Molecular Detection of Various Non-Seasonal, Zoonotic Influenza Viruses Using BioFire FilmArray and GenXpert Diagnostic Platforms
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Contrived-Clinical Specimens, Result Interpretation and Limit of Detection
3. Results
3.1. Limit of Detection of Non-Seasonal, Zoonotic Influenza Viruses in Nasal Swab Specimens
3.2. Limit of Detection of Non-Seasonal, Zoonotic Influenza Viruses in Saliva Specimens
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| Flu A | Influenza A |
| LOD | Limit of detection |
| M | Matrix |
| MEM | Minimal Essential Medium |
| POC | Point of care |
| RSV | Respiratory Syncytial Virus |
References
- Spreeuwenberg, P.; Kroneman, M.; Paget, J. Reassessing the Global Mortality Burden of the 1918 Influenza Pandemic. Am. J. Epidemiol. 2018, 187, 2561–2567. [Google Scholar] [CrossRef] [PubMed]
- Morens, D.M.; Fauci, A.S. The 1918 influenza pandemic: Insights for the 21st century. J. Infect. Dis. 2007, 195, 1018–1028. [Google Scholar] [CrossRef] [PubMed]
- Johnson, N.P.A.S.; Mueller, J. Updating the accounts: Global mortality of the 1918–1920 “Spanish” influenza pandemic. Bull. Hist. Med. 2002, 76, 105–115. [Google Scholar] [CrossRef]
- WHO Global Influenza Programme, World Health Organization. Pandemic Influenza Preparedness and Response: A WHO Guidance Document. 2009. Available online: https://iris.who.int/handle/10665/44123 (accessed on 24 May 2025).
- Michaelis, M.; Doerr, H.W.; Cinatl, J.J. Novel swine-origin influenza A virus in humans: Another pandemic knocking at the door. Med. Microbiol. Immunol. 2009, 198, 175–183. [Google Scholar] [CrossRef]
- Dawood, F.S.; Iuliano, A.D.; Reed, C.; Meltzer, M.I.; Shay, D.K.; Cheng, P.; Bandaranayake, D.; Breiman, R.F.; Brooks, W.A.; Buchy, P.; et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: A modelling study. Lancet Infect. Dis. 2012, 12, 687–695. [Google Scholar] [CrossRef]
- World Health Organization. Global Influenza Strategy 2019–2030; World Health Organization: Geneva, Switzerland, 2019. [Google Scholar]
- The Food and Agriculture Organization of the United Nations; World Organization for Animal Health. Global Strategy for the Prevention and Control of High Pathogenicity Avian Influenza (2024–2033)—Achieving Sustainable, Resilient Poultry Production Systems; The Food and Agriculture Organization of the United Nations; World Organisation for Animal Health: Rome, Italy, 2025; p. 42. [Google Scholar]
- Caliendo, V.; Lewis, N.S.; Pohlmann, A.; Baillie, S.R.; Banyard, A.C.; Beer, M.; Brown, I.H.; Fouchier, R.A.M.; Hansen, R.D.E.; Lameris, T.K.; et al. Transatlantic spread of highly pathogenic avian influenza H5N1 by wild birds from Europe to North America in 2021. Sci. Rep. 2022, 12, 11729. [Google Scholar] [CrossRef] [PubMed]
- Lewis, N.S.; Banyard, A.C.; Whittard, E.; Karibayev, T.; Al Kafagi, T.; Chvala, I.; Byrne, A.; Meruyert Akberovna, S.; King, J.; Harder, T.; et al. Emergence and spread of novel H5N8, H5N5 and H5N1 clade 2.3.4.4 highly pathogenic avian influenza in 2020. Emerg. Microbes Infect. 2021, 10, 148–151. [Google Scholar] [CrossRef]
- Caserta, L.C.; Frye, E.A.; Butt, S.L.; Laverack, M.; Nooruzzaman, M.; Covaleda, L.M.; Thompson, A.C.; Koscielny, M.P.; Cronk, B.; Johnson, A.; et al. Spillover of highly pathogenic avian influenza H5N1 virus to dairy cattle. Nature 2024, 634, 669–676. [Google Scholar] [CrossRef]
- Burrough, E.R.; Magstadt, D.R.; Petersen, B.; Timmermans, S.J.; Gauger, P.C.; Zhang, J.; Siepker, C.; Mainenti, M.; Li, G.; Thompson, A.C.; et al. Highly Pathogenic Avian Influenza A(H5N1) Clade 2.3.4.4b Virus Infection in Domestic Dairy Cattle and Cats, United States, 2024. Emerg. Infect. Dis. 2024, 30, 1335–1343. [Google Scholar] [CrossRef]
- Mostafa, A.; Naguib, M.M.; Nogales, A.; Barre, R.S.; Stewart, J.P.; Garcia-Sastre, A.; Martinez-Sobrido, L. Avian influenza A (H5N1) virus in dairy cattle: Origin, evolution, and cross-species transmission. mBio 2024, 15, e02542-24. [Google Scholar] [CrossRef]
- Webby, R.J.; Uyeki, T.M. An Update on Highly Pathogenic Avian Influenza A(H5N1) Virus, Clade 2.3.4.4b. J. Infect. Dis. 2024, 230, 533–542. [Google Scholar] [CrossRef] [PubMed]
- Jassem, A.N.; Roberts, A.; Tyson, J.; Zlosnik, J.E.A.; Russell, S.L.; Caleta, J.M.; Eckbo, E.J.; Gao, R.; Chestley, T.; Grant, J.; et al. Critical Illness in an Adolescent with Influenza A(H5N1) Virus Infection. N. Engl. J. Med. 2025, 392, 927–929. [Google Scholar] [CrossRef] [PubMed]
- Bruno, A.; Alfaro-Nunez, A.; de Mora, D.; Armas, R.; Olmedo, M.; Garces, J.; Garcia-Bereguiain, M.A. First case of human infection with highly pathogenic H5 avian Influenza A virus in South America: A new zoonotic pandemic threat for 2023? J. Travel Med. 2023, 30, taad032. [Google Scholar] [CrossRef]
- World Health Organization. Disease Outbreak News: Human Infection caused by Avian Influenza A (H5N1)—Chile. 2023. Available online: https://www.who.int/emergencies/disease-outbreak-news/item/2023-DON461 (accessed on 24 March 2025).
- U.S. Centers for Disease Control and Prevention. CDC A(H5N1) Bird Flu Response Update March 19, 2025. 2025. Available online: https://www.cdc.gov/bird-flu/spotlights/h5n1-response-03192025.html (accessed on 24 March 2025).
- U.S. Centers for Disease Control and Prevention. First H5 Bird Flu Death Reported in United States. 2025. Available online: https://www.cdc.gov/media/releases/2025/m0106-h5-birdflu-death.html (accessed on 7 July 2025).
- World Health Organization. WHO Information for the Molecular Detection of Influenza Viruses. 2021. Available online: https://cdn.who.int/media/docs/default-source/influenza/global-influenza-surveillance-and-response-system/related-documents/who_information_for_the_molecular_detection_of_influenza_viruses_20171023_final.pdf (accessed on 24 March 2025).
- Ranadheera, C.; German, G.J.; Steven, L.; Eung, D.; Lyubashenko, D.; Pepin, J.C.; Zivcec, M.; Antonation, K.; Corbett, C.R. A four specimen-pooling scheme reliably detects SARS-CoV-2 and influenza viruses using the BioFire FilmArray Respiratory Panel 2.1. Sci. Rep. 2022, 12, 4947. [Google Scholar] [CrossRef] [PubMed]
- Cepheid Innovations. Xpert® Xpress SARS-CoV-2/Flu/RSV: Instructions for Use. XPCOV2/FLU/RSV-10. 2021. Available online: https://web-support.cepheid.com/Package%20Insert%20Files/Xpert%20Xpress%20SARS-CoV-2%20Flu%20RSV%20Assay%20ENGLISH%20Package%20Insert%20302-4419%20Rev.%20C.pdf (accessed on 7 July 2025).
- BioFire Diagnostics. BioFire Respiratory Panel 2.1 (RP2.1). BFR0000-8579-03. 2023. Available online: https://www.biomerieux.com/content/dam/biomerieux-com/service-support/support-documents/instructions-for-use-and-manuals/BFR0000-8579-BioFire-RP2.1-De-Novo-Instructions-for-Use-EN.pdf (accessed on 7 July 2025).
- To, K.K.W.; Yip, C.C.Y.; Lai, C.Y.W.; Wong, C.K.H.; Ho, D.T.Y.; Pang, P.K.P.; Ng, A.C.K.; Leung, K.; Poon, R.W.S.; Chan, K.; et al. Saliva as a diagnostic specimen for testing respiratory virus by a point-of-care molecular assay: A diagnostic validity study. Clin. Microbiol. Infect. 2019, 25, 372–378. [Google Scholar] [CrossRef]
- Yoon, J.; Yun, S.G.; Nam, J.; Choi, S.; Lim, C.S. The use of saliva specimens for detection of influenza A and B viruses by rapid influenza diagnostic tests. J. Virol. Methods 2017, 243, 15–19. [Google Scholar] [CrossRef]
- Galar, A.; Catalan, P.; Vesperinas, L.; Miguens, I.; Munoz, I.; Garcia-Espona, A.; Sevillano, J.A.; Andueza, J.A.; Bouza, E.; Munoz, P. Use of Saliva Swab for Detection of Influenza Virus in Patients Admitted to an Emergency Department. Microbiol. Spectr. 2021, 9, e0033621. [Google Scholar] [CrossRef]
- Caulley, L.; Corsten, M.; Eapen, L.; Whelan, J.; Angel, J.B.; Antonation, K.; Bastien, N.; Poliquin, G.; Johnson-Obaseki, S. Salivary Detection of COVID-19. Ann. Intern. Med. 2021, 174, 131–133. [Google Scholar] [CrossRef]
- Caulley, L.; Shaw, J.; Corsten, M.; Hua, N.; Angel, J.B.; Poliquin, G.; Whelan, J.; Antonation, K.; Johnson-Obaseki, S. Salivary testing of COVID-19: Evaluation of serological testing following positive salivary results. BMC Infect. Dis. 2021, 21, 410. [Google Scholar] [CrossRef]
- Vaz, S.N.; Santana, D.S.d.; Netto, E.M.; Wang, W.; Brites, C. Validation of the GeneXpert Xpress SARS-CoV-2 PCR assay using saliva as biological specimen. Braz. J. Infect. Dis. 2021, 25, 101543. [Google Scholar] [CrossRef]
- Sanchez, A.O.; Ochoa, A.R.; Hall, S.L.; Voelker, C.R.; Mahoney, R.E.; McDaniel, J.S.; Blackburn, A.; Asin, S.N.; Yuan, T.T. Comparison of next generation diagnostic systems (NGDS) for the detection of SARS-CoV-2. J. Clin. Lab. Anal. 2022, 36, e24285. [Google Scholar] [CrossRef] [PubMed]
- Chan, K.H.; To, K.K.W.; Li, P.T.W.; Wong, T.L.; Zhang, R.; Chik, K.K.H.; Chan, G.; Yip, C.C.Y.; Chen, H.L.; Hung, I.F.N.; et al. Evaluation of NxTAG Respiratory Pathogen Panel and Comparison with xTAG Respiratory Viral Panel Fast v2 and Film Array Respiratory Panel for Detecting Respiratory Pathogens in Nasopharyngeal Aspirates and Swine/Avian-Origin Influenza A Subtypes in Culture Isolates. Adv. Virol. 2017, 2017, 1324276. [Google Scholar] [CrossRef] [PubMed]
- Chan, W.; Wong, K.; Yau, S.; Wong, C.; Chan, T.; Hung, J.; Lai, K.T.; Leung, C.; Wang, C.L.; Au, C.; et al. Clinical Evaluation of Xpert Xpress CoV-2/Flu/RSV plus and Alinity m Resp-4-Plex Assay. Diagnostics 2024, 14, 683. [Google Scholar] [CrossRef] [PubMed]
- Jensen, C.B.; Schneider, U.V.; Madsen, T.V.; Nielsen, X.C.; Ma, C.M.G.; Severinsen, J.K.; Hoegh, A.M.; Botnen, A.B.; Trebbien, R.; Lisby, J.G. Evaluation of the analytical and clinical performance of two RT-PCR based point-of-care tests; Cepheid Xpert® Xpress CoV-2/Flu/RSV plus and SD BioSensor STANDARD™ M10 Flu/RSV/SARS-CoV-2. J. Clin. Virol. 2024, 172, 105674. [Google Scholar] [CrossRef]
| Assay Number | Subtype (Target) | Oligo Sequence |
|---|---|---|
| 1 | H1N1 (M) | AGACAAGACCAAUCUUGUCACCUCUGACUAAGGGAAUUUUAGGAUUUGUGUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGCUUUAUCCAAAAUGCCCUAAAUG |
| 2 | H1N2v (M) | AGACAAGACCAAUCUUGUCACCUCUGACUAAGGGAAUUUUAGGAUUUGUGUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGCUUUAUCCAAAAUGCCCUAAAUG |
| 3 | H3N2 (M) | AGACAAGACCAAUUCUGUCACCUUUGACUAAGGGGAUUUUAGGGUUUGUUUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGCUUUGUCCAAAAUGCCCUCAAUG |
| 4 | H3N2v (M) | AGACAAGACCAAUCUUGUCACCAUUGACUAAGGGUAUUUUAGGAUUUGUGUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGCUUUGUCCAAAAUGCCCUAAAUG |
| 5 | H5N1 (M) | AGACAAGACCAAUCCUGUCACCUCUGACUAAAGGAAUCUUGGGAUUUGUAUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGUUUUGUUCAGAAUGCCCUAAAUG |
| 6 | H7N9 (M) | AGACAAGACCAAUCCUGUCACCUCUGACUAAGGGGAUUUUAGGGUUUGUGUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGGUUUGUCCAAAACGCCCUAAAUG |
| 7 | H9N2/H10N7 (M) | AGACAAGACCAAUCCUGUCACCUCUGACUAAGGGGAUUUUAGGAUUUGUGUUCACGCUCACCGUGCCCAGUGAGCGAGGACUGCAGCGUAGACGCUUUGUCCAAAAUGCCCUUAAUG |
| Modified Primer Sequence | ||
| AFdeg | 5′ Primer | GACCRATCYTGTCACCTYTGAC |
| Name | Subtype | Strain | Seasonal Strain | Species of Virus Origin | Species of Isolation | Quantification Assay Number |
|---|---|---|---|---|---|---|
| H1N1-seasonal | H1N1 | A/turkey/ON/FAV8-12/2020 | Yes | Human | Turkey | 1 |
| H1N2v-human | H1N2v | A/Manitoba/01/2021 | No | Swine | Human | 2 |
| H3N2-seasonal | H3N2 | A/Darwin/6/2021 | Yes | Human | Human | 3 |
| H3N2-canine | H3N2 | A/canine/ON/N-69-1/2018 | No | Canine | Canine | 3 |
| H3N2v-human | H3N2v | A/Manitoba/03/2021 | No | Swine | Human | 4 |
| H5N1-human | H5N1 | A/Alberta/1/2014 | No | Avian | Human | 5 |
| H5N1-AGWT | H5N1 | A/AmericanGreenWingedTeal/NovaScotia/ FAV133-3/2022 | No | Avian | American Green Winged Teal | 5 |
| H5N1-duck | H5N1 | A/Duck/Quebec/FAV1347-10/2022 | No | Avian | Wigeon | 5 |
| H5N1-human-TX | H5N1 | A/Texas/37/2024 | No | Avian/Bovine | Human | 5 |
| H5N1-human-BC | H5N1 | A/BritishColumbia/PHL-2032/2024 | No | Avian | Human | 5 |
| H7N9-human | H7N9 | A/Anhui/01/13 | No | Avian | Human | 6 |
| H9N2-human | H9N2 | A/chicken/Ghana/Slycat-13/2018 | No | Avian | Human | 7 |
| H10N7-seal | H10N7 | A/harbour seal/BC/OTH52-4/2021 | No | Seal | Seal | 7 |
| Name | Cepheid Xpert® Xpress CoV-2/Flu/RSV Plus | BioFire® Respiratory 2.1 Panel | ||
|---|---|---|---|---|
| Positive Result | Limit of Detection (M copies/mL) | Positive Result and Subtype | Limit of Detection (M Copies/mL) | |
| H1N1-seasonal | Flu A | 2.1 × 102 | Flu A/H1 | 2.1 × 103 |
| H1N2v-human | Flu A | 5.0 × 102 | Flu A | 5.0 × 103 |
| H3N2-seasonal | Flu A * (SARS-CoV-2) | 8.0 × 103 | Flu A/H3 | 8.0 × 104 |
| H3N2-canine | Flu A | 9.0 × 102 | Flu A/H3 | 9.0 × 103 |
| H3N2v-human | Flu A | 1.5 × 103 | Flu A/H3 | 1.5 × 104 |
| H5N1-human-AB | Flu A | 4.7 × 103 | Flu A | 4.7 × 104 |
| H5N1-AGWT | Flu A | 2.4 × 103 | Flu A | 2.4 × 104 |
| H5N1-duck | Flu A | 2.4 × 102 | Flu A | 2.4 × 102 |
| H5N1-human-TX | Flu A | 2.4 × 103 | Flu A | 2.4 × 104 |
| H5N1-human-BC | Flu A | 8.3 × 102 | Flu A | 8.3 × 103 |
| H7N9-human | Flu A | 6.2 × 103 | Flu A | 6.2 × 104 |
| H9N2-human | Flu A | 2.7 × 102 | Flu A | 2.7 × 103 |
| H10N7-seal | Flu A | 2.4 × 103 | Flu A | 2.4 × 103 |
| Name | Cepheid Xpert® Xpress CoV-2/Flu/RSV Plus | BioFire® Respiratory 2.1 Panel | ||
|---|---|---|---|---|
| Positive Result | Limit of Detection (M Copies/mL) | Positive Result and Subtype | Limit of Detection (M Copies/mL) | |
| H1N1-seasonal | Flu A | 2.1 × 102 | Flu A/H1 | 2.1 × 103 |
| H1N2v-human | Flu A | 5.0 × 102 | Flu A | 5.0 × 103 |
| H3N2-seasonal | Flu A | 8.0 × 103 | Flu A/H3 | 8.0 × 104 |
| H3N2-canine | Flu A | 9.0 × 102 | Flu A/H3 | 9.0 × 102 |
| H3N2v-human | Flu A | 1.5 × 103 | Flu A/H3 | 1.5 × 104 |
| H5N1-human | Flu A | 4.7 × 103 | Flu A | 4.7 × 103 |
| H5N1-AGWT | Flu A | 2.4 × 103 | Flu A | 2.4 × 103 |
| H5N1-Duck | Flu A | 2.4 × 102 | Flu A | 2.4 × 102 |
| H5N1-human-TX | Flu A | 2.4 × 103 | Flu A | 2.4 × 104 |
| H5N1-human-BC | Flu A | 8.3 × 102 | Flu A | 8.3 × 103 |
| H7N9-human | Flu A | 6.2 × 103 | Flu A | 6.2 × 104 |
| H9N2-human | Flu A | 2.7 × 101 | Flu A | 2.7 × 103 |
| H10N7-seal | Flu A | 2.4 × 103 | Flu A | 2.4 × 103 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ranadheera, C.; Chestley, T.; Perez, O.; Meek, B.; Hart, L.; Johnson, M.; Berhane, Y.; Bastien, N. Molecular Detection of Various Non-Seasonal, Zoonotic Influenza Viruses Using BioFire FilmArray and GenXpert Diagnostic Platforms. Viruses 2025, 17, 970. https://doi.org/10.3390/v17070970
Ranadheera C, Chestley T, Perez O, Meek B, Hart L, Johnson M, Berhane Y, Bastien N. Molecular Detection of Various Non-Seasonal, Zoonotic Influenza Viruses Using BioFire FilmArray and GenXpert Diagnostic Platforms. Viruses. 2025; 17(7):970. https://doi.org/10.3390/v17070970
Chicago/Turabian StyleRanadheera, Charlene, Taeyo Chestley, Orlando Perez, Breanna Meek, Laura Hart, Morgan Johnson, Yohannes Berhane, and Nathalie Bastien. 2025. "Molecular Detection of Various Non-Seasonal, Zoonotic Influenza Viruses Using BioFire FilmArray and GenXpert Diagnostic Platforms" Viruses 17, no. 7: 970. https://doi.org/10.3390/v17070970
APA StyleRanadheera, C., Chestley, T., Perez, O., Meek, B., Hart, L., Johnson, M., Berhane, Y., & Bastien, N. (2025). Molecular Detection of Various Non-Seasonal, Zoonotic Influenza Viruses Using BioFire FilmArray and GenXpert Diagnostic Platforms. Viruses, 17(7), 970. https://doi.org/10.3390/v17070970

