eEF-2K Deficiency Boosts the Virus-Specific Effector CD8+ T Cell Responses During Viral Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. Virus Preparation and Titration
2.3. Viral Infection
2.4. Tissue Processing
2.5. Flow Cytometry and Tetramer Staining
2.6. Sorting of VACV-Specific CD8⁺ T Cells
2.7. RNA Sequencing and Data Analysis
2.8. Intracellular Cytokine and Protein Staining
2.9. RNA Extraction and Quantitative PCR (qPCR)
- Traf3 Forward: GTGAACCTGCTGAAGGAGTGGA
- Traf3 Reverse: TTCGGAGCATCTCCTTCTGCCT
- Gapdh Forward: GTTGTCTCCTGCGACTTCA
- Gapdh Reverse: GGTGGTCCAGGGTTTCTTA
2.10. Illustration and Figures
2.11. Statistical Analysis
3. Results
3.1. eEF-2K⁻/⁻ Mice Show Enhanced Response to VACV Infection During the Effector Stage
3.2. eEF-2K Deficiency Does Not Influence VACV-Specific Memory T Cell Formation
3.3. Involvement of Transcriptional Alteration in the Augmented Response of VACV-Specific eEF-2K⁻/⁻ Effector CD8⁺ T Cells to Viral Infection
3.4. Functional Competence of VACV-Specific eEF-2K⁻/⁻ Effector CD8⁺ T Cells
3.5. TRAF3 Mediates the Enhanced Antiviral Response in eEF-2K⁻/⁻ Effector CD8⁺ T Cells
4. Discussion and Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Teque, F.; Wegehaupt, A.; Roufs, E.; Killian, M.S. CD8+ Lymphocytes from Healthy Blood Donors Secrete Antiviral Levels of Interferon-Alpha. Viruses 2023, 15, 894. [Google Scholar] [CrossRef]
- Wang, L.; Peng, H.Y.; Pham, A.; Villazana, E.; Ballard, D.J.; Das, J.K.; Kumar, A.; Xiong, X.; Song, J. T Cell Response to SARS-CoV-2 Coinfection and Comorbidities. Pathogens 2023, 12, 321. [Google Scholar] [CrossRef]
- Kaech, S.M.; Wherry, E.J.; Ahmed, R. Effector and memory T-cell differentiation: Implications for vaccine development. Nat. Rev. Immunol. 2002, 2, 251–262. [Google Scholar] [CrossRef]
- Meineke, R.; Rimmelzwaan, G.F.; Elbahesh, H. Influenza Virus Infections and Cellular Kinases. Viruses 2019, 11, 171. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Kumar, A.; Das, J.K.; Ren, Y.; Peng, H.Y.; Ballard, D.J.; Xiong, X.; Davis, J.R.; Ren, X.; Yang, J.M.; et al. Expression of NAC1 Restrains the Memory Formation of CD8(+) T Cells during Viral Infection. Viruses 2022, 14, 1713. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Peng, H.Y.; Kishore Das, J.; Kumar, A.; Ren, Y.; Ballard, D.J.; Xiong, X.; Yang, W.; Ren, X.; de Figueiredo, P.; et al. NAC1 confines virus-specific memory formation of CD4(+) T cells through the ROCK1-mediated pathway. J. Med. Virol. 2023, 95, e28957. [Google Scholar] [CrossRef] [PubMed]
- Salek-Ardakani, S.; Song, J.; Halteman, B.S.; Jember, A.G.; Akiba, H.; Yagita, H.; Croft, M. OX40 (CD134) controls memory T helper 2 cells that drive lung inflammation. J. Exp. Med. 2003, 198, 315–324. [Google Scholar] [CrossRef]
- Ryazanov, A.G.; Ward, M.D.; Mendola, C.E.; Pavur, K.S.; Dorovkov, M.V.; Wiedmann, M.; Erdjument-Bromage, H.; Tempst, P.; Parmer, T.G.; Prostko, C.R.; et al. Identification of a new class of protein kinases represented by eukaryotic elongation factor-2 kinase. Proc. Natl. Acad. Sci. USA 1997, 94, 4884–4889. [Google Scholar] [CrossRef]
- Wang, H.; Jin, W.; Li, Z.; Guo, C.; Zhang, L.; Fu, L. Targeting eukaryotic elongation factor 2 kinase (eEF2K) with small-molecule inhibitors for cancer therapy. Drug Discov. Today 2024, 29, 104155. [Google Scholar] [CrossRef] [PubMed]
- Deng, G.; Zeng, F.; He, Y.; Meng, Y.; Sun, H.; Su, J.; Zhao, S.; Cheng, Y.; Chen, X.; Yin, M. EEF2K silencing inhibits tumour progression through repressing SPP1 and synergises with BET inhibitors in melanoma. Clin. Transl. Med. 2022, 12, e722. [Google Scholar] [CrossRef] [PubMed]
- Ju, Y.; Ben-David, Y.; Rotin, D.; Zacksenhaus, E. Inhibition of eEF2K synergizes with glutaminase inhibitors or 4EBP1 depletion to suppress growth of triple-negative breast cancer cells. Sci. Rep. 2021, 11, 9181. [Google Scholar] [CrossRef]
- Wu, Y.; Xie, J.; Jin, X.; Lenchine, R.V.; Wang, X.; Fang, D.M.; Nassar, Z.D.; Butler, L.M.; Li, J.; Proud, C.G. eEF2K enhances expression of PD-L1 by promoting the translation of its mRNA. Biochem. J. 2020, 477, 4367–4381. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Song, H.; Chen, G.; Yang, X.; Liu, J.; Ge, Y.; Lu, J.; Qin, Q.; Zhang, C.; Xu, L.; et al. eEF2K promotes progression and radioresistance of esophageal squamous cell carcinoma. Radiother. Oncol. 2017, 124, 439–447. [Google Scholar] [CrossRef] [PubMed]
- De Gassart, A.; Demaria, O.; Panes, R.; Zaffalon, L.; Ryazanov, A.G.; Gilliet, M.; Martinon, F. Pharmacological eEF2K activation promotes cell death and inhibits cancer progression. EMBO Rep. 2016, 17, 1471–1484. [Google Scholar] [CrossRef]
- Cheng, Y.; Ren, X.; Zhang, Y.; Shan, Y.; Huber-Keener, K.J.; Zhang, L.; Kimball, S.R.; Harvey, H.; Jefferson, L.S.; Yang, J.M. Integrated regulation of autophagy and apoptosis by EEF2K controls cellular fate and modulates the efficacy of curcumin and velcade against tumor cells. Autophagy 2013, 9, 208–219. [Google Scholar] [CrossRef]
- Ma, T. Roles of eukaryotic elongation factor 2 kinase (eEF2K) in neuronal plasticity, cognition, and Alzheimer disease. J. Neurochem. 2023, 166, 47–57. [Google Scholar] [CrossRef]
- Smith, P.R.; Loerch, S.; Kunder, N.; Stanowick, A.D.; Lou, T.F.; Campbell, Z.T. Functionally distinct roles for eEF2K in the control of ribosome availability and p-body abundance. Nat. Commun. 2021, 12, 6789. [Google Scholar] [CrossRef] [PubMed]
- Bianco, C.; Thompson, L.; Mohr, I. Repression of eEF2K transcription by NF-kappaB tunes translation elongation to inflammation and dsDNA-sensing. Proc. Natl. Acad. Sci. USA 2019, 116, 22583–22590. [Google Scholar] [CrossRef] [PubMed]
- Versele, M.M.C.; Proud, C.G.; Rockx, C.; IWeyer, K.; Baelen, K.; Blencke, S.; Wanndinge, S.; Diels, G.; Berthelot, D.; Viellevoye, M.; et al. Managing stress: Discovery of inhibitors of the atypical kinase eEF2K and the class III PI3K, VPS34. In AACR Annual Meeting 2014; American Association for Cancer Research: San Diego, CA, USA, 2014. [Google Scholar]
- Chu, H.P.; Liao, Y.; Novak, J.S.; Hu, Z.; Merkin, J.J.; Shymkiv, Y.; Braeckman, B.P.; Dorovkov, M.V.; Nguyen, A.; Clifford, P.M.; et al. Germline quality control: eEF2K stands guard to eliminate defective oocytes. Dev. Cell 2014, 28, 561–572. [Google Scholar] [CrossRef]
- Das, J.K.; Ren, Y.; Kumar, A.; Peng, H.Y.; Wang, L.; Xiong, X.; Alaniz, R.C.; de Figueiredo, P.; Ren, X.; Liu, X.; et al. Elongation factor-2 kinase is a critical determinant of the fate and antitumor immunity of CD8(+) T cells. Sci. Adv. 2022, 8, eabl9783. [Google Scholar] [CrossRef]
- Xu, Y.; Sun, F.; Tian, Y.; Zeng, G.; Lei, G.; Bai, Z.; Wang, Y.; Ge, X.; Wang, J.; Xiao, C.; et al. Enhanced NK cell activation via eEF2K-mediated potentiation of the cGAS-STING pathway in hepatocellular carcinoma. Int. Immunopharmacol. 2024, 129, 111628. [Google Scholar] [CrossRef]
- Peng, H.Y.; Wang, L.; Das, J.K.; Kumar, A.; Ballard, D.J.; Ren, Y.; Xiong, X.; de Figueiredo, P.; Yang, J.M.; Song, J. Control of CD4(+) T cells to restrain inflammatory diseases via eukaryotic elongation factor 2 kinase. Signal Transduct. Target. Ther. 2023, 8, 415. [Google Scholar] [CrossRef] [PubMed]
- Cotter, C.A.; Earl, P.L.; Wyatt, L.S.; Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Curr. Protoc. Mol. Biol. 2017, 117, 16 16 1–16 16 18. [Google Scholar] [CrossRef]
- Haque, M.; Song, J.; Fino, K.; Wang, Y.; Sandhu, P.; Song, X.; Norbury, C.; Ni, B.; Fang, D.; Salek-Ardakani, S.; et al. C-Myc regulation by costimulatory signals modulates the generation of CD8+ memory T cells during viral infection. Open Biol. 2016, 6, 150208. [Google Scholar] [CrossRef]
- Hornick, E.L.; Wallis, A.M.; Bishop, G.A. TRAF3 enhances type I interferon receptor signaling in T cells by modulating the phosphatase PTPN22. Sci. Signal 2022, 15, eabn5507. [Google Scholar] [CrossRef]
- Chen, F.; Chen, L.; Li, Y.; Sang, H.; Zhang, C.; Yuan, S.; Yang, J. TRAF3 Positively Regulates Host Innate Immune Resistance to Influenza A Virus Infection. Front. Cell Infect. Microbiol. 2022, 12, 839625. [Google Scholar] [CrossRef] [PubMed]
- Hacker, H.; Tseng, P.H.; Karin, M. Expanding TRAF function: TRAF3 as a tri-faced immune regulator. Nat. Rev. Immunol. 2011, 11, 457–468. [Google Scholar] [CrossRef]
- Zhao, X.; Zhong, C.; Zhu, R.; Gong, R.; Liu, B.; He, L.; Tian, S.; Jin, J.; Jiang, T.; Chen, J.L.; et al. Structure-Activity Relationship Studies of Substituted 2-Phenyl-1,2,4-triazine-3,5(2H,4H)-dione Analogues: Development of Potent eEF2K Degraders against Triple-Negative Breast Cancer. J. Med. Chem. 2024, 67, 15837–15861. [Google Scholar] [CrossRef] [PubMed]
- Zhong, C.; Zhu, R.; Jiang, T.; Tian, S.; Zhao, X.; Wan, X.; Jiang, S.; Chen, Z.; Gong, R.; He, L.; et al. Design and Characterization of a Novel eEF2K Degrader with Potent Therapeutic Efficacy Against Triple-Negative Breast Cancer. Adv. Sci. 2024, 11, e2305035. [Google Scholar] [CrossRef] [PubMed]
Marker | Color | Company & Cat NO. |
---|---|---|
IL-2 | BV421 | BioLegend 503825 |
IFN-y | FITC | BioLegend 505806 |
CD8 | PE | BioLegend 100708 |
CD44 | FITC | BioLegend 103005 |
CD69 | BV711 | BioLegend 104537 |
CD197 | BV421 | BioLegend 120119 |
BCL-2 | PE | Miltenyi Biotec 130-118-688 |
VACV tetramer | APC | NIH Tetramer core B8R |
TRAF3 | Alex Fluor 488 | Proteintech CL488-66310 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Song, B.S.; Poojary, R.; Xiong, X.; Ren, X.; Yang, J.-M.; Song, J. eEF-2K Deficiency Boosts the Virus-Specific Effector CD8+ T Cell Responses During Viral Infection. Viruses 2025, 17, 26. https://doi.org/10.3390/v17010026
Wang L, Song BS, Poojary R, Xiong X, Ren X, Yang J-M, Song J. eEF-2K Deficiency Boosts the Virus-Specific Effector CD8+ T Cell Responses During Viral Infection. Viruses. 2025; 17(1):26. https://doi.org/10.3390/v17010026
Chicago/Turabian StyleWang, Liqing, Benny Shone Song, Rayansh Poojary, Xiaofang Xiong, Xingcong Ren, Jin-Ming Yang, and Jianxun Song. 2025. "eEF-2K Deficiency Boosts the Virus-Specific Effector CD8+ T Cell Responses During Viral Infection" Viruses 17, no. 1: 26. https://doi.org/10.3390/v17010026
APA StyleWang, L., Song, B. S., Poojary, R., Xiong, X., Ren, X., Yang, J.-M., & Song, J. (2025). eEF-2K Deficiency Boosts the Virus-Specific Effector CD8+ T Cell Responses During Viral Infection. Viruses, 17(1), 26. https://doi.org/10.3390/v17010026