fragment of pol. However, only three samples of L. chrysomelas and one sample of L. rosalia had that fragment successfully amplified and were thus directed to sequencing. Only one of the positive samples analyzed, a sample from L. rosalia, had the sequence successfully determined (MP261), generating a 213 bp DNA fragment (GenBank accession number: PP960560).
The multiple sequences alignment passed tests of phylogenetical signal with satisfactory results. Although 63.1% of quartets in the likelihood mapping analysis were resolved into distinct topologies (Supplementary Table S3, Supplementary Figure S1), a robust phylogenetic signal was evidenced by minimal substitution saturation (Iss < Iss.c, Supplementary Table S4) and high alignment confidence (GUIDANCE2 = 0.995, Supplementary Figure S2). The maximum likelihood phylogeny inferred recovered a topology consistent with previously proposed SFV, with most host-specific viral lineages inferred with high support values (SH-aLRT  > 75, UFBoot > 75). The L. rosalia-generated sequence grouped with the SFV of the Cebidae and Callitrichidae families, close to another sequence from L. rosalia (SFVlro; GenBank accession number: PP960560) as expected, forming a clade of SFVlro with strong support (SH-aLRT  > 98.8, UFBoot > 100). However, it did not form a sister clade with either of the two circulating L. chrysomelas SFV lineages (SFVlchrysom) (Figure 4A). The phylogeny of SFV infecting the Cebidae and Callitrichidae families can be further visualized in Figure 4B.
While our phylogeny inferred the SFV infecting Afro-Eurasian primates as a clade within each of the host families that they infected, we did not observe the same happening in the SFV infecting AP. For instance, the SFV infecting the family Pitheciidae did not form a clade in our analysis. Also, we observed the presence of two lineages of SFV circulating both in the Sapajus and Leontopithecus genera. Although the SFV families were mixed in the AP, we observed clades in each SFV lineage. The SFV infecting the Leontopithecus genus always formed a sister clade of SFV from the Cebidae or Callitrichidae family.
Considering this unique pattern, a timescale phylogenetic tree was obtained using the RelTime-ML method (Figure 5). The SFV found in OWP served as calibration points, using its host divergence dates to calibrate internal nodes of the viral tree. The L. rosalia SFV sequence obtained in this work had an origin calculated to be 0.0836 Mya, indicating a recent circulation among L. rosalia. The SFVlro shared recent ancestors with Sapajus SFV (0.7071 Mya) and L. chrysomelas SFV 1 (1.1471 Mya), belonging to an older monophyletic lineage of Cebidae SFV (3.79 Mya). A similar pattern was found for the L. chrysomelas SFV 2, which shared an ancestor with Sapajus nigritus SFV (2.4733 Mya) and was a sister clade to a lineage of Callithrix SFV (3.652 Mya). Interestingly, a pattern of the host switching between Callitrichidae and Cebidae was observed, as the monophyletic lineage of all Callitrichidae SFV and Cebidae SFV (4.2332 Mya) was not exclusive to either host family. Node dates and confidence intervals of major clades of SFV can be found in Supplementary Table S5.

4. Discussion

Despite the high diversity and broad geographic distribution of American primates [56], data on the prevalence of viral agents, including simian foamy virus (SFV), remain scarce—especially in free-living populations. SFVs are widely disseminated retroviruses known to coevolve with their primate hosts [7]. In this study, we reported the prevalence, the viral load, and the phylogenetic relationship of SFV in free-living populations of L. chrysomelas and L. rosalia. [8,11,34]. Our results showed that the proviral load was distinct between species, but any of the studied morphological trait (age, body weight, and sex) significantly predicted it. The observed prevalence rates aligned with previous reports, which ranged between 20% and 50% in free-living American primates [8,11,34]. This difference may be explained by the low number of L. chrysomelas collected. SFV prevalence in free-living L. chrysomelas was comparable to that observed in recently captured captive individuals [11]: the prevalence was similar, either in the comparison of individuals with up to six months of captivity (p = 0.72) or those that were in captivity for more than six months (p = 0.13). Consistent with findings in both Afro-Eurasian primates and American primates, no significant sex-related differences in SFV prevalence were observed, indicating that sex does not influence transmission [11,34,57].
Hood and collaborators [58] reported that SFV prevalence increases with age in Macaca fascicularis, likely due to the chronic nature of SFV infection and cumulative exposure over time [20,59]. To explore this trend, we compared SFV prevalence among juveniles, subadults, and adults. In L. rosalia, we found similar results, with the prevalence ranging from 29% in juveniles to 42% in adults. In L. chrysomelas, we observed 50% in both juveniles and subadults and 17% in adults. However, the small sample sizes for juveniles (n = 2) and subadults (n = 4) may have limited the reliability of these estimates. In general, there was a high variability in SFV prevalence among the collection points sampled in Silva Jardim and Rio Bonito. The L. rosalia population was distributed in 13 management units, in an area of approximately 4500 km2 of lowland Atlantic coastal rainforest. In 2019, AMLD detected 24 social groups [60,61]. The dispersion of L. rosalia occurs more frequently from small and nearby fragments than from large, isolated forests. That being so, a fragmented landscape may lead to low dispersal rates [62]. The population dynamics and viability were highly affected by dispersion [61]. The L. chrysomelas population of this study was present in a fragmentated habitat, near urban areas in Niterói-RJ, and their interaction with humans and domestic animals was already registered [61].
We attempted to correlate the geospatial arrangement of L. rosalia with SFV prevalence, assuming that nearby groups would have a similar prevalence, but due to the small sample size of each group, it was not possible to conduct a robust statistical analysis. With the provided data, we also observed the prevalence in each group within each of the AMLD animal collection points. Some points were better represented than others, as was the case at the Afetiva collection point (Table 4). On the other hand, at other collection points, sampling probably did not represent the local population, such as at the Sítio Quelinho and Andorinha points, with samples from a single group of two and four animals, respectively.
The sensitivity of qPCR was between 10–60% for 1 copy of DNA and 90–100% for 20 copies, comparable with serological tests [34]. For phylogenetic analysis, a conventional PCR of the pol region was carried out, and 8% (4 out of 45) of the positive samples for SFV were amplified. Such limited PCR amplification success may be indicative of a great genetic variability of SFV strains circulating among this group of animals. The pol PCR was developed with the few available complete sequences of SFV infecting American primates, which included SFV from Sapajus, Callithrix, and Leontopithecus [11]. In this sense, the primers used may not comprise the diversity of SFVs present in these families of primates, a major limitation for this study of molecular characterization by conventional methods. The diversity in the pol region could reach 54% when comparing the SFVs infecting different species of American primates [34]. The few available partial pol sequences of SFV infecting the Leontopithecus genus, only 13, made it difficult to obtain the design of specific primers. Furthermore, the efficiency of the primers used to amplify a larger fragment of pol was usually low [8,11]. Besides that, gDNA concentrations in the PCR-positive samples were low (5.9–7.5 ng/μL). In the only successfully sequenced fragment, only the forward primer generated usable data, yielding a 213 bp sequence, and further Sanger sequencing attempts failed. Future studies using high-throughput sequencing may be more effective for these divergent SFV strains. As new strains of SFV were sequenced, an improvement in molecular techniques for detecting this virus was warranted. The only SFV sequence of L. rosalia obtained formed a clade with a previous SFVlro sequence from a captive L. rosalia specimen from the Rio de Janeiro Primate Center obtained in the study by Muniz and collaborators [20]. However, there was no grouping with any clade of the SFVlcm lineages, which would be expected by the co-divergence hypothesis. The identification of two circulating strains in L. chrysomelas was observed in [11], in which viral strains SFVlcm-1 and SFVlcm-2 were identified. In agreement with what was found in Muniz et al. [8], we also observed two clades of SFV infecting the Sapajus genus. This recurrent pattern of multiple SFV strains found within a distinct genus of NP can imply a more complex scenario than the expected co-divergence hypothesis. Ghersi et al. [9] considered this as a dynamic co-speciation between SFV and their hosts in AP, with ancient cross-genus transmissions of SFV as the cause of this unique pattern within AP SFV. The sequencing of larger regions of pol and/or other viral genes of SFVs infecting AP will allow more robust phylogenetic analyses for the understanding of the evolution of SFV in AP.
Despite the small generated fragment (213 bp), considerations of the dynamics of the evolution of SFV could be investigated using molecular dating techniques. However, since the sequence generated was short compared to the pol gene (approximately 3440 bp), testing such hypotheses is challenging, and there must be caution. In our timescale, the SFVlro shared recent ancestors with Sapajus SFV (0.7071 Mya) and L. chrysomelas SFV 1 (1.1471 Mya), indicating a recent circulation among those species. Even more, all Callitrichidae SFV and Cebidae SFV shared an ancestor strain dated to 4.2332 Mya. Such molecular dating matches with the timescale phylogeny of Ghersi et al. [9], where Callithrix and Cebidae SFVs were dated to ~4.36 Mya (3.08–6.06). Both analyses presented a more recent ancestor than the ones found previously by our group (7.94 Mya 5.17–14.05) [20]. Nevertheless, all time trees seemed like a consensus that the split of this SFV lineage happened much later than the Callithrix and Cebidae host split [~20.70 Ma (95% HPD = 19.02–22.41) [21], possibly representing cross-genus transmission between the hosts. Further studies focused on the diagnosis, genomic sequencing, and evolutionary modeling of SFV naturally infecting wild populations are key to understanding such unique dynamics within the AP SFV.

5. Conclusions

In conclusion, we reported the prevalence, the proviral load, and the phylogenetic relationship of SFV in free-living populations of L. rosalia and L. chrysomelas. We did not observe a significant difference in SFV prevalence, but we did on the proviral load, according to the species. Proviral load was not influenced by sex, age category, or body weight. We also did not observe a relationship between the geographic distribution of samples from Leontopithecus rosalia and SFV prevalence. The clustering of SFVlro with the SFV from Sapajus may be the result of one or more interspecies transmission events. Further molecular and phylogenetic analyses would be necessary to shed light on this issue.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v17081072/s1. Supplementary File S1: Figure S1: Likelihood mapping plots of used aligned. Figure S2: GUIDANCE2 alignment confidence. Figure S3: Complete timescale phylogenetic tree generated by RelTime-ML. Estimated host divergence dates were used to calibrate internal nodes of the viral tree. The node labels are colored according to the host family used in the dataset. The sequence generated in the current study is marked with a golden star. The x-axis summarizes the geological time scale of the timetree: Oligocene (Ol), Miocene (Mio), Plioceno (Pli) and Pleistocene (Ple). Table S1: SFV prevalence and viral load according to the location of data collection to Leontopithecus rosalia. Table S2: SFV sequences used to characterize the novel SFVlro. Table S3: Likelihood mapping plot values used, aligned. Table S4: Test of substitution saturation performed in all sites. Table S5: Node dates and confidence intervals of major clades of SFV inferred in this study. The final alignment and tree files are only available at github.

Author Contributions

Conceptualization, A.F.S., M.D. and M.A.S.; methodology, D.L.G., T.S.M., M.A.C.C., T.M.F., M.D., B.C.A., F.L.S., S.S.F., S.B.M., A.P. and C.R.R.-M.; validation, T.M.F., M.D., B.C.A., F.L.S., S.S.F., S.B.M., A.P. and C.R.R.-M.; formal analysis, D.L.G., C.C.d.S., T.S.M., M.A.C.C., A.F.S., V.R. and M.D.; investigation, D.L.G., T.S.M. and M.A.C.C.; resources, A.F.S., M.D. and M.A.S.; data curation, D.L.G., T.S.M., M.A.C.C., T.M.F., M.D., B.C.A., F.L.S., S.S.F., S.B.M., A.P. and C.R.R.-M.; writing—original draft preparation, D.L.G., T.S.M., A.F.S. and M.D.; writing—review and editing, D.L.G., T.S.M., T.M.F., C.C.d.S., A.P., C.R.R.-M., M.A.S., M.D., V.R. and A.F.S.; supervision, M.D. and A.F.S.; project administration, M.D. and A.F.S.; funding acquisition, A.F.S. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Rio de Janeiro State Science Foundation (FAPERJ), grants E-26/211.355/2021 and E-26/201.193/2022, to A.F.S. and by the National Research Council (CNPq), grant 309850/2020-7 to M.A.S.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee on the Use of Animals (CEUA) of UFRJ (reference number 037/14). All procedures were conducted in full compliance with federal permits issued by the Brazilian Ministry of the Environment (SISBIO 75941-4), and samples were collected following the national guidelines and provisions of IBAMA (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis, Brazil; permanent license number 11375–1).

Informed Consent Statement

Not applicable.

Data Availability Statement

The sequence generated in the present work was submitted to Genbank under the accession number PP960560.

Acknowledgments

We thank the field team of the Associação do Mico-Leão-Dourado (AMLD) and Centro de Primatologia do Rio de Janeiro (CPRJ) for providing samples and demographic data.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kehl, T.; Tan, J.; Materniak, M. Non-Simian Foamy Viruses: Molecular Virology, Tropism and prevalence and Zoonotic/Interspecies Transmission. Viruses 2013, 5, 2169–2209. [Google Scholar] [CrossRef]
  2. Khan, A.S.; Bodem, J.; Buseyne, F.; Gessain, A.; Johnson, W.; Kuhn, J.H.; Kuzmak, J.; Lindemann, D.; Linial, M.L.; Löchelt, M.; et al. Spumaretroviruses: Updated Taxonomy and Nomenclature. Virology 2018, 516, 158–164. [Google Scholar] [CrossRef]
  3. Enders, J.F.; Peebles, T.C. Propagation in Tissue Cultures of Cytopathogenic Agents from patients with Measles. Proc. Soc. Exp. Biol. Med. 1954, 86, 277–286. [Google Scholar] [CrossRef]
  4. Rustigian, R.; Johnston, P.; Reihart, H. Infection of Monkey Kidney Tissue Cultures with Virus-like Agents. Proc. Soc. Exp. Biol. Med. 1955, 88, 8–16. [Google Scholar] [CrossRef]
  5. Hashimoto-Gotoh, A.; Yoshikawa, R.; Nakagawa So and Okamoto, M.; Miyazawa, T. Phylogenetic Analyses Reveal That Simian Foamy Virus isolated from Japanese Yakushima Macaques (Macaca fuscata yakui) Is from Most of Japanese Hondo Macaques (Macaca fuscata). Gene 2020, 734, 144382. [Google Scholar] [CrossRef] [PubMed]
  6. Shankar, A.; Sibley, S.D.; Goldberg, T.L.; Switzer, W.M. Molecular Analysis of the Complete Genome of a Simian Foamy Virus Hylobates pileatus (Pileated Gibbon) Reveals Ancient-Evolution with Lesser Apes. Viruses 2019, 11, 605. [Google Scholar] [CrossRef] [PubMed]
  7. Switzer, W.M.; Salemi, M.; Shanmugam, V.; Gao, F.; Cong, M.E.; Kuiken, C.; Bhullar, V.; Beer, B.E.; Vallet, D.; Gautier-Hion, A.; et al. Ancient Co-Speciation of Simian Foamy Viruses and Primates. Nature 2005, 434, 376–380. [Google Scholar] [CrossRef] [PubMed]
  8. Muniz, C.P.; Troncoso, L.L.; Moreira, M.A.; Soares, E.A.; Pissinatti, A.; Bonvicino, C.R.; Seuánez, H.N.; Sharma, B.; Jia, H.; Shankar, A.; et al. Identification and Characterization of Highly Divergent Simian Viruses in a Wide Range of New World Primates from Brazil. PLoS ONE 2013, 8, e67568. [Google Scholar] [CrossRef]
  9. Ghersi, B.M.; Jia, H.; Aiewsakun, P.; Katzourakis, A.; Mendoza, P.; Bausch, D.G.; Kasper, M.R.; Montgomery, J.M.; Switzer, W.M. Wide Distribution and Ancient Evolutionary History of Simian Viruses in New World Primates. Retrovirology 2015, 12, 89. [Google Scholar] [CrossRef]
  10. Santos, A.F.; Cavalcante, L.T.F.; Muniz, C.P.; Switzer, W.M.; Soares, M.A. Simian Foamy Viruses in Central and South America: A New World of Discovery. Viruses 2019, 11, 967. [Google Scholar] [CrossRef]
  11. Miranda, T.S.; Muniz, C.P.; Moreira, S.B.; Bueno, M.G.; Kierulff, M.C.M.; Molina, C.V.; Catão-Dias, J.L.; Pissinatti, A.; Soares, M.A.; Santos, A.F. Eco-Epidemiological Profile and Molecular Characterization of simian Foamy Virus in a Recently-Captured Invasive Population of Leontopithecus chrysomelas (Golden-Headed Lion Tamarin) in Rio de Janeiro, Brazil. Viruses 2019, 11, 931. [Google Scholar] [CrossRef] [PubMed]
  12. Schrago, C.G.; Menezes, A.N.; Furtado, C.; Bonvicino, C.R.; Seuanez, H.N. Multispecies Coalescent Analysis of the Early Diversification of neotropical Primates: Phylogenetic Inference under Strong Gene/Species Tree Conflict. Genome Biol. Evol. 2014, 6, 3105–3114. [Google Scholar] [CrossRef] [PubMed]
  13. IUCN/SSC Primates-Specialist Group. Available online: http://www.primate-sg.org/ (accessed on 10 February 2025).
  14. Hooks, J.J.; Gibbs, C.J., Jr.; Chou, S.; Howk, R.; Lewis, M.; Gajdusek, D.C. Isolation of a New Simian Foamy Virus from a Spider Monkey Brain. Infect. Immun. 1973, 8, 804–813. [Google Scholar] [CrossRef] [PubMed]
  15. Troncoso, L.L.; Muniz, C.P.; Siqueira, J.D.; Curty, G.; Schrago, C.G.; Augusto, A.; Fedullo, L.; Soares, M.A.; Santos, A.F. Characterization and Comparative Analysis of a Simian Foamy Virus Genome Isolated from Brazilian Capuchin Monkeys. Virus Res. 2015, 208, 1–6. [Google Scholar] [CrossRef]
  16. Muniz, C.P.; Cavalcante, L.T.F.; Dudley Dawn, M.; Pissinatti, A.; O’Connor, D.H.; Santos André, F.; Soares, M.A. First Complete Genome Sequence of a Simian Foamy Virus Infecting the Neotropical Primate Brachyteles arachnoides. Microbiol. Resour. Announc. 2018, 7, e00839-18. [Google Scholar] [CrossRef]
  17. Thümer, L.; Rethwilm, A.; Holmes, E.C.; Bodem, J. The Complete Nucleotide Sequence of a New World Simian Foamy Virus. Virology 2007, 369, 191–197. [Google Scholar] [CrossRef]
  18. Pacheco, B.; Finzi, A.; McGee-Estrada, K.; Sodroski, J. Species-Specific Inhibition of Foamy Viruses from South American by New World Monkey TRIM5α Proteins. J. Virol. 2010, 84, 4095–4099. [Google Scholar] [CrossRef]
  19. Marczynska, B.; Jones, C.J.; Wolfe, L.G. Syncytium-Forming Virus of Common Marmosets (Callithrix jacchus). Infect. Immun. 1981, 31, 1261–1269. [Google Scholar] [CrossRef]
  20. Muniz, C.P.; Jia, H.; Shankar, A.; Troncoso, L.L.; Augusto, A.M.; Farias, E.; Pissinatti, A.; Fedullo, L.P.; Santos, A.F.; Soares, M.A.; et al. An Expanded Search for Simian Foamy Viruses (SFV) in Brazilian World Primates Identifies Novel SFV Lineages and Host-Related Infections. Retrovirology 2015, 12, 94. [Google Scholar] [CrossRef]
  21. Kuderna, L.F.K.; Gao, H.; Janiak, M.C.; Kuhlwilm, M.; Orkin, J.D.; Bataillon, T.; Manu, S.; Valenzuela, A.; Bergman, J.; Rousselle, M.; et al. A Global Catalog of Whole-Genome Diversity from 233 Primate. Science 2023, 380, 906–913. [Google Scholar] [CrossRef]
  22. Katzourakis, A.; Aiewsakun, P.; Jia, H.; Wolfe, N.D.; LeBreton, M.; Yoder, A.D.; Switzer, W.M. Discovery of Prosimian and Afrotherian Foamy Viruses and Potential Species Transmissions amidst Stable and Ancient Mammalian-Evolution. Retrovirology 2014, 11, 61. [Google Scholar] [CrossRef] [PubMed]
  23. Chen, Y.; Zhang, Y.-Y.; Wei, X.; Cui, J. Multiple Infiltration and Cross-Species Transmission of Foamy across the Paleozoic to the Cenozoic Era. J. Virol. 2021, 95, e0048421. [Google Scholar] [CrossRef] [PubMed]
  24. IUCN/SSC Primates-Specialist Group. Global Non-Human Primate Diversity. 2023. Available online: http://www.primate-sg.org/primate_diversity_by_region/ (accessed on 13 April 2025).
  25. Meyer, A.L.S.; Pie, M.R.; Passos, F.C. Assessing the Exposure of Lion Tamarins (Leontopithecus spp.) to future Climate Change. Am. J. Primatol. 2014, 76, 551–562. [Google Scholar] [CrossRef]
  26. Kierulff, M.C.M.; Ruiz-Miranda, C.R.; de Oliveira, P.P.; Beck, B.B.; Martins, A.; Dietz, J.M.; Rambaldi, D.M.; Baker, A.J. The Golden Lion Tamarin Leontopithecus rosalia: A Success Story. Int. Zoo Yearbook 2012, 46, 36–45. [Google Scholar] [CrossRef]
  27. Associação Mico-Leão-Dourado. Conectando Florestas Para Salvar a Espécie 2024. Available online: https://micoleao.org.br/ (accessed on 12 August 2024).
  28. Associação Mico-Leão-Dourado. Publicações. Available online: https://micoleao.org.br/publicacoes/ (accessed on 12 August 2024).
  29. Associação Mico-Leão-Dourado Manejo. Available online: https://micoleao.org.br/manejo/ (accessed on 12 August 2024).
  30. Kleiman, D.G. Leontopithecus rosalia. Mamm. Species 1981, 148, 1–7. [Google Scholar] [CrossRef]
  31. Oliveira, L.C.; Neves, L.G.; Kierulff, M.C.M.; Jerusalinsky, L.; Mittermeier, R.A.; Rylands, A.B. Leontopithecus chrysomelas (Amended Version of 2020 Assessment). The IUCN Red List of Threatened Species. e.T40643A192327573, 2307-8235. 2021. Available online: https://www.iucnredlist.org/species/40643/192327573 (accessed on 20 August 2024).
  32. Raboy, B.E.; Christman, M.C.; Dietz, J.M. The Use of Degraded and Shade Cocoa Forests by Endangered Golden-Headed Lion Tamarins Leontopithecus chrysomelas. Oryx 2004, 38, 75–83. [Google Scholar] [CrossRef]
  33. Ruiz-Miranda, C.R.; Affonso, A.G.; de Morais, M.M.; Verona, C.E.; Martins, A.; Beck, B.B. Behavioral and Ecological Interactions between Reintroduced Lion Tamarins (Leontopithecus rosalia Linnaeus, 1766) and introduced Marmosets (Callithrix spp, Linnaeus, 1758) in Brazil’s Coast Forest Fragments. Braz. Arch. Biol. Technol. 2006, 49, 99–109. [Google Scholar] [CrossRef]
  34. Muniz, C.P.; Zheng, H.Q.; Jia, H.; Cavalcante, L.T.F.; Augusto, A.M.; Fedullo, L.P.; Pissinatti, A.; Soares, M.A.; Switzer, W.M.; Santos, A.F. A Non-Invasive Specimen Collection Method and a Novel Simian Virus (SFV) DNA Quantification Assay in New World Reveal Aspects of Tissue Tropism and Improved SFV. PLoS ONE 2017, 12, e0184251. [Google Scholar] [CrossRef]
  35. Dos Santos Miranda, T.; Schiffler, F.B.; D’arc, M.; Moreira, F.R.R.; Cosentino, M.A.C.; Coimbra, A.; Mouta, R.; Medeiros, G.; Girardi, D.L.; Wanderkoke, V.; et al. Metagenomic Analysis Reveals Novel Dietary-Related Viruses in the gut Virome of Marmosets Hybrids (Callithrix jacchus x callithrix), Brazil. Virus Res. 2023, 325, 199017. [Google Scholar] [CrossRef]
  36. Ruiz-Miranda, C.R.; Kleiman, D.G.; Dietz, J.M.; Moraes, E.; Grativol, A.D.; Baker, A.J.; Beck, B.B. Food Transfers in Wild and Reintroduced Golden Lion Tamarins, Leontopithecus rosalia. Am. J. Primatol. 1999, 48, 305–320. [Google Scholar] [CrossRef]
  37. Dietz, J.M.; Baker, A.J.; Miglioretti, D. Seasonal Variation in Reproduction, Juvenile Growth, and Adult Mass in Golden Lion Tamarins (Leontopithecus rosalia). Am. J. Primatol. 1994, 34, 115–132. [Google Scholar] [CrossRef]
  38. Rylands, A.B. Marmosets and Tamarins: Systematics, Behaviour, and Ecology; Oxford University Press: Oxford, UK, 1993. [Google Scholar]
  39. Muniz, C.P.; Cavalcante, L.T.F.; Jia, H.; Zheng, H.; Tang, S.; Augusto, A.M.; Pissinatti, A.; Fedullo, L.P.; Santos, A.F.; Soares, M.A.; et al. Zoonotic Infection of Brazilian Primate Workers with New World Foamy Virus. PLoS ONE 2017, 12, e0184502. [Google Scholar] [CrossRef]
  40. Tandon, R.; Cattori, V.; Gomes-Keller, M.A.; Meli, M.L.; Golder, M.C.; Lutz, H.; Hofmann-Lehmann, R. Quantitation of Feline Leukaemia Virus Viral and Proviral Loads by TaqMan Real-Time Polymerase Chain Reaction. J. Virol. Methods 2005, 130, 124–132. [Google Scholar] [CrossRef]
  41. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
  42. Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. TrimAl: A Tool for Automated Alignment Trimming in Large-Scale Analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef] [PubMed]
  43. Strimmer, K.; Von Haeseler, A. Likelihood-Mapping: A Simple Method to Visualize Phylogenetic Content of a Sequence Alignment. Proc. Natl. Acad. Sci. USA 1997, 94, 6815–6819. [Google Scholar] [CrossRef]
  44. Sela, I.; Ashkenazy, H.; Katoh, K.; Pupko, T. GUIDANCE2: Accurate Detection of Unreliable Alignment Regions Accounting for the Uncertainty of Multiple Parameters. Nucleic Acids Res. 2015, 43, W7–W14. [Google Scholar] [CrossRef]
  45. Xia, X. DAMBE6: New Tools for Microbial Genomics, Phylogenetics, and Molecular Evolution. J. Hered. 2017, 108, 431–437. [Google Scholar] [CrossRef]
  46. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  47. Kalyaanamoorthy, S.; Minh, B.Q.; Wong Thomas, K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
  48. Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New Algorithms and Methods to Estimate Maximum-Likelihood: Assessing the Performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef]
  49. Minh, B.Q.; Nguyen, M.A.T.; von Haeseler, A. Ultrafast Approximation for Phylogenetic Bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
  50. Tamura, K.; Tao, Q.; Kumar, S. Theoretical Foundation of the RelTime Method for Estimating Times from Variable Evolutionary Rates. Mol. Biol. Evol. 2018, 35, 1770–1782. [Google Scholar] [CrossRef]
  51. Tamura, K.; Battistuzzi, F.U.; Billing-Ross, P.; Murillo, O.; Filipski, A.; Kumar, S. Estimating Divergence Times in Large Molecular Phylogenies. Proc. Natl. Acad. Sci. USA 2012, 109, 19333–19338. [Google Scholar] [CrossRef]
  52. Mello, B.; Tao, Q.; Tamura, K.; Kumar, S. Fast and Accurate Estimates of Divergence Times from Big Data. Mol. Biol. Evol. 2017, 34, 45–50. [Google Scholar] [CrossRef]
  53. Yu, G.; Smith, D.K.; Zhu, H.; Guan, Y.; Lam, T.T.-Y. Ggtree: An r Package for Visualization and Annotation of phylogenetic Trees with Their Covariates and Other Associated. Methods Ecol. Evol. 2017, 8, 28–36. [Google Scholar] [CrossRef]
  54. Ripley, B.D. The R Project in Statistical Computing. MSOR Connect. 2001, 1, 23–25. [Google Scholar] [CrossRef]
  55. Bates, D.; Maechler, M.; Bolker, B.; Walker, S.; Christensen, R.H.B.; Singmann, H.; Dai, B.; Scheipl, F.; Grothendieck, G.; Green, P.; et al. Package “Lme4”. Convergence 2015, 12, 2. [Google Scholar]
  56. Estrada, A.; Garber, P.A.; Rylands, A.B.; Roos, C.; Fernandez-Duque, E.; Di Fiore, A.; Nekaris, K.A.-I.; Nijman, V.; Heymann, E.W.; Lambert, J.E.; et al. Impending Extinction Crisis of the World’s Primates: Why Primates. Sci. Adv. 2017, 3, e1600946. [Google Scholar] [CrossRef] [PubMed]
  57. Mouinga-Ondémé, A.; Kazanji, M. Simian Foamy Virus in Non-Human Primates and Cross-Species to Humans in Gabon: An Emerging Zoonotic Disease in central Africa? Viruses 2013, 5, 1536–1552. [Google Scholar] [CrossRef] [PubMed]
  58. Hood, S.; Mitchell, J.L.; Sethi, M.; Almond, N.M.; Cutler, K.L.; Rose, N.J. Horizontal Acquisition and a Broad Biodistribution Typify Simian Foamy Virus Infection in a Cohort of Macaca fascicularis. Virol. J. 2013, 10, 326. [Google Scholar] [CrossRef]
  59. Blasse, A.; Calvignac-Spencer, S.; Merkel, K.; Goffe, A.S.; Boesch, C.; Mundry, R.; Leendertz, F.H. Mother-Offspring Transmission and Age-Dependent Accumulation of Simian Foamy Virus in Wild Chimpanzees. J. Virol. 2013, 87, 5193–5204. [Google Scholar] [CrossRef]
  60. Ruiz-Miranda, C.R.; de Morais, M.M., Jr.; Dietz, L.A.; Rocha Alexandre, B.; Martins, A.F.; Ferraz, L.P.; Mickelberg, J.; Hankerson, S.J.; Dietz, J.M. Estimating Population Sizes to Evaluate Progress in conservation of Endangered Golden Lion Tamarins (Leontopithecus rosalia). PLoS ONE 2019, 14, e0216664. [Google Scholar] [CrossRef]
  61. Moraes, A.M.; Ruiz-Miranda, C.R.; Galetti Jr, P.M.; Niebuhr, B.B.; Alexandre, B.R.; Muylaert, R.L.; Grativol, A.D.; Ribeiro, J.W.; Ferreira, A.N.; Ribeiro, M.C. Landscape Resistance Influences Effective Dispersal of Endangered Lion Tamarins within the Atlantic Forest. Biol. Conserv. 2018, 224, 178–187. [Google Scholar] [CrossRef]
  62. Romano, V.; Martins, A.F.; Ruiz-Miranda, C.R. Unraveling the Dispersal Patterns and the Social Drivers of Natal of a Cooperative Breeding Mammal, the Golden Lion. Am. J. Primatol. 2019, 81, e22959. [Google Scholar] [CrossRef]
Viruses 17 01072 g001
Figure 1. Prevalence of simian foamy virus (SFV) infection according to Leontopithecus species (A), sex (B), and age group (C).
Figure 1. Prevalence of simian foamy virus (SFV) infection according to Leontopithecus species (A), sex (B), and age group (C).
Viruses 17 01072 g001
Viruses 17 01072 g002
Figure 2. Geographic distribution of groups sampled in the state of Rio de Janeiro (RJ) (A), in the municipalities of Silva Jardim and Rio Bonito (B). In (C), we highlighted the municipalities where the collections were carried out, with Silva Jardim being the most representative (10 collection points) and Rio Bonito with only one point of data collection. Each color represents a different collection point. In the legend, we showed the SFV prevalence in each one of the collection points.
Figure 2. Geographic distribution of groups sampled in the state of Rio de Janeiro (RJ) (A), in the municipalities of Silva Jardim and Rio Bonito (B). In (C), we highlighted the municipalities where the collections were carried out, with Silva Jardim being the most representative (10 collection points) and Rio Bonito with only one point of data collection. Each color represents a different collection point. In the legend, we showed the SFV prevalence in each one of the collection points.
Viruses 17 01072 g002
Viruses 17 01072 g003
Figure 3. Simian foamy virus (SFV) viral load according to Leontopithecus species (A), p-value = 0.0051; sex (B); and age group (C).
Figure 3. Simian foamy virus (SFV) viral load according to Leontopithecus species (A), p-value = 0.0051; sex (B); and age group (C).
Viruses 17 01072 g003
Viruses 17 01072 g004
Figure 4. Phylogenetic tree inferred using maximum likelihood analysis with a fragment of SFV viral polymerase (213-bp). The new sequence generated in the current study is marked with a golden star. The host species within the Callitrichidae and the Cebidae families are listed. The node labels are colored according to the host family used in the dataset. Node labels are colored according to the SH-type approximate likelihood ratio test (SH-aLRT) and ultrafast bootstrap (UFBoot) supports. The node labels colored in black represent support for SH-aLRT and UFBoot equal to or greater than 75%. When only SH-aLRT is superior to the cutoff, the label is represented in gray, while only UFBoot node labels are represented by white squares. When both parameters are lower than 75%, no label is depicted. Purple rectangles represent the calibration points used to further explore the timescale of the phylogeny. In (A) we see the phylogeny of SFV infecting the five Primate families. (B) represents the phylogeny of SFV infecting Cebidae and Callitrichidae families.
Figure 4. Phylogenetic tree inferred using maximum likelihood analysis with a fragment of SFV viral polymerase (213-bp). The new sequence generated in the current study is marked with a golden star. The host species within the Callitrichidae and the Cebidae families are listed. The node labels are colored according to the host family used in the dataset. Node labels are colored according to the SH-type approximate likelihood ratio test (SH-aLRT) and ultrafast bootstrap (UFBoot) supports. The node labels colored in black represent support for SH-aLRT and UFBoot equal to or greater than 75%. When only SH-aLRT is superior to the cutoff, the label is represented in gray, while only UFBoot node labels are represented by white squares. When both parameters are lower than 75%, no label is depicted. Purple rectangles represent the calibration points used to further explore the timescale of the phylogeny. In (A) we see the phylogeny of SFV infecting the five Primate families. (B) represents the phylogeny of SFV infecting Cebidae and Callitrichidae families.
Viruses 17 01072 g004
Viruses 17 01072 g005
Figure 5. Timescale phylogenetic tree generated by RelTime-ML. Estimated host divergence dates were used to calibrate internal nodes of the viral tree. The node labels are colored according to the host family used in the dataset. The sequence generated in the current study is marked with a golden star. The x-axis summarizes the geological timescale of the time tree: Oligocene (Ol), Miocene (Mio), Plioceno (Pli), and Pleistocene (Ple).
Figure 5. Timescale phylogenetic tree generated by RelTime-ML. Estimated host divergence dates were used to calibrate internal nodes of the viral tree. The node labels are colored according to the host family used in the dataset. The sequence generated in the current study is marked with a golden star. The x-axis summarizes the geological timescale of the time tree: Oligocene (Ol), Miocene (Mio), Plioceno (Pli), and Pleistocene (Ple).
Viruses 17 01072 g005
Table 1. PCR primers for the SFV polymerase (pol) sequence.
Table 1. PCR primers for the SFV polymerase (pol) sequence.
RoundPrimerSequence (5′ to 3′)DirectionSizeAnnealing Temperature
(35 Cycles)
1st5960TACCACTTTGTAGGTCTTCCForward486 bp53.4 °C
5878CTTTGGGGGTGGTAAGGReverse
2nd5474GCCAAACATGAGAAAGGATGForward404 bp54 °C
5878CTTTGGGGGTGGTAAGGReverse
Table 2. Demographic and morphometric data of Leontopithecus rosalia and Leontopithecus chrysomelas.
Table 2. Demographic and morphometric data of Leontopithecus rosalia and Leontopithecus chrysomelas.
IndividualsL. rosaliaL. chrysomelas
Total sample size10248
Males54 (53%)29 (60%)
Females48 (7%)19 (40%)
Adults48 (47%)42 (88%)
Subadults23 (23%)4 (8%)
Juveniles31 (30%)2 (4%)
Average weight (grams)521 (259–754) g603 (320–740) g
Average number of individuals sampled per site5 (2–26)N/A *
N/A *—not available.
Table 3. SFV prevalence and viral load according to age category in Leontopithecus rosalia.
Table 3. SFV prevalence and viral load according to age category in Leontopithecus rosalia.
Collection PointAnimals SampledJuvenilesSubadultsAdultsPrevalence (%)Mean Viral Load *
Afetiva26129519 (4–34)3.04
Tamarins502340 (0–83)3.81
Igarapé1233650 (22–78)3.30
Nova

Esperança		19441121 (3–39)3.14
Rio Vermelho940522 (0–49)2.74
Ribeirão20020N/A **
Santa Helena1424836 (11–61)3.73
Santa Helena I411250 (1–99)4.56
Sítio Quelinho21011003.91
Tertúlio210150 (0–100)3.93
Monte Moriá540140 (0–83)3.63
Andorinha30031004.22
* Mean viral load (log10) per 106 cells. ** Not available.
Table 4. Parameter estimates from linear mixed-effect models explaining viral load in Leontopithecus.
Table 4. Parameter estimates from linear mixed-effect models explaining viral load in Leontopithecus.
EstimateStandard Errordft ValuePr (>|t|)
Intercept4.411.6729.122.650.01
Age (Juvenile)−1.160.6938.11−1.680.10
Age (Subadult)−0.290.5338.00−0.550.59
Gender (Male)0.360.2838.001.320.19
Body Weight−0.0030.00238.03−1.120.27
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Girardi, D.L.; Miranda, T.S.; Cosentino, M.A.C.; de Sá, C.C.; Francisco, T.M.; Afonso, B.C.; Soffiati, F.L.; Ferreira, S.S.; Moreira, S.B.; Pissinatti, A.; et al. Simian Foamy Virus Prevalence and Evolutionary Relationships in Two Free-Living Lion Tamarin Populations from Rio de Janeiro, Brazil. Viruses 2025, 17, 1072. https://doi.org/10.3390/v17081072

AMA Style

Girardi DL, Miranda TS, Cosentino MAC, de Sá CC, Francisco TM, Afonso BC, Soffiati FL, Ferreira SS, Moreira SB, Pissinatti A, et al. Simian Foamy Virus Prevalence and Evolutionary Relationships in Two Free-Living Lion Tamarin Populations from Rio de Janeiro, Brazil. Viruses. 2025; 17(8):1072. https://doi.org/10.3390/v17081072

Chicago/Turabian Style

Girardi, Déa Luiza, Thamiris Santos Miranda, Matheus Augusto Calvano Cosentino, Caroline Carvalho de Sá, Talitha Mayumi Francisco, Bianca Cardozo Afonso, Flávio Landim Soffiati, Suelen Sanches Ferreira, Silvia Bahadian Moreira, Alcides Pissinatti, and et al. 2025. "Simian Foamy Virus Prevalence and Evolutionary Relationships in Two Free-Living Lion Tamarin Populations from Rio de Janeiro, Brazil" Viruses 17, no. 8: 1072. https://doi.org/10.3390/v17081072

APA Style

Girardi, D. L., Miranda, T. S., Cosentino, M. A. C., de Sá, C. C., Francisco, T. M., Afonso, B. C., Soffiati, F. L., Ferreira, S. S., Moreira, S. B., Pissinatti, A., Ruiz-Miranda, C. R., Romano, V., Soares, M. A., D’arc, M., & Santos, A. F. (2025). Simian Foamy Virus Prevalence and Evolutionary Relationships in Two Free-Living Lion Tamarin Populations from Rio de Janeiro, Brazil. Viruses, 17(8), 1072. https://doi.org/10.3390/v17081072

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop