Circulating MicroRNAs Related to Arterial Stiffness in Adults with HIV Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Demographic and Clinical Data
2.3. Physical Measurements
2.4. Laboratory Samples
2.5. Pulse Wave Velocity and Pulse Wave Analysis
2.6. MiRNA Analysis
2.6.1. Sample Processing
2.6.2. Isolation of MiRNA from the Serum
2.6.3. Reverse Transcription and PCR Analysis
2.6.4. Selection of MiRNA Primer Assays
2.6.5. Quality Control
2.7. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kitaw, T.A.; Abate, B.B.; Yilak, G.; Tilahun, B.D.; Faris, A.M.; Walle, G.T.; Haile, R.N. Virological Outcomes of Third-Line Antiretroviral Therapy in a Global Context: A Systematic Reviews and Meta-Analysis. AIDS Res. Ther. 2024, 21, 43. [Google Scholar] [CrossRef] [PubMed]
- Trickey, A.; Sabin, C.A.; Burkholder, G.; Crane, H.; d’Arminio Monforte, A.; Egger, M.; Gill, M.J.; Grabar, S.; Guest, J.L.; Jarrin, I.; et al. Life Expectancy after 2015 of Adults with HIV on Long-Term Antiretroviral Therapy in Europe and North America: A Collaborative Analysis of Cohort Studies. Lancet HIV 2023, 10, e295–e307. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention. HIV Surveillance Report: Diagnoses, Deaths, and Prevalence of HIV in the United States and 6 Territories and Freely Associated State. 2022. Available online: https://stacks.cdc.gov/view/cdc/156509 (accessed on 20 September 2024).
- Lerner, A.M.; Eisinger, R.W.; Fauci, A.S. Comorbidities in Persons With HIV: The Lingering Challenge. JAMA 2020, 323, 19–20. [Google Scholar] [CrossRef] [PubMed]
- Zicari, S.; Sessa, L.; Cotugno, N.; Ruggiero, A.; Morrocchi, E.; Concato, C.; Rocca, S.; Zangari, P.; Manno, E.C.; Palma, P. Immune Activation, Inflammation, and Non-AIDS Co-Morbidities in HIV-Infected Patients under Long-Term ART. Viruses 2019, 11, 200. [Google Scholar] [CrossRef] [PubMed]
- McCutcheon, K.; Nqebelele, U.; Murray, L.; Thomas, T.S.; Mpanya, D.; Tsabedze, N. Cardiac and Renal Comorbidities in Aging People Living With HIV. Circ. Res. 2024, 134, 1636–1660. [Google Scholar] [CrossRef]
- Chawla, A.; Wang, C.; Patton, C.; Murray, M.; Punekar, Y.; De Ruiter, A.; Steinhart, C. A Review of Long-Term Toxicity of Antiretroviral Treatment Regimens and Implications for an Aging Population. Infect. Dis. Ther. 2018, 7, 183–195. [Google Scholar] [CrossRef]
- Goulet, J.L.; Fultz, S.L.; Rimland, D.; Butt, A.; Gibert, C.; Rodriguez-Barradas, M.; Bryant, K.; Justice, A.C. Do Patterns of Comorbidity Vary by HIV Status, Age, and HIV Severity? Clin. Infect. Dis. 2007, 45, 1593–1601. [Google Scholar] [CrossRef]
- Mitchell, G.F.; Hwang, S.-J.; Vasan, R.S.; Larson, M.G.; Pencina, M.J.; Hamburg, N.M.; Vita, J.A.; Levy, D.; Benjamin, E.J. Arterial Stiffness and Cardiovascular Events: The Framingham Heart Study. Circulation 2010, 121, 505–511. [Google Scholar] [CrossRef]
- Tsai, J.-P.; Hsu, B.-G. Arterial Stiffness: A Brief Review. Tzu Chi Med. J. 2021, 33, 115–121. [Google Scholar] [CrossRef]
- Van Bortel, L.M.; Laurent, S.; Boutouyrie, P.; Chowienczyk, P.; Cruickshank, J.K.; De Backer, T.; Filipovsky, J.; Huybrechts, S.; Mattace-Raso, F.U.S.; Protogerou, A.D.; et al. Expert Consensus Document on the Measurement of Aortic Stiffness in Daily Practice Using Carotid-Femoral Pulse Wave Velocity. J. Hypertens. 2012, 30, 445–448. [Google Scholar] [CrossRef]
- Mancia, G.; Kreutz, R.; Brunström, M.; Burnier, M.; Grassi, G.; Januszewicz, A.; Muiesan, M.L.; Tsioufis, K.; Agabiti-Rosei, E.; Algharably, E.A.E.; et al. 2023 ESH Guidelines for the Management of Arterial Hypertension The Task Force for the Management of Arterial Hypertension of the European Society of Hypertension: Endorsed by the International Society of Hypertension (ISH) and the European Renal Association (ERA). J. Hypertens. 2023, 41, 1874–2071. [Google Scholar] [CrossRef] [PubMed]
- Weber, T.; Auer, J.; O’Rourke, M.F.; Kvas, E.; Lassnig, E.; Lamm, G.; Stark, N.; Rammer, M.; Eber, B. Increased Arterial Wave Reflections Predict Severe Cardiovascular Events in Patients Undergoing Percutaneous Coronary Interventions. Eur. Heart J. 2005, 26, 2657–2663. [Google Scholar] [CrossRef] [PubMed]
- Laurent, S.; Cockcroft, J.; Van Bortel, L.; Boutouyrie, P.; Giannattasio, C.; Hayoz, D.; Pannier, B.; Vlachopoulos, C.; Wilkinson, I.; Struijker-Boudier, H.; et al. Expert Consensus Document on Arterial Stiffness: Methodological Issues and Clinical Applications. Eur. Heart J. 2006, 27, 2588–2605. [Google Scholar] [CrossRef] [PubMed]
- Kuate Defo, A.; Chalati, M.D.; Labos, C.; Fellows, L.K.; Mayo, N.E.; Daskalopoulou, S.S. Association of HIV Infection and Antiretroviral Therapy with Arterial Stiffness: A Systematic Review and Meta-Analysis. Hypertension 2021, 78, 320–332. [Google Scholar] [CrossRef] [PubMed]
- Leite, L.H.M.; Cohen, A.; Boccara, F. HIV Infection and Aortic Stiffness. Arch. Cardiovasc. Dis. 2017, 110, 495–502. [Google Scholar] [CrossRef]
- Kaplan, R.C.; Sinclair, E.; Landay, A.L.; Lurain, N.; Sharrett, A.R.; Gange, S.J.; Xue, X.; Parrinello, C.M.; Hunt, P.; Deeks, S.G.; et al. T Cell Activation Predicts Carotid Artery Stiffness among HIV-Infected Women. Atherosclerosis 2011, 217, 207–213. [Google Scholar] [CrossRef]
- Baker, J.V.; Sharma, S.; Achhra, A.C.; Bernardino, J.I.; Bogner, J.R.; Duprez, D.; Emery, S.; Gazzard, B.; Gordin, J.; Grandits, G.; et al. Changes in Cardiovascular Disease Risk Factors With Immediate Versus Deferred Antiretroviral Therapy Initiation Among HIV-Positive Participants in the START (Strategic Timing of Antiretroviral Treatment) Trial. J. Am. Heart Assoc. 2017, 6, e004987. [Google Scholar] [CrossRef]
- Msoka, T.F.; Van Guilder, G.P.; Smulders, Y.M.; Van Furth, M.; Bartlett, J.A.; Van Agtmael, M.A. Antiretroviral Treatment and Time since HIV-1 Diagnosis Are Associated with Large Artery Stiffness in Sub-Saharan African HIV-1 Patients. Artery Res. 2016, 16, 34–41. [Google Scholar] [CrossRef]
- Maia-Leite, L.H.; Catez, E.; Boyd, A.; Haddour, N.; Curjol, A.; Lang, S.; Nuernberg, M.; Duvivier, C.; Desvarieux, M.; Kirstetter, M.; et al. Aortic Stiffness Aging Is Influenced by Past Profound Immunodeficiency in HIV-Infected Individuals: Results from the EVAS-HIV (EValuation of Aortic Stiffness in HIV-Infected Individuals). J. Hypertens. 2016, 34, 1338–1346. [Google Scholar] [CrossRef]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. Elegans Heterochronic Gene Lin-4 Encodes Small RNAs with Antisense Complementarity to Lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.; Croce, C.M. MicroRNA: Trends in Clinical Trials of Cancer Diagnosis and Therapy Strategies. Exp. Mol. Med. 2023, 55, 1314–1321. [Google Scholar] [CrossRef] [PubMed]
- Almeida, M.I.; Reis, R.M.; Calin, G.A. MicroRNA History: Discovery, Recent Applications, and next Frontiers. Mutat. Res. 2011, 717, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Nanoudis, S.; Pikilidou, M.; Yavropoulou, M.; Zebekakis, P. The Role of MicroRNAs in Arterial Stiffness and Arterial Calcification. An Update and Review of the Literature. Front. Genet. 2017, 8, 209. [Google Scholar] [CrossRef] [PubMed]
- Baraban, J.M.; Tuday, E.; Berkowitz, D.E.; Das, S. Deciphering the Role of microRNAs in Large-Artery Stiffness Associated With Aging: Focus on miR-181b. Front. Physiol. 2021, 12, 747789. [Google Scholar] [CrossRef]
- Pozniak, T.; Shcharbin, D.; Bryszewska, M. Circulating microRNAs in Medicine. Int. J. Mol. Sci. 2022, 23, 3996. [Google Scholar] [CrossRef]
- Creemers, E.E.; Tijsen, A.J.; Pinto, Y.M. Circulating MicroRNAs: Novel Biomarkers and Extracellular Communicators in Cardiovascular Disease? Circ. Res. 2012, 110, 483–495. [Google Scholar] [CrossRef]
- Wang, H.; Peng, R.; Wang, J.; Qin, Z.; Xue, L. Circulating microRNAs as Potential Cancer Biomarkers: The Advantage and Disadvantage. Clin. Epigenet. 2018, 10, 59. [Google Scholar] [CrossRef]
- Da Fonseca Ferreira, A.; Wei, J.; Zhang, L.; Macon, C.J.; Degnan, B.; Jayaweera, D.; Hare, J.M.; Kolber, M.A.; Bellio, M.; Khan, A.; et al. HIV Promotes Atherosclerosis via Circulating Extracellular Vesicle MicroRNAs. Int. J. Mol. Sci. 2023, 24, 7567. [Google Scholar] [CrossRef]
- Van Almen, G.C.; Verhesen, W.; Van Leeuwen, R.E.W.; Van De Vrie, M.; Eurlings, C.; Schellings, M.W.M.; Swinnen, M.; Cleutjens, J.P.M.; Van Zandvoort, M.A.M.J.; Heymans, S.; et al. MicroRNA-18 and microRNA-19 Regulate CTGF and TSP-1 Expression in Age-related Heart Failure. Aging Cell 2011, 10, 769–779. [Google Scholar] [CrossRef]
- Gao, F.; Kataoka, M.; Liu, N.; Liang, T.; Huang, Z.-P.; Gu, F.; Ding, J.; Liu, J.; Zhang, F.; Ma, Q.; et al. Therapeutic Role of miR-19a/19b in Cardiac Regeneration and Protection from Myocardial Infarction. Nat. Commun. 2019, 10, 1802. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Cui, Y.; Zhu, T. MicroRNA-19 Upregulation Attenuates Cardiac Fibrosis via Targeting Connective Tissue Growth Factor. Am. J. Med. Sci. 2023, 365, 375–385. [Google Scholar] [CrossRef] [PubMed]
- Beaumont, J.; López, B.; Ravassa, S.; Hermida, N.; San José, G.; Gallego, I.; Valencia, F.; Gómez-Doblas, J.J.; De Teresa, E.; Díez, J.; et al. MicroRNA-19b Is a Potential Biomarker of Increased Myocardial Collagen Cross-Linking in Patients with Aortic Stenosis and Heart Failure. Sci. Rep. 2017, 7, 40696. [Google Scholar] [CrossRef] [PubMed]
- Lorenzen, J.M.; Schauerte, C.; Hübner, A.; Kölling, M.; Martino, F.; Scherf, K.; Batkai, S.; Zimmer, K.; Foinquinos, A.; Kaucsar, T.; et al. Osteopontin Is Indispensible for AP1-Mediated Angiotensin II-Related miR-21 Transcription during Cardiac Fibrosis. Eur. Heart J. 2015, 36, 2184–2196. [Google Scholar] [CrossRef]
- Zuo, K.; Li, M.; Zhang, X.; Lu, C.; Wang, S.; Zhi, K.; He, B. MiR-21 Suppresses Endothelial Progenitor Cell Proliferation by Activating the TGFβ Signaling Pathway via Downregulation of WWP1. Int. J. Clin. Exp. Pathol. 2015, 8, 414–422. [Google Scholar]
- Maurer, B.; Stanczyk, J.; Jüngel, A.; Akhmetshina, A.; Trenkmann, M.; Brock, M.; Kowal-Bielecka, O.; Gay, R.E.; Michel, B.A.; Distler, J.H.W.; et al. MicroRNA-29, a Key Regulator of Collagen Expression in Systemic Sclerosis. Arthritis Rheum. 2010, 62, 1733–1743. [Google Scholar] [CrossRef]
- Verdura, E.; Hervé, D.; Bergametti, F.; Jacquet, C.; Morvan, T.; Prieto-Morin, C.; Mackowiak, A.; Manchon, E.; Hosseini, H.; Cordonnier, C.; et al. Disruption of a miR-29 Binding Site Leading to COL4A1 Upregulation Causes Pontine Autosomal Dominant Microangiopathy with Leukoencephalopathy. Ann. Neurol. 2016, 80, 741–753. [Google Scholar] [CrossRef]
- Li, J.; Cen, B.; Chen, S.; He, Y. MicroRNA-29b Inhibits TGF-Β1-Induced Fibrosis via Regulation of the TGF-Β1/Smad Pathway in Primary Human Endometrial Stromal Cells. Mol. Med. Rep. 2016, 13, 4229–4237. [Google Scholar] [CrossRef]
- Jiang, W.; Zhang, Z.; Yang, H.; Lin, Q.; Han, C.; Qin, X. The Involvement of miR-29b-3p in Arterial Calcification by Targeting Matrix Metalloproteinase-2. BioMed Res. Int. 2017, 2017, 6713606. [Google Scholar] [CrossRef]
- Harris, T.A.; Yamakuchi, M.; Ferlito, M.; Mendell, J.T.; Lowenstein, C.J. MicroRNA-126 Regulates Endothelial Expression of Vascular Cell Adhesion Molecule 1. Proc. Natl. Acad. Sci. USA 2008, 105, 1516–1521. [Google Scholar] [CrossRef]
- Wu, Q.; Qi, B.; Duan, X.; Ming, X.; Yan, F.; He, Y.; Bu, X.; Sun, S.; Zhu, H. MicroRNA-126 Enhances the Biological Function of Endothelial Progenitor Cells under Oxidative Stress via PI3K/Akt/GSK-3β and ERK1/2 Signaling Pathways: MiRNA-126 Enhances the Biological Function of EPCs. Bosn. J. Basic Med. Sci. 2020, 21, 71. [Google Scholar] [CrossRef]
- Feng, Y.; Bao, Y.; Ding, J.; Li, H.; Liu, W.; Wang, X.; Guan, H.; Chen, Z. MicroRNA-130a Attenuates Cardiac Fibrosis after Myocardial Infarction through TGF-β/Smad Signaling by Directly Targeting TGF-β Receptor 1. Bioengineered 2022, 13, 5779–5791. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Wang, Z.; Li, Z.; Wang, M.; Wang, W.; Chang, G. MicroRNA-130a Inhibits Proliferation of Vascular Smooth Muscle Cells by Suppressing Autophagy via ATG2B. J. Cell Mol. Med. 2021, 25, 3829–3839. [Google Scholar] [CrossRef] [PubMed]
- Meng, S.; Cao, J.; Zhang, X.; Fan, Y.; Fang, L.; Wang, C.; Lv, Z.; Fu, D.; Li, Y. Downregulation of MicroRNA-130a Contributes to Endothelial Progenitor Cell Dysfunction in Diabetic Patients via Its Target Runx3. PLoS ONE 2013, 8, e68611. [Google Scholar] [CrossRef] [PubMed]
- Zhao, N.; Koenig, S.N.; Trask, A.J.; Lin, C.-H.; Hans, C.P.; Garg, V.; Lilly, B. MicroRNA miR145 Regulates TGFBR2 Expression and Matrix Synthesis in Vascular Smooth Muscle Cells. Circ. Res. 2015, 116, 23–34. [Google Scholar] [CrossRef]
- Davis-Dusenbery, B.N.; Chan, M.C.; Reno, K.E.; Weisman, A.S.; Layne, M.D.; Lagna, G.; Hata, A. Down-Regulation of Krüppel-like Factor-4 (KLF4) by MicroRNA-143/145 Is Critical for Modulation of Vascular Smooth Muscle Cell Phenotype by Transforming Growth Factor-β and Bone Morphogenetic Protein 4. J. Biol. Chem. 2011, 286, 28097–28110. [Google Scholar] [CrossRef]
- Guo, X.; Li, D.; Chen, M.; Chen, L.; Zhang, B.; Wu, T.; Guo, R. miRNA-145 Inhibits VSMC Proliferation by Targeting CD40. Sci. Rep. 2016, 6, 35302. [Google Scholar] [CrossRef]
- Hori, D.; Dunkerly-Eyring, B.; Nomura, Y.; Biswas, D.; Steppan, J.; Henao-Mejia, J.; Adachi, H.; Santhanam, L.; Berkowitz, D.E.; Steenbergen, C.; et al. miR-181b Regulates Vascular Stiffness Age Dependently in Part by Regulating TGF-β Signaling. PLoS ONE 2017, 12, e0174108. [Google Scholar] [CrossRef]
- Liu, X.; Cheng, Y.; Zhang, S.; Lin, Y.; Yang, J.; Zhang, C. A Necessary Role of miR-221 and miR-222 in Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia. Circ. Res. 2009, 104, 476–487. [Google Scholar] [CrossRef]
- Mackenzie, N.C.W.; Staines, K.A.; Zhu, D.; Genever, P.; MacRae, V.E. miRNA-221 and miRNA-222 Synergistically Function to Promote Vascular Calcification. Cell Biochem. Funct. 2014, 32, 209–216. [Google Scholar] [CrossRef]
- Yan, Y.; Xu, Y.; Ni, G.; Wang, S.; Li, X.; Gao, J.; Zhang, H. MicroRNA-221 Promotes Proliferation and Migration of Pulmonary Arterial Smooth Muscle Cells (PASMCs) by Targeting Tissue Inhibitor of Metalloproteinases-3 (TIMP3). Cardiovasc. Diagn. Ther. 2020, 10, 646–657. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Bei, Y.; Shen, S.; Zhang, J.; Lu, Y.; Xiao, J.; Li, X. MicroRNA-222 Promotes the Proliferation of Pulmonary Arterial Smooth Muscle Cells by Targeting P27 and TIMP3. Cell Physiol. Biochem. 2017, 43, 282–292. [Google Scholar] [CrossRef] [PubMed]
- Tabet, F.; Vickers, K.C.; Cuesta Torres, L.F.; Wiese, C.B.; Shoucri, B.M.; Lambert, G.; Catherinet, C.; Prado-Lourenco, L.; Levin, M.G.; Thacker, S.; et al. HDL-Transferred microRNA-223 Regulates ICAM-1 Expression in Endothelial Cells. Nat. Commun. 2014, 5, 3292. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Wang, H.; Liu, Y.; Song, Y.; Lai, L.; Han, Q.; Cao, X.; Wang, Q. Inducible MicroRNA-223 Down-Regulation Promotes TLR-Triggered IL-6 and IL-1β Production in Macrophages by Targeting STAT3. PLoS ONE 2012, 7, e42971. [Google Scholar] [CrossRef]
- Jia, C.Y.; Li, H.H.; Zhu, X.C.; Dong, Y.W.; Fu, D.; Zhao, Q.L.; Wu, W.; Wu, X.Z. MiR-223 Suppresses Cell Proliferation by Targeting IGF-1R. PLoS ONE 2011, 6, e27008. [Google Scholar] [CrossRef]
- Liu, D.; Pan, J.; Zhao, D.; Liu, F. MicroRNA-223 Inhibits Deposition of the Extracellular Matrix by Airway Smooth Muscle Cells through Targeting IGF-1R in the PI3K/Akt Pathway. Am. J. Transl. Res. 2018, 10, 744–752. [Google Scholar]
- Rangrez, A.Y.; M’Baya-Moutoula, E.; Metzinger-Le Meuth, V.; Hénaut, L.; Djelouat, M.S.E.I.; Benchitrit, J.; Massy, Z.A.; Metzinger, L. Inorganic Phosphate Accelerates the Migration of Vascular Smooth Muscle Cells: Evidence for the Involvement of miR-223. PLoS ONE 2012, 7, e47807. [Google Scholar] [CrossRef]
- Mach, F.; Baigent, C.; Catapano, A.L.; Koskinas, K.C.; Casula, M.; Badimon, L.; Chapman, M.J.; De Backer, G.G.; Delgado, V.; Ference, B.A.; et al. 2019 ESC/EAS Guidelines for the Management of Dyslipidaemias: Lipid Modification to Reduce Cardiovascular Risk. Atherosclerosis 2019, 290, 140–205. [Google Scholar] [CrossRef]
- Katsiki, N.; Filippatos, T.; Vlachopoulos, C.; Panagiotakos, D.; Milionis, H.; Tselepis, A.; Garoufi, A.; Rallidis, L.; Richter, D.; Nomikos, T.; et al. Executive Summary of the Hellenic Atherosclerosis Society Guidelines for the Diagnosis and Treatment of Dyslipidemias—2023. Atheroscler. Plus 2024, 55, 74–92. [Google Scholar] [CrossRef]
- Morando, N.; Rosenzvit, M.C.; Pando, M.A.; Allmer, J. The Role of MicroRNAs in HIV Infection. Genes 2024, 15, 574. [Google Scholar] [CrossRef]
- Lopez-Santillan, M.; Larrabeiti-Etxebarria, A.; Arzuaga-Mendez, J.; Lopez-Lopez, E.; Garcia-Orad, A. Circulating miRNAs as Biomarkers in Diffuse Large B-Cell Lymphoma: A Systematic Review. Oncotarget 2018, 9, 22850–22861. [Google Scholar] [CrossRef] [PubMed]
- Troppan, K.; Wenzl, K.; Deutsch, A.; Ling, H.; Neumeister, P.; Pichler, M. MicroRNAs in Diffuse Large B-Cell Lymphoma: Implications for Pathogenesis, Diagnosis, Prognosis and Therapy. Anticancer Res. 2014, 34, 557–564. [Google Scholar]
- Ntsekhe, M.; Baker, J.V. Cardiovascular Disease Among Persons Living With HIV: New Insights Into Pathogenesis and Clinical Manifestations in a Global Context. Circulation 2023, 147, 83–100. [Google Scholar] [CrossRef] [PubMed]
- Torriani, F.J.; Komarow, L.; Parker, R.A.; Cotter, B.R.; Currier, J.S.; Dubé, M.P.; Fichtenbaum, C.J.; Gerschenson, M.; Mitchell, C.K.C.; Murphy, R.L.; et al. Endothelial Function in Human Immunodeficiency Virus-Infected Antiretroviral-Naive Subjects Before and After Starting Potent Antiretroviral Therapy. J. Am. Coll. Cardiol. 2008, 52, 569–576. [Google Scholar] [CrossRef] [PubMed]
- Karim, R.; Mack, W.J.; Kono, N.; Tien, P.C.; Anastos, K.; Lazar, J.; Young, M.; Desai, S.; Golub, E.T.; Kaplan, R.C.; et al. T-Cell Activation, Both Pre- and Post-HAART Levels, Correlates With Carotid Artery Stiffness Over 6.5 Years Among HIV-Infected Women in the WIHS. J. Acquir. Immune Defic. Syndr. 2014, 67, 349–356. [Google Scholar] [CrossRef]
- Bao, M.-H.; Feng, X.; Zhang, Y.-W.; Lou, X.-Y.; Cheng, Y.; Zhou, H.-H. Let-7 in Cardiovascular Diseases, Heart Development and Cardiovascular Differentiation from Stem Cells. Int. J. Mol. Sci. 2013, 14, 23086–23102. [Google Scholar] [CrossRef]
- Dantas-Komatsu, R.C.S.; Cruz, M.S.; Freire, P.P.; Diniz, R.V.Z.; Bortolin, R.H.; Cabral-Marques, O.; Souza, K.B.D.S.; Hirata, M.H.; Hirata, R.D.C.; Reis, B.Z.; et al. The Let-7b-5p, miR-326, and miR-125a-3p Are Associated with Left Ventricular Systolic Dysfunction in Post-Myocardial Infarction. Front. Cardiovasc. Med. 2023, 10, 1151855. [Google Scholar] [CrossRef]
- Bernstein, D.L.; Jiang, X.; Rom, S. Let-7 microRNAs: Their Role in Cerebral and Cardiovascular Diseases, Inflammation, Cancer, and Their Regulation. Biomedicines 2021, 9, 606. [Google Scholar] [CrossRef]
- Tang, Y.; Zhang, Y.; Chen, Y.; Xiang, Y.; Shen, C.; Li, Y. The Role of miR-19b in the Inhibition of Endothelial Cell Apoptosis and Its Relationship with Coronary Artery Disease. Sci. Rep. 2015, 5, 15132. [Google Scholar] [CrossRef]
- Parthenakis, F.; Marketou, M.; Kontaraki, J.; Patrianakos, A.; Nakou, H.; Touloupaki, M.; Vernardos, M.; Kochiadakis, G.; Chlouverakis, G.; Vardas, P. Low Levels of Micro RNA -21 Are a Marker of Reduced Arterial Stiffness in Well-Controlled Hypertension. J. Clin. Hypertens. 2017, 19, 235–240. [Google Scholar] [CrossRef]
- Zhu, J.; Tang, Z.; Ren, J.; Geng, J.; Guo, F.; Xu, Z.; Jia, J.; Chen, L.; Jia, Y. Downregulation of microRNA-21 Contributes to Decreased Collagen Expression in Venous Malformations via Transforming Growth Factor-β/Smad3/microRNA-21 Signaling Feedback Loop. J. Vasc. Surg. Venous Lymphat. Disord. 2022, 10, 469–481.e2. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Li, W.; Chang, G.-Q.; Ye, C.-S.; Ou, J.-S.; Li, X.-X.; Liu, Y.; Cheang, T.-Y.; Huang, X.-L.; Wang, S.-M. MicroRNA-21 Regulates Vascular Smooth Muscle Cell Function via Targeting Tropomyosin 1 in Arteriosclerosis Obliterans of Lower Extremities. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 2044–2053. [Google Scholar] [CrossRef] [PubMed]
- Lacolley, P.; Regnault, V.; Laurent, S. Mechanisms of Arterial Stiffening: From Mechanotransduction to Epigenetics. Arterioscler. Thromb. Vasc. Biol. 2020, 40, 1055–1062. [Google Scholar] [CrossRef] [PubMed]
- Lacolley, P.; Regnault, V.; Segers, P.; Laurent, S. Vascular Smooth Muscle Cells and Arterial Stiffening: Relevance in Development, Aging, and Disease. Physiol. Rev. 2017, 97, 1555–1617. [Google Scholar] [CrossRef]
- Theofilis, P.; Oikonomou, E.; Vogiatzi, G.; Sagris, M.; Antonopoulos, A.S.; Siasos, G.; Iliopoulos, D.C.; Perrea, D.; Vavouranakis, M.; Tsioufis, K.; et al. The Role of MicroRNA-126 in Atherosclerotic Cardiovascular Diseases. Curr. Med. Chem. 2023, 30, 1902–1921. [Google Scholar] [CrossRef]
- Wei, Y.; Nazari-Jahantigh, M.; Neth, P.; Weber, C.; Schober, A. MicroRNA-126, -145, and -155: A Therapeutic Triad in Atherosclerosis? Arterioscler. Thromb. Vasc. Biol. 2013, 33, 449–454. [Google Scholar] [CrossRef]
- Kontaraki, J.E.; Marketou, M.E.; Zacharis, E.A.; Parthenakis, F.I.; Vardas, P.E. MiR-1, miR-9 and miR-126 Levels in Peripheral Blood Mononuclear Cells of Patients with Essential Hypertension Associate with Prognostic Indices of Ambulatory Blood Pressure Monitoring. Eur. Heart J. 2013, 34, P5158. [Google Scholar] [CrossRef]
- Liu, J.; Liu, J.; Shi, L.; Zhang, F.; Yu, L.; Yang, X.; Cai, J. Preliminary Study of microRNA-126 as a Novel Therapeutic Target for Primary Hypertension. Int. J. Mol. Med. 2018, 41, 1835–1844. [Google Scholar] [CrossRef]
- Matshazi, D.M.; Weale, C.J.; Erasmus, R.T.; Kengne, A.P.; Davids, S.F.G.; Raghubeer, S.; Davison, G.M.; Matsha, T.E. Circulating Levels of MicroRNAs Associated With Hypertension: A Cross-Sectional Study in Male and Female South African Participants. Front. Genet. 2021, 12, 710438. [Google Scholar] [CrossRef]
- Martinez-Arroyo, O.; Ortega, A.; Flores-Chova, A.; Sanchez-Garcia, B.; Garcia-Garcia, A.B.; Chaves, F.J.; Martin-Escudero, J.C.; Forner, M.J.; Redon, J.; Cortes, R. High miR-126-3p Levels Associated with Cardiovascular Events in a General Population. Eur. J. Intern. Med. 2023, 113, 49–56. [Google Scholar] [CrossRef]
- Abu-Halima, M.; Oberhoffer, F.S.; Wagner, V.; Abd El Rahman, M.; Jung, A.-M.; Zemlin, M.; Rohrer, T.R.; Meese, E.; Abdul-Khaliq, H. MicroRNA-126-3p/5p and Aortic Stiffness in Patients with Turner Syndrome. Children 2022, 9, 1109. [Google Scholar] [CrossRef]
- Alkagiet, S.; Tziomalos, K. Vascular Calcification: The Role of microRNAs. Biomol. Concepts 2017, 8, 119–123. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Ouyang, Y.; Che, J.; Li, X.; Zhao, Y.; Yang, K.; Zhao, X.; Chen, Y.; Fan, C.; Yuan, W. Potential Value of miR-221/222 as Diagnostic, Prognostic, and Therapeutic Biomarkers for Diseases. Front. Immunol. 2017, 8, 56. [Google Scholar] [CrossRef] [PubMed]
- Coulson, D.J.; Bakhashab, S.; Latief, J.S.; Weaver, J.U. MiR-126, IL-7, CXCR1/2 Receptors, Inflammation and Circulating Endothelial Progenitor Cells: The Study on Targets for Treatment Pathways in a Model of Subclinical Cardiovascular Disease (Type 1 Diabetes Mellitus). J. Transl. Med. 2021, 19, 140. [Google Scholar] [CrossRef] [PubMed]
Gene Symbol | MiScript Primer Assay Catalog | MiRNA Sequence | Target Gene | Predicted Function |
---|---|---|---|---|
hsa-let-7b-5p | MS00003122 | 5′UGAGGUAGUAGGUUGUGUGGUU | Hmga2 | Increases arterial stiffness and promotes endothelial dysfunction [30]. |
hsa-miR-19b-3p | MS00006545 | 5′UGUGCAAAUCCAUGCAAAACUGA | CTGF, TSP-1, LOX | Decreases arterial stiffness [31,32,33,34]. |
hsa-miR-21-5p | MS00003213 | 5′UAGCUUAUCAGACUGAUGUUGA | PTEN/SMAD7, WWP1 | Increases arterial stiffness [35,36]. |
hsa-miR-29a-3p | MS00044653 | 5′UAGCACCAUCUGAAAUCGGUUA | COL1A1, COL3A1, COL4A1, TGFB2, MMP2 | Decreases arterial stiffness and arterial calcification [37,38,39,40]. |
hsa-miR-126-3p | MS00003430 | 5′UCGUACCGUGAGUAAUAAUGCG | VCAM-1, PI3K/AKT | Decreases arterial stiffness [41,42]. |
hsa-miR-130a-3p | MS00003444 | 5′CAGUGCAAUGUUAAAAGGGCAU | TGFBR1, ATG2B, RUNX3 | Inhibits VSMC proliferation, maintains normal endothelial function, and reduces fibrosis [43,44,45]. |
hsa-miR-145-5p | MS00003528 | 5′GUCCAGUUUUCCCAGGAAUCCCU | TGFBR2, KLF4, CD40 | Decreases arterial stiffness and VSMC proliferation [46,47,48]. |
hsa-miR-181b-5p | MS00006699 | 5′AACAUUCAUUGCUGUCGGUGGGU | TGFBi | Decreases arterial stiffness [49]. |
hsa-miR-221-3p | MS00003857 | 5′AGCUACAUUGUCUGCUGGGUUUC | p27, p57, Enpp1 and Pit-1, TIMP3 | Promotes VSMC proliferation and arterial calcification [50,51,52] |
hsa-miR-222-3p | MS00007609 | 5′AGCUACAUCUGGCUACUGGGU | p27, p57, Enpp1 and Pit-1, TIMP3 | Promotes VSMC proliferation and arterial calcification [50,51,53] |
hsa-miR-223-3p | MS00003871 | 5′UGUCAGUUUGUCAAAUACCCCA | ICAM-1, IL6/STAT3, IGF1R, mef2c | Decreases arterial inflammation and calcification, controversy on VSMC function [54,55,56,57,58]. |
cel-miR-39-3p | MS00019789 | 5′UCACCGGGUGUAAAUCAGCUUG | (-) | Spike-in control |
hsa-miR-16-5p | MS00006517 | 5′UAGCAGCACGUAAAUAUUGGCG | (-) | Control housekeeping gene |
hsa-miR-451a | MS00004242 | 5′AAACCGUUACCAUUACUGAGUU | (-) | Control housekeeping gene |
PWH (n = 36) | People Without HIV (n = 36) | p-Value | |
---|---|---|---|
Sociodemographic and Clinical Parameters | |||
Age (years) | 53 (51–57.8) | 54 (51–58.8) | 0.852 |
BMI (kg/m2) | 26.3 ± 2.1 | 26.7 ± 2.1 | 0.399 |
Waist circumference (cm) | 99.5 ± 8.3 | 98 ± 7.7 | 0.438 |
Smoking, n (%) | 27 (75) | 24 (66.7) | 0.437 |
Pack years, (n) | 24.5 (0.5–35.8) | 17 (0–34.5) | 0.545 |
Physical activity, n (%) | 18 (50) | 13 (36.1) | 0.234 |
Alcohol abuse, n (%) | 0 (0) | 1 (2.8) | 1.000 |
Dyslipidemia, n (%) | 21 (58.3) | 23 (63.9) | 0.629 |
Lipid-lowering agents, n (%) | 8 (22.2) | 7 (19.4) | 0.772 |
FRS, (n) | 15.6 (11.2–23.4) | 13.2 (8.5–17.6) | 0.107 |
HellenicSCORE2, (n) | 3 (2–4) | 3 (2–3.9) | 0.416 |
Laboratory parameters | |||
Fasting glucose (mg/dl) | 92 (87–98) | 95 (84–104) | 0.782 |
Total cholesterol (mg/dl) | 194 ± 32 | 200 ± 36 | 0.477 |
Triglycerides (mg/dl) | 134 ± 54 | 124 ± 55 | 0.439 |
HDL cholesterol (mg/dl) | 45 ± 10 | 53 ± 12 | 0.002 |
LDL cholesterol (mg/dl) | 122 ± 28 | 122 ± 32 | 0.960 |
eGFR (mL/min/1.73 m2) | 90.4 ± 17.2 | 88.6 ± 16 | 0.638 |
Hemodynamic parameters | |||
bSBP (mmHg) | 127.2 ±11.6 | 126.4 ± 14.1 | 0.799 |
bDBP (mmHg) | 80.4 ± 6.7 | 78.7 ± 10.1 | 0.396 |
bPP (mmHg) | 46.8 ± 8.4 | 47.7 ± 8.4 | 0.636 |
MBP (mmHg) | 96 ± 7.7 | 94.6 ± 10.9 | 0.531 |
aSBP (mmHg) | 116.8 ± 11.6 | 116.11 ± 13.3 | 0.836 |
aDBP (mmHg) | 81.6 ± 6.8 | 79.8 ± 10.1 | 0.371 |
aPP (mmHg) | 35.1 ± 7.7 | 36.4 ± 7.3 | 0.493 |
Heart rate (bpm) | 74 ± 10 | 71 ± 10 | 0.222 |
AIx@75 (%) | 21.6 ± 7.4 | 18.5 ± 8.2 | 0.092 |
cfPWV (m/s) | 9.3 ± 1.4 | 8.6 ± 1.2 | 0.019 |
Variable | Value |
---|---|
Duration of HIV infection (years) | 13.5 (8–19.8) |
Duration of ART (years) | 12 (7–18) |
VL < 50 c/mL, n (%) | 35 (97.2) |
Current CD4+T-cell count (cells/mm3) | 831 ± 365 |
Current CD4+T-cell < 200 cells/mm3 (%) | 0 (0) |
Nadir CD4+T-cell count (cells/mm3) | 269 (111–368) |
Nadir CD4+T-cell < 200 cells/mm3 (%) | 14 (38.9) |
D:A:D 5-year risk score | 5.8 ± 2.9 |
Current NNRTI-based ART | |
n (%) | 13 (36.1) |
Years | 9.4 ± 3.1 |
Current PI-based ART | |
n (%) | 15 (41.7) |
Years | 11.9 ± 5.6 |
Current INSTI-based ART | |
n (%) | 15 (41.7) |
Years | 2 (1–4) |
Current TDF-based ART | |
n (%) | 25 (69.4) |
Years | 6 ± 2.7 |
Current ABC-based ART | |
n (%) | 2 (5.6) |
Years | 6.5 ± 0.7 |
Cumulative NNRTI-based ART | |
n (%) | 19 (52.8) |
Years | 9.8 ± 4.2 |
Cumulative PI-based ART | |
n (%) | 26 (72.2) |
Years | 7 (6–14) |
Cumulative INSTI-based ART | |
n (%) | 16 (44.4) |
Years | 2 (1–5) |
Cumulative TDF-based ART | |
n (%) | 32 (88.9) |
Years | 6.5 ± 3 |
Cumulative ABC-based ART | |
n (%) | 7 (19.4) |
Years | 5.3 ± 3.1 |
miRNA | 2−ΔCt | p-Value | Fold Change Comparing to People Without HIV | 95% CI | |
---|---|---|---|---|---|
PWH | People Without HIV | ||||
let-7b-5p | 0.127860 | 0.024419 | 0.027 | 5.24 | 1.86~8.61 |
miR-19b-3p | 0.060110 | 0.099174 | 0.049 | 0.61 | 0.20~1.01 |
miR-21-5p | 0.360600 | 0.105762 | <0.001 | 3.41 | 1.75~5.07 |
miR-29a-3p | 0.009141 | 0.008749 | 0.074 | 1.04 | 0.42~1.67 |
miR-126-3p | 0.037678 | 0.030660 | 0.019 | 1.23 | 0.64~1.82 |
miR-130a-3p | 0.003910 | 0.005483 | 0.686 | 0.71 | 0.32~1.10 |
miR-145-5p | 0.008211 | 0.005691 | 0.190 | 1.44 | 0.45~2.44 |
miR-181b-5p | 0.006856 | 0.002813 | 0.191 | 2.44 | 0.64~4.24 |
miR-221-3p | 0.013447 | 0.017244 | 0.846 | 0.78 | 0.35~1.21 |
miR-222-3p | 0.009027 | 0.002730 | 0.002 | 3.31 | 1.10~5.51 |
miR-223-3p | 0.131354 | 0.045253 | 0.115 | 2.90 | 0.81~4.99 |
Characteristics | Bivariable | Multivariable | ||||
---|---|---|---|---|---|---|
β | 95%CI | p-Value | β | 95%CI | p-Value | |
Sociodemographic and Clinical Parameters | ||||||
Age (years) | 0.027 | −0.013~0.067 | 0.181 | - | - | - |
BMI (kg/m2) | −0.050 | −0.150~0.049 | 0.314 | - | - | - |
Lipid-lowering agents, n (%) | 0.021 | −0.482~0.525 | 0.932 | - | - | - |
Smoking, n (%) | −0.056 | −0.539~0.427 | 0.815 | - | - | - |
Pack years, (n) | 0.002 | −0.006~0.010 | 0.606 | - | - | - |
FRS, (n) | 0.024 | −0.003~0.050 | 0.077 | - | - | - |
HellenicSCORE2, (n) | 0.076 | −0.043~0.196 | 0.204 | - | - | - |
Laboratory Parameters | ||||||
Fasting glucose (mg/dl) | −0.004 | −0.022~0.014 | 0.616 | - | - | - |
Total cholesterol (mg/dl) | 0.003 | −0.003~0.010 | 0.302 | - | - | - |
LDL cholesterol (mg/dl) | 0.001 | −0.006~0.008 | 0.760 | - | - | - |
eGFR (mL/min/1.73 m2) | 0.002 | −0.011~0.014 | 0.769 | - | - | - |
Hemodynamic Parameters | ||||||
bSBP (mmHg) | 0.027 | 0.012~0.043 | 0.001 | - | - | - |
bDBP (mmHg) | 0.024 | −0.007~0.054 | 0.121 | - | - | - |
bPP (mmHg) | 0.037 | 0.015~0.059 | 0.002 | 0.030 | 0.008~0.051 | 0.009 |
MBP (mmHg) | 0.033 | 0.008~0.058 | 0.012 | - | - | - |
aSBP (mmHg) | 0.025 | 0.009~0.041 | 0.003 | - | - | - |
aDBP (mmHg) | 0.023 | −0.007~0.053 | 0.132 | - | - | - |
aPP (mmHg) | 0.040 | 0.016~0.063 | 0.002 | - | - | - |
AIx@75 (%) | 0.012 | −0.017~0.040 | 0.401 | - | - | - |
cfPWV (m/s) | 0.120 | −0.027~0.268 | 0.107 | - | - | - |
HIV-Related Parameters | ||||||
Duration of HIV infection (years) | 0.006 | −0.027~0.039 | 0.714 | - | - | - |
Duration of ART (years) | 0.014 | −0.019~0.046 | 0.398 | - | - | - |
Current CD4+T-cell count (cells/mm3) | 0.001 | −0.001~0.001 | 0.364 | - | - | - |
Nadir CD4+T-cell count (cells/mm3) | −0.001 | −0.002~0.001 | 0.183 | - | - | - |
Nadir CD4+T-cell <200 cells/mm3 (%) | 0.412 | 0.008~0.817 | 0.046 | 0.344 | 0.001~0.691 | 0.049 |
D:A:D 5-year score | 0.033 | −0.039~0.106 | 0.359 | - | - | - |
Current NNRTI-based ART | −0.184 | −0.615~0.247 | 0.391 | - | - | - |
Current PI-based ART | 0.253 | −0.162~0.669 | 0.223 | - | - | - |
Current INSTI-based ART | 0.280 | −0.133~0.694 | 0.177 | - | - | - |
Current TDF-based ART | −0.519 | −0.936~−0.102 | 0.016 | −0.315 | −0.701~0.072 | 0.107 |
Characteristics | Bivariable | Multivariable | ||||
---|---|---|---|---|---|---|
β | 95%CI | p-Value | β | 95%CI | p-Value | |
Sociodemographic and Clinical Parameters | ||||||
Age (years) | 0.037 | 0.004~0.070 | 0.029 | 0.032 | 0.004~0.060 | 0.027 |
BMI (kg/m2) | 0.020 | −0.067~0.107 | 0.644 | - | - | - |
Lipid-lowering agents, n (%) | −0.016 | −0.441~0.430 | 0.979 | - | - | - |
Smoking, n (%) | −0.056 | −0.539~0.427 | 0.815 | - | - | - |
Pack years, (n) | −0.104 | −0.520~0.313 | 0.616 | - | - | - |
FRS, (n) | −0.001 | −0.008~0.005 | 0.662 | - | - | - |
HellenicSCORE2, (n) | 0.075 | −0.028~0.178 | 0.148 | - | - | - |
Laboratory Parameters | ||||||
Fasting glucose (mg/dl) | 0.009 | −0.006~0.024 | 0.237 | - | - | - |
Total cholesterol (mg/dl) | 0.001 | −0.006~0.006 | 0.945 | - | - | - |
LDL cholesterol (mg/dl) | 0.001 | −0.007~0.006 | 0.883 | - | - | - |
eGFR (mL/min/1.73 m2) | −0.014 | −0.023~−0.004 | 0.007 | −0.012 | −0.020~−0.004 | 0.004 |
Hemodynamic Parameters | ||||||
bSBP (mmHg) | 0.019 | 0.005~0.034 | 0.009 | 0.012 | −0.001~0.024 | 0.066 |
bDBP (mmHg) | 0.027 | 0.001~0.052 | 0.042 | - | - | - |
bPP (mmHg) | 0.028 | 0.007~0.050 | 0.012 | - | - | - |
MBP (mmHg) | 0.020 | −0.001~0.041 | 0.060 | - | - | - |
aSBP (mmHg) | 0.020 | 0.006~0.035 | 0.006 | - | - | - |
aDBP (mmHg) | 0.027 | 0.001~0.052 | 0.040 | - | - | - |
aPP (mmHg) | 0.026 | 0.003~0.048 | 0.025 | - | - | - |
AIx@75 (%) | 0.010 | −0.015~0.035 | 0.417 | - | - | - |
cfPWV (m/s) | 0.060 | −0.071~0.191 | 0.361 | - | - | - |
HIV-Related Parameters | ||||||
Duration of HIV infection (years) | −0.005 | −0.034~0.023 | 0.696 | - | - | - |
Duration of ART (years) | −0.001 | −0.029~0.028 | 0.955 | - | - | - |
Current CD4+T-cell count (cells/mm3) | 0.001 | −0.001~0.001 | 0.420 | - | - | - |
Nadir CD4+T-cell count (cells/mm3) | 0.001 | −0.001~0.002 | 0.158 | - | - | - |
Nadir CD4+T-cell <200 cells/mm3 (%) | −0.209 | −0.573~0.155 | 0.251 | - | - | - |
D:A:D 5-year score | 0.052 | −0.009~0.112 | 0.093 | - | - | - |
Current NNRTI-based ART | 0.402 | 0.052~0.752 | 0.025 | 0.389 | 0.100~0.678 | 0.010 |
Current PI-based ART | −0.104 | −0.470~0.261 | 0.565 | - | - | - |
Current INSTI-based ART | −0.184 | −0.545~0.178 | 0.308 | - | - | - |
Current TDF-based ART | −0.037 | −0.430~0.356 | 0.849 | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nanoudis, S.; Yavropoulou, M.P.; Tsachouridou, O.; Pikilidou, M.; Pilalas, D.; Kotsa, K.; Skoura, L.; Zebekakis, P.; Metallidis, S. Circulating MicroRNAs Related to Arterial Stiffness in Adults with HIV Infection. Viruses 2024, 16, 1945. https://doi.org/10.3390/v16121945
Nanoudis S, Yavropoulou MP, Tsachouridou O, Pikilidou M, Pilalas D, Kotsa K, Skoura L, Zebekakis P, Metallidis S. Circulating MicroRNAs Related to Arterial Stiffness in Adults with HIV Infection. Viruses. 2024; 16(12):1945. https://doi.org/10.3390/v16121945
Chicago/Turabian StyleNanoudis, Sideris, Maria P. Yavropoulou, Olga Tsachouridou, Maria Pikilidou, Dimitrios Pilalas, Kalliopi Kotsa, Lemonia Skoura, Pantelis Zebekakis, and Symeon Metallidis. 2024. "Circulating MicroRNAs Related to Arterial Stiffness in Adults with HIV Infection" Viruses 16, no. 12: 1945. https://doi.org/10.3390/v16121945
APA StyleNanoudis, S., Yavropoulou, M. P., Tsachouridou, O., Pikilidou, M., Pilalas, D., Kotsa, K., Skoura, L., Zebekakis, P., & Metallidis, S. (2024). Circulating MicroRNAs Related to Arterial Stiffness in Adults with HIV Infection. Viruses, 16(12), 1945. https://doi.org/10.3390/v16121945