DHX15 and Rig-I Coordinate Apoptosis and Innate Immune Signaling by Antiviral RNase L
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals, Reagents, and Antibodies
2.2. Cell Culture and Transfections
2.3. 2-5A, RNase L-Cleaved Small RNAs and Control Small RNAs
2.4. Generation of Gene Knockout Cell Lines Using CRISPR/Cas9 System
2.5. Plasmid Constructs and Site-Directed Mutagenesis
2.6. Lentivirus Transduction and siRNA Gene Silencing
2.7. Coxsackievirus B3 (CVB3) Growth and Titration
2.8. Cell Death Assays
2.9. Real-Time Monitoring of Cell Death Using Dual Dyes
2.10. Caspase-3/7 Assay
2.11. RNA Isolation and Quantitative Real-Time PCR
2.12. RNA Binding Assays
2.13. Western Blot Analysis
2.14. Immunofluorescence Analysis
2.15. Coimmunoprecipitation
2.16. Luciferase Reporter Assay
2.17. Statistical Analysis
3. Results
3.1. DHX15 and Rig-I Are Required for Cell Death Induced by RNase L Activation
3.2. DHX15 and Rig-I Mediate Apoptotic Cell Death by RNase L Cleavage Products
3.3. RNase L Signals via DHX15 and Rig-I to Promote MAVS-Dependent Apoptosis
3.4. MAPK Signaling Induced by RNase L-Cleaved RNAs Is Required for DHX15-Rig-I-MAVS-Mediated Apoptosis
3.5. Apoptosis Induced by RNase L-Cleaved RNAs Is Independent of IRF-3 and NF-κB Signaling
3.6. Induction of IFN and Proinflammatory Cytokines by RNase L-Cleaved RNAs Is Dependent on DHX15 and Rig-I
3.7. RNA Binding by DHX15 and Rig-I Triggers RNase L-Mediated Apoptosis
3.8. Apoptosis Induced by RNase L Impacts CVB3 Pathogenesis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Takeuchi, O.; Akira, S. Innate immunity to virus infection. Immunol. Rev. 2009, 227, 75–86. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Recognition of viruses by innate immunity. Immunol. Rev. 2007, 220, 214–224. [Google Scholar] [CrossRef]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed]
- Takeda, K.; Akira, S. Toll-like receptors in innate immunity. Int. Immunol. 2005, 17, 1–14. [Google Scholar] [CrossRef]
- Medzhitov, R. Recognition of microorganisms and activation of the immune response. Nature 2007, 449, 819–826. [Google Scholar] [CrossRef]
- Loo, Y.M.; Gale, M., Jr. Viral regulation and evasion of the host response. Curr. Top. Microbiol. Immunol. 2007, 316, 295–313. [Google Scholar] [PubMed]
- Loo, Y.M.; Gale, M., Jr. Immune signaling by RIG-I-like receptors. Immunity 2011, 34, 680–692. [Google Scholar] [CrossRef] [PubMed]
- Loo, Y.M.; Fornek, J.; Crochet, N.; Bajwa, G.; Perwitasari, O.; Martinez-Sobrido, L.; Akira, S.; Gill, M.A.; Garcia-Sastre, A.; Katze, M.G.; et al. Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. J. Virol. 2008, 82, 335–345. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Gale, M., Jr. Principles of intracellular viral recognition. Curr. Opin. Immunol. 2007, 19, 17–23. [Google Scholar] [CrossRef]
- Kato, H.; Takeuchi, O.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Matsui, K.; Uematsu, S.; Jung, A.; Kawai, T.; Ishii, K.J.; et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006, 441, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, M.; Fujita, T. RNA recognition and signal transduction by RIG-I-like receptors. Immunol. Rev. 2009, 227, 54–65. [Google Scholar] [CrossRef]
- Gitlin, L.; Benoit, L.; Song, C.; Cella, M.; Gilfillan, S.; Holtzman, M.J.; Colonna, M. Melanoma differentiation-associated gene 5 (MDA5) is involved in the innate immune response to Paramyxoviridae infection in vivo. PLoS Pathog. 2010, 6, e1000734. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Kumar, H.; Kato, H.; Ishii, K.J.; Takeuchi, O.; Akira, S. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef] [PubMed]
- Seth, R.B.; Sun, L.; Ea, C.K.; Chen, Z.J. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 2005, 122, 669–682. [Google Scholar] [CrossRef]
- Xu, L.G.; Wang, Y.Y.; Han, K.J.; Li, L.Y.; Zhai, Z.; Shu, H.B. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 2005, 19, 727–740. [Google Scholar] [CrossRef]
- Meylan, E.; Curran, J.; Hofmann, K.; Moradpour, D.; Binder, M.; Bartenschlager, R.; Tschopp, J. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 2005, 437, 1167–1172. [Google Scholar] [CrossRef] [PubMed]
- Fitzgerald, K.A.; McWhirter, S.M.; Faia, K.L.; Rowe, D.C.; Latz, E.; Golenbock, D.T.; Coyle, A.J.; Liao, S.M.; Maniatis, T. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 2003, 4, 491–496. [Google Scholar] [CrossRef]
- McWhirter, S.M.; Fitzgerald, K.A.; Rosains, J.; Rowe, D.C.; Golenbock, D.T.; Maniatis, T. IFN-regulatory factor 3-dependent gene expression is defective in Tbk1-deficient mouse embryonic fibroblasts. Proc. Natl. Acad. Sci. USA 2004, 101, 233–238. [Google Scholar] [CrossRef]
- Borden, E.C.; Sen, G.C.; Uze, G.; Silverman, R.H.; Ransohoff, R.M.; Foster, G.R.; Stark, G.R. Interferons at age 50: Past, current and future impact on biomedicine. Nat. Rev. Drug Discov. 2007, 6, 975–990. [Google Scholar] [CrossRef] [PubMed]
- Hur, S. Double-Stranded RNA Sensors and Modulators in Innate Immunity. Annu. Rev. Immunol. 2019, 37, 349–375. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, M.; Kikuchi, M.; Natsukawa, T.; Shinobu, N.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Akira, S.; Fujita, T. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 2004, 5, 730–737. [Google Scholar] [CrossRef]
- Poeck, H.; Besch, R.; Maihoefer, C.; Renn, M.; Tormo, D.; Morskaya, S.S.; Kirschnek, S.; Gaffal, E.; Landsberg, J.; Hellmuth, J.; et al. 5′-Triphosphate-siRNA: Turning gene silencing and Rig-I activation against melanoma. Nat. Med. 2008, 14, 1256–1263. [Google Scholar] [CrossRef]
- Besch, R.; Poeck, H.; Hohenauer, T.; Senft, D.; Hacker, G.; Berking, C.; Hornung, V.; Endres, S.; Ruzicka, T.; Rothenfusser, S.; et al. Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon-independent apoptosis in human melanoma cells. J. Clin. Investig. 2009, 119, 2399–2411. [Google Scholar] [CrossRef] [PubMed]
- Boehmer, D.F.R.; Formisano, S.; de Oliveira Mann, C.C.; Mueller, S.A.; Kluge, M.; Metzger, P.; Rohlfs, M.; Horth, C.; Kocheise, L.; Lichtenthaler, S.F.; et al. OAS1/RNase L executes RIG-I ligand-dependent tumor cell apoptosis. Sci. Immunol. 2021, 6, eabe2550. [Google Scholar] [CrossRef] [PubMed]
- Matsushima-Miyagi, T.; Hatano, K.; Nomura, M.; Li-Wen, L.; Nishikawa, T.; Saga, K.; Shimbo, T.; Kaneda, Y. TRAIL and Noxa are selectively upregulated in prostate cancer cells downstream of the RIG-I/MAVS signaling pathway by nonreplicating Sendai virus particles. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2012, 18, 6271–6283. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Ingle, H.; Mishra, S.; Mahla, R.S.; Kumar, A.; Kawai, T.; Akira, S.; Takaoka, A.; Raut, A.A.; Kumar, H. IPS-1 differentially induces TRAIL, BCL2, BIRC3 and PRKCE in type I interferons-dependent and -independent anticancer activity. Cell Death Dis. 2015, 6, e1758. [Google Scholar] [CrossRef]
- El Maadidi, S.; Faletti, L.; Berg, B.; Wenzl, C.; Wieland, K.; Chen, Z.J.; Maurer, U.; Borner, C. A novel mitochondrial MAVS/Caspase-8 platform links RNA virus-induced innate antiviral signaling to Bax/Bak-independent apoptosis. J. Immunol. 2014, 192, 1171–1183. [Google Scholar] [CrossRef]
- Chattopadhyay, S.; Marques, J.T.; Yamashita, M.; Peters, K.L.; Smith, K.; Desai, A.; Williams, B.R.; Sen, G.C. Viral apoptosis is induced by IRF-3-mediated activation of Bax. EMBO J. 2010, 29, 1762–1773. [Google Scholar] [CrossRef]
- Samir, P.; Kesavardhana, S.; Patmore, D.M.; Gingras, S.; Malireddi, R.K.S.; Karki, R.; Guy, C.S.; Briard, B.; Place, D.E.; Bhattacharya, A.; et al. DDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasome. Nature 2019, 573, 590–594. [Google Scholar] [CrossRef]
- Shih, J.W.; Wang, W.T.; Tsai, T.Y.; Kuo, C.Y.; Li, H.K.; Wu Lee, Y.H. Critical roles of RNA helicase DDX3 and its interactions with eIF4E/PABP1 in stress granule assembly and stress response. Biochem. J. 2012, 441, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Soulat, D.; Burckstummer, T.; Westermayer, S.; Goncalves, A.; Bauch, A.; Stefanovic, A.; Hantschel, O.; Bennett, K.L.; Decker, T.; Superti-Furga, G. The DEAD-box helicase DDX3X is a critical component of the TANK-binding kinase 1-dependent innate immune response. EMBO J. 2008, 27, 2135–2146. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Kim, T.; Bao, M.; Facchinetti, V.; Jung, S.Y.; Ghaffari, A.A.; Qin, J.; Cheng, G.; Liu, Y.J. DDX1, DDX21, and DHX36 helicases form a complex with the adaptor molecule TRIF to sense dsRNA in dendritic cells. Immunity 2011, 34, 866–878. [Google Scholar] [CrossRef] [PubMed]
- Mitoma, H.; Hanabuchi, S.; Kim, T.; Bao, M.; Zhang, Z.; Sugimoto, N.; Liu, Y.J. The DHX33 RNA helicase senses cytosolic RNA and activates the NLRP3 inflammasome. Immunity 2013, 39, 123–135. [Google Scholar] [CrossRef]
- Chakrabarti, A.; Banerjee, S.; Franchi, L.; Loo, Y.M.; Gale, M., Jr.; Nunez, G.; Silverman, R.H. RNase L activates the NLRP3 inflammasome during viral infections. Cell Host Microbe 2015, 17, 466–477. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.; Pazhoor, S.; Bao, M.; Zhang, Z.; Hanabuchi, S.; Facchinetti, V.; Bover, L.; Plumas, J.; Chaperot, L.; Qin, J.; et al. Aspartate-glutamate-alanine-histidine box motif (DEAH)/RNA helicase A helicases sense microbial DNA in human plasmacytoid dendritic cells. Proc. Natl. Acad. Sci. USA 2010, 107, 15181–15186. [Google Scholar] [CrossRef]
- Zhang, Z.; Yuan, B.; Lu, N.; Facchinetti, V.; Liu, Y.J. DHX9 pairs with IPS-1 to sense double-stranded RNA in myeloid dendritic cells. J. Immunol. 2011, 187, 4501–4508. [Google Scholar] [CrossRef] [PubMed]
- Miyashita, M.; Oshiumi, H.; Matsumoto, M.; Seya, T. DDX60, a DEXD/H box helicase, is a novel antiviral factor promoting RIG-I-like receptor-mediated signaling. Mol. Cell. Biol. 2011, 31, 3802–3819. [Google Scholar] [CrossRef]
- Mosallanejad, K.; Sekine, Y.; Ishikura-Kinoshita, S.; Kumagai, K.; Nagano, T.; Matsuzawa, A.; Takeda, K.; Naguro, I.; Ichijo, H. The DEAH-box RNA helicase DHX15 activates NF-kappaB and MAPK signaling downstream of MAVS during antiviral responses. Sci. Signal. 2014, 7, ra40. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Lu, N.; Weng, L.; Yuan, B.; Liu, Y.J.; Zhang, Z. DHX15 senses double-stranded RNA in myeloid dendritic cells. J. Immunol. 2014, 193, 1364–1372. [Google Scholar] [CrossRef] [PubMed]
- Xing, J.; Zhou, X.; Fang, M.; Zhang, E.; Minze, L.J.; Zhang, Z. DHX15 is required to control RNA virus-induced intestinal inflammation. Cell Rep. 2021, 35, 109205. [Google Scholar] [CrossRef]
- Pattabhi, S.; Knoll, M.L.; Gale, M., Jr.; Loo, Y.M. DHX15 Is a Coreceptor for RLR Signaling That Promotes Antiviral Defense Against RNA Virus Infection. J. Interferon Cytokine Res. 2019, 39, 331–346. [Google Scholar] [CrossRef]
- Shen, C.; Li, R.; Negro, R.; Cheng, J.; Vora, S.M.; Fu, T.M.; Wang, A.; He, K.; Andreeva, L.; Gao, P.; et al. Phase separation drives RNA virus-induced activation of the NLRP6 inflammasome. Cell 2021, 184, 5759–5774.e20. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.L.; Fukukawa, C.; Park, J.H.; Naito, K.; Kijima, K.; Shimo, A.; Ajiro, M.; Nishidate, T.; Nakamura, Y.; Katagiri, T. Involvement of G-patch domain containing 2 overexpression in breast carcinogenesis. Cancer Sci. 2009, 100, 1443–1450. [Google Scholar] [CrossRef] [PubMed]
- Jing, Y.; Nguyen, M.M.; Wang, D.; Pascal, L.E.; Guo, W.; Xu, Y.; Ai, J.; Deng, F.M.; Masoodi, K.Z.; Yu, X.; et al. DHX15 promotes prostate cancer progression by stimulating Siah2-mediated ubiquitination of androgen receptor. Oncogene 2018, 37, 638–650. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.L.; Cai, Y.H.; Liu, Q.; Pan, L.L.; Shi, S.L.; Liu, X.L.; Chen, Y.; Li, J.G.; Wang, J.; Li, Y.; et al. ETS1 and SP1 drive DHX15 expression in acute lymphoblastic leukaemia. J. Cell. Mol. Med. 2018, 22, 2612–2621. [Google Scholar] [CrossRef]
- Ito, S.; Koso, H.; Sakamoto, K.; Watanabe, S. RNA helicase DHX15 acts as a tumour suppressor in glioma. Br. J. Cancer 2017, 117, 1349–1359. [Google Scholar] [CrossRef]
- Xiao, Y.F.; Li, J.M.; Wang, S.M.; Yong, X.; Tang, B.; Jie, M.M.; Dong, H.; Yang, X.C.; Yang, S.M. Cerium oxide nanoparticles inhibit the migration and proliferation of gastric cancer by increasing DHX15 expression. Int. J. Nanomed. 2016, 11, 3023–3034. [Google Scholar] [CrossRef]
- Silverman, R.H. A scientific journey through the 2-5A/RNase L system. Cytokine Growth Factor Rev. 2007, 18, 381–388. [Google Scholar] [CrossRef]
- Silverman, R.H. Viral encounters with 2′,5′-oligoadenylate synthetase and RNase L during the interferon antiviral response. J. Virol. 2007, 81, 12720–12729. [Google Scholar] [CrossRef] [PubMed]
- Hovanessian, A.G.; Brown, R.E.; Kerr, I.M. Synthesis of low molecular weight inhibitor of protein synthesis with enzyme from interferon-treated cells. Nature 1977, 268, 537–540. [Google Scholar] [CrossRef]
- Huang, H.; Zeqiraj, E.; Dong, B.; Jha, B.K.; Duffy, N.M.; Orlicky, S.; Thevakumaran, N.; Talukdar, M.; Pillon, M.C.; Ceccarelli, D.F.; et al. Dimeric structure of pseudokinase RNase L bound to 2-5A reveals a basis for interferon-induced antiviral activity. Mol. Cell 2014, 53, 221–234. [Google Scholar] [CrossRef]
- Dong, B.; Silverman, R.H. 2-5A-dependent RNase molecules dimerize during activation by 2-5A. J. Biol. Chem. 1995, 270, 4133–4137. [Google Scholar] [CrossRef]
- Han, Y.; Donovan, J.; Rath, S.; Whitney, G.; Chitrakar, A.; Korennykh, A. Structure of human RNase L reveals the basis for regulated RNA decay in the IFN response. Science 2014, 343, 1244–1248. [Google Scholar] [CrossRef] [PubMed]
- Wreschner, D.H.; McCauley, J.W.; Skehel, J.J.; Kerr, I.M. Interferon action--sequence specificity of the ppp(A2′p)nA-dependent ribonuclease. Nature 1981, 289, 414–417. [Google Scholar] [CrossRef] [PubMed]
- Xi, J.; Snieckute, G.; Martinez, J.F.; Arendrup, F.S.W.; Asthana, A.; Gaughan, C.; Lund, A.H.; Bekker-Jensen, S.; Silverman, R.H. Initiation of a ZAKalpha-dependent ribotoxic stress response by the innate immunity endoribonuclease RNase L. Cell Rep. 2024, 43, 113998. [Google Scholar] [CrossRef] [PubMed]
- Karasik, A.; Lorenzi, H.A.; DePass, A.V.; Guydosh, N.R. Endonucleolytic RNA cleavage drives changes in gene expression during the innate immune response. Cell Rep. 2024, 43, 114287. [Google Scholar] [CrossRef]
- Malathi, K.; Paranjape, J.M.; Bulanova, E.; Shim, M.; Guenther-Johnson, J.M.; Faber, P.W.; Eling, T.E.; Williams, B.R.; Silverman, R.H. A transcriptional signaling pathway in the IFN system mediated by 2′-5′-oligoadenylate activation of RNase L. Proc. Natl. Acad. Sci. USA 2005, 102, 14533–14538. [Google Scholar] [CrossRef] [PubMed]
- Siddiqui, M.A.; Mukherjee, S.; Manivannan, P.; Malathi, K. RNase L Cleavage Products Promote Switch from Autophagy to Apoptosis by Caspase-Mediated Cleavage of Beclin-1. Int. J. Mol. Sci. 2015, 16, 17611–17636. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Xiang, Y.; Sabapathy, K.; Silverman, R.H. An apoptotic signaling pathway in the interferon antiviral response mediated by RNase L and c-Jun NH2-terminal kinase. J. Biol. Chem. 2004, 279, 1123–1131. [Google Scholar] [CrossRef] [PubMed]
- Malathi, K.; Dong, B.; Gale, M., Jr.; Silverman, R.H. Small self-RNA generated by RNase L amplifies antiviral innate immunity. Nature 2007, 448, 816–819. [Google Scholar] [CrossRef]
- Manivannan, P.; Siddiqui, M.A.; Malathi, K. RNase L Amplifies Interferon Signaling by Inducing Protein Kinase R-Mediated Antiviral Stress Granules. J. Virol. 2020, 94, 10–1128. [Google Scholar] [CrossRef]
- Siddiqui, M.A.; Malathi, K. RNase L induces autophagy via c-Jun N-terminal kinase and double-stranded RNA-dependent protein kinase signaling pathways. J. Biol. Chem. 2012, 287, 43651–43664. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, R.; Justesen, J.; Sarkar, S.N.; Sen, G.C.; Yee, V.C. Crystal structure of the 2′-specific and double-stranded RNA-activated interferon-induced antiviral protein 2′-5′-oligoadenylate synthetase. Mol. Cell 2003, 12, 1173–1185. [Google Scholar] [CrossRef] [PubMed]
- Qi, L.S.; Larson, M.H.; Gilbert, L.A.; Doudna, J.A.; Weissman, J.S.; Arkin, A.P.; Lim, W.A. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 2013, 152, 1173–1183. [Google Scholar] [CrossRef] [PubMed]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. RNA-guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [PubMed]
- Feuer, R.; Mena, I.; Pagarigan, R.; Slifka, M.K.; Whitton, J.L. Cell cycle status affects coxsackievirus replication, persistence, and reactivation in vitro. J. Virol. 2002, 76, 4430–4440. [Google Scholar] [CrossRef]
- Kato, H.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Uematsu, S.; Matsui, K.; Tsujimura, T.; Takeda, K.; Fujita, T.; Takeuchi, O.; et al. Cell type-specific involvement of RIG-I in antiviral response. Immunity 2005, 23, 19–28. [Google Scholar] [CrossRef]
- Malathi, K.; Paranjape, J.M.; Ganapathi, R.; Silverman, R.H. HPC1/RNASEL mediates apoptosis of prostate cancer cells treated with 2′,5′-oligoadenylates, topoisomerase I inhibitors, and tumor necrosis factor-related apoptosis-inducing ligand. Cancer Res. 2004, 64, 9144–9151. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.L.; Kamata, H.; Karin, M. IKK/NF-kappaB signaling: Balancing life and death--a new approach to cancer therapy. J. Clin. Investig. 2005, 115, 2625–2632. [Google Scholar] [CrossRef] [PubMed]
- Karin, M. How NF-kappaB is activated: The role of the IkappaB kinase (IKK) complex. Oncogene 1999, 18, 6867–6874. [Google Scholar] [CrossRef]
- Yoneyama, M.; Fujita, T. Recognition of viral nucleic acids in innate immunity. Rev. Med. Virol. 2010, 20, 4–22. [Google Scholar] [CrossRef] [PubMed]
- Takahasi, K.; Yoneyama, M.; Nishihori, T.; Hirai, R.; Kumeta, H.; Narita, R.; Gale, M., Jr.; Inagaki, F.; Fujita, T. Nonself RNA-sensing mechanism of RIG-I helicase and activation of antiviral immune responses. Mol. Cell 2008, 29, 428–440. [Google Scholar] [CrossRef] [PubMed]
- Murakami, K.; Nakano, K.; Shimizu, T.; Ohto, U. The crystal structure of human DEAH-box RNA helicase 15 reveals a domain organization of the mammalian DEAH/RHA family. Acta Crystallogr. F Struct. Biol. Commun. 2017, 73, 347–355. [Google Scholar] [CrossRef]
- Zhang, J.; Huang, J.; Xu, K.; Xing, P.; Huang, Y.; Liu, Z.; Tong, L.; Manley, J.L. DHX15 is involved in SUGP1-mediated RNA missplicing by mutant SF3B1 in cancer. Proc. Natl. Acad. Sci. USA 2022, 119, e2216712119. [Google Scholar] [CrossRef] [PubMed]
- Chakrabarti, A.; Ghosh, P.K.; Banerjee, S.; Gaughan, C.; Silverman, R.H. RNase L triggers autophagy in response to viral infections. J. Virol. 2012, 86, 11311–11321. [Google Scholar] [CrossRef]
- Der, S.D.; Yang, Y.L.; Weissmann, C.; Williams, B.R. A double-stranded RNA-activated protein kinase-dependent pathway mediating stress-induced apoptosis. Proc. Natl. Acad. Sci. USA 1997, 94, 3279–3283. [Google Scholar] [CrossRef]
- Lee, S.B.; Esteban, M. The interferon-induced double-stranded RNA-activated protein kinase induces apoptosis. Virology 1994, 199, 491–496. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence |
---|---|
sgOAS1-F | 5′ CACCGCAGGATCAGTTAAATCGCCG 3′ |
sgOAS1-R | 5′ AAACCGGCGATTTAACTGATCCTGC 3′ |
sgOAS2-F | 5′ CACCGGAAGCTGGGTTGGTTTATCC 3′ |
sgOAS2-R | 5′ AAACGGGATAAACCAACCCAGCTTCC 3′ |
sgOAS3-F | 5′ CACCGGCGATGCCCGCATCTCACTG 3′ |
sgOAS3-R | 5′ AAACCAGTGAGATGCGGGCATCGCC 3′ |
Mutation | Orientation | Primer Sequence |
---|---|---|
R22A | Sense | 5′-cactactgcagtcttcaaatgcaatggagtaaccaacttcct-3′ |
Antisense | 5′-aggaagttggttactccattgcatttgaagactgcagtagtg-3′ | |
R243A | Sense | 5′-gggatcattcatagcttcagcaagtaacatcccatcagtcatat-3′ |
Antisense | 5′-atatgactgatgggatgttacttgctgaagctatgaatgatccc-3′ | |
T237A | Sense | 5′-ttcacgaagtaacatcccatcagccatatacttaagaatggtttttg-3′ |
Antisense | 5′-caaaaaccattcttaagtatatggctgatgggatgttacttcgtgaa-3′ | |
RR194/195AA | Sense | 5′-acactcattgcagccactgccgcgggttgggtacaggcaac-3′ |
Antisense | 5′-gttgcctgtacccaacccgcggcagtggctgcaatgagtgt-3′ | |
T421/N422AA | Sense | 5′-gtcaaagacgtctctgctatggcagctgacacaactacctttcttcc-3′ |
Antisense | 5′-ggaagaaaggtagttgtgtcagctgccatagcagagacgtctttgac-3′ |
Primer | Sequence (5′-3′) |
---|---|
IFN-β F | GGAGGACGCCGCATTGAC |
IFN-β R | TGATAGACATTAGCCAGGAGGTTC |
CCL5 F | CCAGCAGTCGTCTTTGTCAC |
CCL5 R | CTCTGGGTTGGCACACACTT |
IL-8 F | AAGAGAGCTCTGTCTGGACC |
IL-8 R | GATATTCTCTTGGCCCTTGG |
IP-10 F | TTCCTGCAAGCCAATTTTGTC |
IP-10 R | TCTTCTCACCCTTCTTTTTCATTGT |
GAPDH F | GCAAATTCCATGGCACCGT |
GAPDH R | TCGCCCCACTTGATTTTGG |
CVB3 F | CACACTCCGATCAACAGTCA |
CVB3 R | GAACGCTTTCTCCTTCAACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ramnani, B.; Devale, T.; Manivannan, P.; Haridas, A.; Malathi, K. DHX15 and Rig-I Coordinate Apoptosis and Innate Immune Signaling by Antiviral RNase L. Viruses 2024, 16, 1913. https://doi.org/10.3390/v16121913
Ramnani B, Devale T, Manivannan P, Haridas A, Malathi K. DHX15 and Rig-I Coordinate Apoptosis and Innate Immune Signaling by Antiviral RNase L. Viruses. 2024; 16(12):1913. https://doi.org/10.3390/v16121913
Chicago/Turabian StyleRamnani, Barkha, Trupti Devale, Praveen Manivannan, Aiswarya Haridas, and Krishnamurthy Malathi. 2024. "DHX15 and Rig-I Coordinate Apoptosis and Innate Immune Signaling by Antiviral RNase L" Viruses 16, no. 12: 1913. https://doi.org/10.3390/v16121913
APA StyleRamnani, B., Devale, T., Manivannan, P., Haridas, A., & Malathi, K. (2024). DHX15 and Rig-I Coordinate Apoptosis and Innate Immune Signaling by Antiviral RNase L. Viruses, 16(12), 1913. https://doi.org/10.3390/v16121913