Intra-Host Citrus Tristeza Virus Populations during Prolonged Infection Initiated by a Well-Defined Sequence Variant in Nicotiana benthamiana
Abstract
1. Introduction
2. Materials and Methods
2.1. Agroinfiltration of a Virus Construct into N. benthamiana Leaves, Examination of the Results of Virus Inoculation, and Sample Collection
2.2. RNA Extraction, Library Preparation, and High-Throughput Sequencing
2.3. Genome Assembly and Single-Nucleotide Polymorphism (SNP) Calling
2.4. Defective Viral Genome (DVG) Identification
3. Results and Discussion
3.1. Intra-Host Evolution of CTV-T36 and Comparison with Other RNA Viruses
3.2. Generation of DVGs during Experimental Evolution of CTV-T36
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Domingo, E.; Holland, J.J. RNA Virus Mutations and Fitness for Survival. Annu. Rev. Microbiol. 1997, 51, 151–178. [Google Scholar] [CrossRef]
- Bordería, A.V.; Stapleford, K.A.; Vignuzzi, M. RNA Virus Population Diversity: Implications for Inter-Species Transmission. Curr. Opin. Virol. 2011, 1, 643–648. [Google Scholar] [CrossRef] [PubMed]
- Poirier, E.Z.; Vignuzzi, M. Virus Population Dynamics during Infection. Curr. Opin. Virol. 2017, 23, 82–87. [Google Scholar] [CrossRef]
- Butković, A.; González, R. A Brief View of Factors That Affect Plant Virus Evolution. Front. Virol. 2022, 2, 994057. [Google Scholar] [CrossRef]
- LaTourrette, K.; Garcia-Ruiz, H. Determinants of Virus Variation, Evolution, and Host Adaptation. Pathogens 2022, 11, 1039. [Google Scholar] [CrossRef] [PubMed]
- Elena, S.F. The Role of Indels in Evolution and Pathogenicity of RNA Viruses. Proc. Natl. Acad. Sci. USA 2023, 120, e2310785120. [Google Scholar] [CrossRef]
- González Aparicio, L.J.; López, C.B. Selection of Nonstandard Viral Genomes during the Evolution of RNA Viruses: A Virus Survival Strategy or a Pesky Inconvenience? Adv. Virus Res. 2024, 119, 39–61. [Google Scholar] [CrossRef]
- Vignuzzi, M.; López, C.B. Defective Viral Genomes Are Key Drivers of the Virus–Host Interaction. Nat. Microbiol. 2019, 4, 1075–1087. [Google Scholar] [CrossRef] [PubMed]
- Pathak, K.B.; Nagy, P.D. Defective Interfering RNAs: Foes of Viruses and Friends of Virologists. Viruses 2009, 1, 895–919. [Google Scholar] [CrossRef]
- Brennan, J.W.; Sun, Y. Defective Viral Genomes: Advances in Understanding Their Generation, Function, and Impact on Infection Outcomes. mBio 2024, 15, e0069224. [Google Scholar] [CrossRef]
- Bosma, T.J.; Karagiannis, K.; Santana-Quintero, L.; Ilyushina, N.; Zagorodnyaya, T.; Petrovskaya, S.; Laassri, M.; Donnelly, R.P.; Rubin, S.; Simonyan, V.; et al. Identification and Quantification of Defective Virus Genomes in High Throughput Sequencing Data Using DVG-Profiler, a Novel Post-Sequence Alignment Processing Algorithm. PLoS ONE 2019, 14, e0216944. [Google Scholar] [CrossRef] [PubMed]
- Budzyńska, D.; Zwart, M.P.; Hasiów-Jaroszewska, B. Defective RNA Particles of Plant Viruses—Origin, Structure and Role in Pathogenesis. Viruses 2022, 14, 2814. [Google Scholar] [CrossRef] [PubMed]
- Dawson, W.O.; Bar-Joseph, M.; Garnsey, S.M.; Moreno, P. Citrus tristeza virus: Making an Ally from an Enemy. Annu. Rev. Phytopathol. 2015, 53, 137–155. [Google Scholar] [CrossRef] [PubMed]
- Moreno, P.; Ambrós, S.; Albiach-Martí, M.R.; Guerri, J.; Peña, L. Citrus tristeza virus: A Pathogen That Changed the Course of the Citrus Industry. Mol. Plant Pathol. 2008, 9, 251–268. [Google Scholar] [CrossRef]
- Agranovsky, A.A. Principles of Molecular Organization, Expression, and Evolution of Closteroviruses: Over The Barriers. Adv. Virus Res. 1996, 47, 119–158. [Google Scholar] [CrossRef]
- Folimonova, S.Y. Citrus tristeza virus: A Large RNA Virus with Complex Biology Turned into a Valuable Tool for Crop Protection. PLoS Pathog. 2020, 16, e1008416. [Google Scholar] [CrossRef] [PubMed]
- Karasev, A.V.; Boyko, V.P.; Gowda, S.; Nikolaeva, O.V.; Koonin, E.V.; Niblett, C.L.; Cline, K.; Gumpf, D.J.; Lee, R.F.; Garnsey, S.M.; et al. Complete Sequence of the Citrus Tristeza Virus RNA Genome. Virology 1995, 208, 511–520. [Google Scholar] [CrossRef]
- Dolja, V.V.; Kreuze, J.F.; Valkonen, J.P.T. Comparative and Functional Genomics of Closteroviruses. Virus Res. 2006, 117, 38–51. [Google Scholar] [CrossRef]
- Satyanarayana, T.; Gowda, S.; Mawassi, M.; Albiach-Martí, M.R.; Ayllón, M.A.; Robertson, C.; Garnsey, S.M.; Dawson, W.O. Closterovirus Encoded HSP70 Homolog and P61 in Addition to Both Coat Proteins Function in Efficient Virion Assembly. Virology 2000, 278, 253–265. [Google Scholar] [CrossRef]
- Lu, R.; Folimonov, A.; Shintaku, M.; Li, W.X.; Falk, B.W.; Dawson, W.O.; Ding, S.W. Three Distinct Suppressors of RNA Silencing Encoded by a 20-Kb Viral RNA Genome. Proc. Natl. Acad. Sci. USA 2004, 101, 15742–15747. [Google Scholar] [CrossRef]
- Tatineni, S.; Robertson, C.J.; Garnsey, S.M.; Dawson, W.O. A Plant Virus Evolved by Acquiring Multiple Nonconserved Genes to Extend Its Host Range. Proc. Natl. Acad. Sci. USA 2011, 108, 17366–17371. [Google Scholar] [CrossRef] [PubMed]
- Tatineni, S.; Robertson, C.J.; Garnsey, S.M.; Bar-Joseph, M.; Gowda, S.; Dawson, W.O. Three Genes of Citrus Tristeza Virus Are Dispensable for Infection and Movement throughout Some Varieties of Citrus Trees. Virology 2008, 376, 297–307. [Google Scholar] [CrossRef] [PubMed]
- Folimonova, S.Y. Superinfection Exclusion Is an Active Virus-Controlled Function That Requires a Specific Viral Protein. J. Virol. 2012, 86, 5554–5561. [Google Scholar] [CrossRef]
- Harper, S.J. Citrus tristeza virus: Evolution of Complex and Varied Genotypic Groups. Front. Microbiol. 2013, 4, 93. [Google Scholar] [CrossRef]
- Yokomi, R.; Selvaraj, V.; Maheshwari, Y.; Chiumenti, M.; Saponari, M.; Giampetruzzi, A.; Weng, Z.; Xiong, Z.; Hajeri, S. Molecular and Biological Characterization of a Novel Mild Strain of Citrus Tristeza Virus in California. Arch. Virol. 2018, 163, 1795–1804. [Google Scholar] [CrossRef]
- Silva, G.; Marques, N.; Nolasco, G. The Evolutionary Rate of Citrus Tristeza Virus Ranks among the Rates of the Slowest RNA Viruses. J. Gen. Virol. 2012, 93, 419–429. [Google Scholar] [CrossRef] [PubMed]
- Folimonova, S.Y.; Achor, D.; Bar-Joseph, M. Walking Together: Cross-Protection, Genome Conservation, and the Replication Machinery of Citrus tristeza virus. Viruses 2020, 12, 1353. [Google Scholar] [CrossRef]
- Biswas, K.K.; Palchoudhury, S.; Chakraborty, P.; Bhattacharyya, U.K.; Ghosh, D.K.; Debnath, P.; Ramadugu, C.; Keremane, M.L.; Khetarpal, R.K.; Lee, R.F. Codon Usage Bias Analysis of Citrus tristeza virus: Higher Codon Adaptation to Citrus Reticulata Host. Viruses 2019, 11, 331. [Google Scholar] [CrossRef]
- Smith, E.C.; Blanc, H.; Vignuzzi, M.; Denison, M.R. Coronaviruses Lacking Exoribonuclease Activity Are Susceptible to Lethal Mutagenesis: Evidence for Proofreading and Potential Therapeutics. PLoS Pathog. 2013, 9, e1003565. [Google Scholar] [CrossRef]
- Zhang, X.F.; Sun, R.; Guo, Q.; Zhang, S.; Meulia, T.; Halfmann, R.; Li, D.; Qu, F. A Self-Perpetuating Repressive State of a Viral Replication Protein Blocks Superinfection by the Same Virus. PLoS Pathog. 2017, 13, e1003565. [Google Scholar] [CrossRef]
- Weng, Z.; Barthelson, R.; Gowda, S.; Hilf, M.E.; Dawson, W.O.; Galbraith, D.W.; Xiong, Z. Persistent Infection and Promiscuous Recombination of Multiple Genotypes of an RNA Virus within a Single Host Generate Extensive Diversity. PLoS ONE 2007, 2, 917. [Google Scholar] [CrossRef] [PubMed]
- Mawass, M.; Karasev, A.V.; Mietkiewska, E.; Gafny, R.; Lee, R.F.; Dawson, W.O.; Bar-Joseph, M. Defective RNA Molecules Associated with Citrus Tristeza Virus. Virology 1995, 208, 383–387. [Google Scholar] [CrossRef] [PubMed]
- Mawassi, M.; Mietkiewska, E.; Hilf, M.E.; Ashoulin, L.; Karasev, A.V.; Gafny, R.; Lee, R.F.; Garnsey, S.M.; Dawson, W.O.; Bar-Joseph, M. Multiple Species of Defective RNAs in Plants Infected with Citrus Tristeza Virus. Virology 1995, 214, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Bar-Joseph, M.; Mawassi, M. The Defective RNAs of Closteroviridae. Front. Microbiol. 2013, 4, 132. [Google Scholar] [CrossRef]
- Ayllón, M.A.; López, C.; Navas-Castillo, J.; Mawassi, M.; Dawson, W.O.; Guerri, J.; Flores, R.; Moreno, P. New Defective RNAs from Citrus Tristeza Virus: Evidence for a Replicase-Driven Template Switching Mechanism in Their Generation. J. Gen. Virol. 1999, 80, 817–821. [Google Scholar] [CrossRef]
- Yang, G.; Mawassi, M.; Gofman, R.; Gafny, R.; Bar-Joseph, M. Involvement of a Subgenomic MRNA in the Generation of a Variable Population of Defective Citrus Tristeza Virus Molecules. J. Virol. 1997, 71, 9800–9802. [Google Scholar] [CrossRef]
- Elena, S.F.; Sanjuán, R. Virus Evolution: Insights from an Experimental Approach. Annu. Rev. Ecol. Evol. Syst. 2007, 38, 27–52. [Google Scholar] [CrossRef]
- González, R.; Butkovic, A.; Escaray, F.J.; Martínez-Latorre, J.; Melero, Í.; Pérez-Parets, E.; Gómez-Cadenas, A.; Carrasco, P.; Elena, S.F. Plant Virus Evolution under Strong Drought Conditions Results in a Transition from Parasitism to Mutualism. Proc. Natl. Acad. Sci. USA 2021, 118, e2020990118. [Google Scholar] [CrossRef]
- El-Mohtar, C.; Dawson, W.O. Exploring the Limits of Vector Construction Based on Citrus Tristeza Virus. Virology 2014, 448, 274–283. [Google Scholar] [CrossRef]
- Ambrós, S.; El-Mohtar, C.; Ruiz-Ruiz, S.; Peña, L.; Guerri, J.; Dawson, W.O.; Moreno, P. Agroinoculation of Citrus tristeza virus Causes Systemic Infection and Symptoms in the Presumed Nonhost Nicotiana benthamiana. Mol. Plant-Microbe Interact. 2011, 24, 1119–1131. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 30 July 2024).
- Krueger, F.; Galore, T. A Wrapper Tool around Cutadapt and FastQC to Consistently Apply Quality and Adapter Trimming to FastQ Files. Available online: https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ (accessed on 30 July 2024).
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Wilm, A.; Aw, P.P.K.; Bertrand, D.; Yeo, G.H.T.; Ong, S.H.; Wong, C.H.; Khor, C.C.; Petric, R.; Hibberd, M.L.; Nagarajan, N. LoFreq: A Sequence-Quality Aware, Ultra-Sensitive Variant Caller for Uncovering Cell-Population Heterogeneity from High-Throughput Sequencing Datasets. Nucleic Acids Res. 2012, 40, 11189–11201. [Google Scholar] [CrossRef]
- Olmo-Uceda, M.J.; Muñoz-Sánchez, J.C.; Lasso-Giraldo, W.; Arnau, V.; Díaz-Villanueva, W.; Elena, S.F. DVGfinder: A Metasearch Tool for Identifying Defective Viral Genomes in RNA-Seq Data. Viruses 2022, 14, 1114. [Google Scholar] [CrossRef]
- Sotcheff, S.; Zhou, Y.; Yeung, J.; Sun, Y.; Johnson, J.E.; Torbett, B.E.; Routh, A.L. ViReMa: A Virus Recombination Mapper of next-Generation Sequencing Data Characterizes Diverse Recombinant Viral Nucleic Acids. Gigascience 2023, 12, giad009. [Google Scholar] [CrossRef] [PubMed]
- Beauclair, G.; Mura, M.; Combredet, C.; Tangy, F.; Jouvenet, N.; Komarova, A.V. DI-Tector: Defective Interfering Viral Genomes’ Detector for next-Generation Sequencing Data. RNA 2018, 24, 1285–1296. [Google Scholar] [CrossRef]
- Naim, F.; Nakasugi, K.; Crowhurst, R.N.; Hilario, E.; Zwart, A.B.; Hellens, R.P.; Taylor, J.M.; Waterhouse, P.M.; Wood, C.C. Advanced Engineering of Lipid Metabolism in Nicotiana Benthamiana Using a Draft Genome and the V2 Viral Silencing-Suppressor Protein. PLoS ONE 2012, 7, e52717. [Google Scholar] [CrossRef]
- Dunham, J.P.; Simmons, H.E.; Holmes, E.C.; Stephenson, A.G. Analysis of Viral (Zucchini Yellow Mosaic Virus) Genetic Diversity during Systemic Movement through a Cucurbita pepo vine. Virus Res. 2014, 191, 172–179. [Google Scholar] [CrossRef]
- Cuevas, J.M.; Willemsen, A.; Hillung, J.; Zwart, M.P.; Elena, S.F. Temporal Dynamics of Intrahost Molecular Evolution for a Plant RNA Virus. Mol. Biol. Evol. 2015, 32, 1132–1147. [Google Scholar] [CrossRef]
- Folimonova, S.Y.; Robertson, C.J.; Shilts, T.; Folimonov, A.S.; Hilf, M.E.; Garnsey, S.M.; Dawson, W.O. Infection with Strains of Citrus Tristeza Virus Does Not Exclude Superinfection by Other Strains of the Virus. J. Virol. 2010, 84, 1314–1325. [Google Scholar] [CrossRef]
- Alam, M.M.; Kobayashi, N.; Ishino, M.; Nagashima, S.; Paul, S.K.; Chawla-Sarkar, M.; Krishnan, T.; Naik, T.N. Identical Rearrangement of NSP3 Genes Found in Three Independently Isolated Virus Clones Derived from Mixed Infection and Multiple Passages of Rotaviruses. Arch. Virol. 2008, 153, 555–559. [Google Scholar] [CrossRef]
- Kautz, T.F.; Jaworski, E.; Routh, A.; Forrester, N.L. A Low Fidelity Virus Shows Increased Recombination during the Removal of an Alphavirus Reporter Gene. Viruses 2020, 12, 660. [Google Scholar] [CrossRef] [PubMed]
- Folimonov, A.S.; Folimonova, S.Y.; Bar-Joseph, M.; Dawson, W.O. A Stable RNA Virus-Based Vector for Citrus Trees. Virology 2007, 368, 205–216. [Google Scholar] [CrossRef] [PubMed]
- Bar-Joseph, M.; Yang, G.; Gafny, R.; Mawassi, M. Subgenomic RNAs: The Possible Building Blocks for Modular Recombination OfClosteroviridaeGenomes. Semin. Virol. 1997, 8, 113–119. [Google Scholar] [CrossRef]
- Che, X.; Mawassi, M.; Bar-Joseph, M. A Novel Class of Large and Infectious Defective RNAs of Citrus Tristeza Virus. Virology 2002, 298, 133–145. [Google Scholar] [CrossRef]
- Che, X.; Dawson, W.O.; Bar-Joseph, M. Defective RNAs of Citrus Tristeza Virus Analogous to Crinivirus Genomic RNAs. Virology 2003, 310, 298–309. [Google Scholar] [CrossRef]
- Allison, R.; Thompson, C.; Ahlquist, P. Regeneration of a Functional RNA Virus Genome by Recombination between Deletion Mutants and Requirement for Cowpea Chlorotic Mottle Virus 3a and Coat Genes for Systemic Infection. Proc. Natl. Acad. Sci. USA 1990, 87, 1820–1824. [Google Scholar] [CrossRef] [PubMed]
- Martín, S.; Sambade, A.; Rubio, L.; Vives, M.C.; Moya, P.; Guerri, J.; Elena, S.F.; Moreno, P. Contribution of Recombination and Selection to Molecular Evolution of Citrus tristeza virus. J. Gen. Virol. 2009, 90, 1527–1538. [Google Scholar] [CrossRef]
Sample ID | Total Read Bases (bp) | Total Reads |
---|---|---|
88-1-IL1 | 4,167,587,618 | 27,599,918 |
88-1-IL2 | 4,636,013,778 | 30,702,078 |
88-1-IL3 | 3,592,283,960 | 23,789,960 |
88-1-SL1 | 4,090,091,398 | 27,086,698 |
88-1-SL2 | 3,609,980,254 | 23,907,154 |
88-1-SL3 | 3,678,504,658 | 24,360,958 |
Sample | Genomic Position | Ref. nt | Alt. nt | Coverage | Amino Acid Change | Variant Frequency (%) |
---|---|---|---|---|---|---|
IL1 | 17,035 | G | U | 8073 | Ala—Ser | 1.6 |
SL2 | 4733 | G | A | 2724 | - | 1.0 |
SL2 | 15,389 | G | A | 3439 | - | 7.0 |
SL2 | 17,494 | G | U | 6736 | Ala—Ser | 1.1 |
SL3 | 3548 | G | U | 6520 | - | 1.0 |
SL3 | 15,755 | G | U | 8751 | - | 1.7 |
Sample | DVG_Type | BP | RP | |
---|---|---|---|---|
Inoculated leaves | IL1/IL2/IL3 | Deletion | 19,462 | 19,580 |
IL1/IL2/IL3 | Insertion | 19,211 | 19,131 | |
IL1/IL2/IL3 | Insertion | 19,811 | 19,772 | |
IL1/IL2 | Deletion | 7020 | 7069 | |
IL1/IL3 | Insertion | 19,204 | 19,124 | |
IL2 | Deletion | 18,971 | 19,107 | |
IL3 | Deletion | 11,065 | 19,577 | |
Systemically infected leaves | SL1/SL2/SL3 | Deletion | 7020 | 7069 |
SL1/SL2/SL3 | Insertion | 19,211 | 19,131 | |
SL1/SL2/SL3 | Insertion | 19,811 | 19,772 | |
SL1/SL3 | Insertion | 19,597 | 19,520 | |
SL1 | Insertion | 19,638 | 19,519 | |
SL2 | Deletion | 19,347 | 19,805 | |
SL2 | Insertion | 19,204 | 19,124 | |
SL3 | Deletion | 490 | 18,353 |
BP | BP Sequence | RP | RP Sequence | DVG Length | |
---|---|---|---|---|---|
1 | 232 (ORF 1a) | TCTGTTAGAATCACCAAGGTG | 18,356 (btw p20/p23) | TAACTTTAATTCGAACAAATA | 1983 |
2 | 394 (ORF 1a) | CCCGTTATCAACGCATCTGGC | 18,355 (btw p20/p23) | CTAACTTTAATTCGAACAAAT | 2146 |
3 | 490 (ORF 1a) | AGGTCCCTCCGTCAGGCAAAG | 18,049 (p20) | TCGCGACAAGCTGCTCTGTAC | 2548 |
4 | 490 (ORF 1a) | AGGTCCCTCCGTCAGGCAAAG | 18,353 (btw p20/p23) | AACTAACTTTAATTCGAACAA | 2244 |
5 | 490 (ORF 1a) | AGGTCCCTCCGTCAGGCAAAG | 17,713 (btw p13/p20) | GTCTATTAGTATAACGTATTA | 2884 |
6 | 490 (ORF 1a) | AGGTCCCTCCGTCAGGCAAAG | 19,077 (btw p23/GFP) | AAGGGTCGTTAATTGACGACT | 1520 |
7 | 518 (ORF 1a) | CTGTTTCCCTTTCTAGCCGGG | 16,218 (CP) | CGATGTTGTTGCTGCCGAGTC | 4407 |
8 | 573 (ORF 1a) | CACACGTTCAAGACTTCACAG | 18,355 (btw p20/p23) | CTAACTTTAATTCGAACAAAT | 2325 |
9 | 7020 (ORF 1a) | GAAGTTGTTACGCAACCTATT | 7069 (ORF 1a) | GGGTTGTTACTTCAAACCCTT | 20,058 |
10 | 11,065 (p33) | TTATTTCTCATTGTATTTCTT | 19,577 (GFP) | TACATCACGGCAGACAAACAA | 11,595 |
11 | 15,008 (p61) | ACGTCATAGTGAAGTGGCTTT | 489 (ORF 1a) | GAGGTCCCTCCGTCAGGCAAA | 5588 |
12 | 16,142 (btw CPm/CP) | ACATTTACTAGGTTTGAATTA | 16,043 (CPm) | TACGCGATTTGGGTAAGTACT | 20,008 |
13 | 18,530 (p23) | ATTATTATCGATGCTTTGATA | 679 (ORF 1a) | TCTCACCTCCCTTACATGGGG | 2256 |
14 | 18,549 (p23) | TACGGAAGAATAGTTATCAGG | 18,542 (p23) | GCTTTGATACGGAAGAATAGT | 20,100 |
15 | 18,971 (p23) | GAGTATCCAGTGAGTCTGAGT | 19,107 (btw p23/GFP) | TTTACTAGGTTTGAATTATGG | 19,971 |
16 | 19,119 (GFP) | GAATTATGGCTAGCAAAGGAG | 16,156 (CP) | TGAATTATGGACGACGAAACA | 17,144 |
17 | 19,347 (GFP) | ATCCGGATCATATGAAACGGC | 19,805 (GFP) | GCTGGGATTACACATGGCATG | 19,649 |
18 | 19,462 (GFP) | CAAGTTTGAAGGTGATACCCT | 19,580 (GFP) | ATCACGGCAGACAAACAAAAG | 19,989 |
19 | 19,578 (GFP) | ACATCACGGCAGACAAACAAA | 19,493 (GFP) | ATCGAGTTAAAAGGTATTGAT | 20,022 |
20 | 19,805 (GFP) | GCTGGGATTACACATGGCATG | 19,347 (GFP) | ATCCGGATCATATGAAACGGC | 19,649 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ferreira Sa Antunes, T.; Huguet-Tapia, J.C.; Elena, S.F.; Folimonova, S.Y. Intra-Host Citrus Tristeza Virus Populations during Prolonged Infection Initiated by a Well-Defined Sequence Variant in Nicotiana benthamiana. Viruses 2024, 16, 1385. https://doi.org/10.3390/v16091385
Ferreira Sa Antunes T, Huguet-Tapia JC, Elena SF, Folimonova SY. Intra-Host Citrus Tristeza Virus Populations during Prolonged Infection Initiated by a Well-Defined Sequence Variant in Nicotiana benthamiana. Viruses. 2024; 16(9):1385. https://doi.org/10.3390/v16091385
Chicago/Turabian StyleFerreira Sa Antunes, Tathiana, José C. Huguet-Tapia, Santiago F. Elena, and Svetlana Y. Folimonova. 2024. "Intra-Host Citrus Tristeza Virus Populations during Prolonged Infection Initiated by a Well-Defined Sequence Variant in Nicotiana benthamiana" Viruses 16, no. 9: 1385. https://doi.org/10.3390/v16091385
APA StyleFerreira Sa Antunes, T., Huguet-Tapia, J. C., Elena, S. F., & Folimonova, S. Y. (2024). Intra-Host Citrus Tristeza Virus Populations during Prolonged Infection Initiated by a Well-Defined Sequence Variant in Nicotiana benthamiana. Viruses, 16(9), 1385. https://doi.org/10.3390/v16091385