Establishment of a New Real-Time Molecular Assay for the Detection of Babanki Virus in Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Sample Collection
2.3. Virus Stock Preparation
2.4. Indirect Immunofluorescence (IFI)
2.5. Plaque Assay
2.6. Primers Design
2.7. RNA Extraction
2.8. Real-Time qRT-PCR Conditions
2.9. Specificity Testing
2.10. Sensitivity Testing
2.10.1. Analytical Sensitivity
2.10.2. Diagnostic Sensitivity
2.10.3. Sensitivity in Human Serum and Leibovitz 15 (L-15) Medium
2.10.4. Repeatability and Reproducibility
2.10.5. Experimental Validation Using Vector Competency
2.11. Statistical and Data Analysis
3. Results
3.1. Specificity
3.2. Data from the Analytical Sensitivity Testing
3.3. Data from the Diagnostic Sensitivity Testing
3.4. Data from the Sensitivity Testing in Human Serum and Leibovitz 15 (L-15) Medium
3.5. Vector Competency of Mosquitoes for BBKV
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mossel, E.C.; Crabtree, M.B.; Mutebi, J.P.; Lutwama, J.J.; Borland, E.M.; Powers, A.M.; Miller, B.A. Arboviruses Isolated from Mosquitoes Collected in Uganda, 2008–2012. J. Med. Entomol. 2017, 54, 1403–1409. [Google Scholar] [CrossRef] [PubMed]
- Liljeström, P. Alphavirus expression systems. Curr. Opin. Biotechnol. 1994, 5, 495–500. [Google Scholar] [CrossRef] [PubMed]
- Weaver, S.C.; Kang, W.; Shirako, Y.; Rumenapf, T.; Strauss, E.G.; Strauss, J.H. Recombinational history and molecular evolution of western equine encephalomyelitis complex alphaviruses. J. Virol. 1997, 71, 613–623. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, N.; Goedhals, D.; Vawda, S.; Bester, P.A.; Burt, F. Sindbis Virus Antibody Seroprevalence in Central Plateau Populations, South Africa. Emerg. Infect. Dis. 2022, 28, 2137–2139. [Google Scholar] [CrossRef]
- Sem Ouilibona, R.C.; Tchetgna Simo, H.D.; Vickos, U.; Berthet, N.; Nakouné, E. Full-Length Genome Sequence of a Sindbis Virus Strain Isolated from Culex cinereus in 1977 in Bozo, Central African Republic. Genome Announc. 2018, 6, e00455-18. [Google Scholar] [CrossRef]
- Bousses, P.; Dehecq, J.S.; Fontenille, D. Principaux Arbovirus A Risque de Sante Publique Pour la Reunion; IRD Éditions: Marseille, France, 2022; pp. 195–199. Available online: http://books.openedition.org/irdeditions/42649 (accessed on 2 May 2024).
- Tricou, V.; Selekon, B.; Faye, O.; Gessain, A.; Kazanji, M.; Nakouné, E.; Berthet, N. Complete Genome Sequences of Igbo-Ora and Babanki Alphavirus Strains Isolated in the Central African Republic in the 1960s and 1970s. Microbiol. Resour. Announc. 2019, 8, e00868-19. [Google Scholar] [CrossRef]
- Imbert-Laurenceau, E.; Crepinior, J.; Crance, J.M.; Jouan, A.; Migonney, V. Polystyrene derivatives substituted with arginine interact with Babanki (Togaviridae) and Kedougou (Flaviviridae) viruses. J. Med. Virol. 2003, 69, 503–509. [Google Scholar] [CrossRef]
- Ndiaye, E.H.; Diallo, D.; Fall, G.; Ba, Y.; Faye, O.; Dia, I.; Diallo, M. Arboviruses isolated from the Barkedji mosquito-based surveillance system, 2012–2013. BMC Infect. Dis. 2018, 18, 642. [Google Scholar] [CrossRef]
- Lvov, D.K.; Shchelkanov, M.Y.; Alkhovsky, S.V.; Deryabin, P.G. Chapter 8-Single-Stranded RNA Viruses: Zoonotic Viruses in Northern Eurasia; Academic Press: Boston, MA, USA, 2015; pp. 135–392. Available online: https://www.sciencedirect.com/science/article/pii/B9780128017425000088 (accessed on 2 May 2024).
- Suvanto, M.T.; Uusitalo, R.; Kampe, E.O.I.; Vuorinen, T.; Kurkela, S.; Vapalahti, O.; Dub, T.; Huhtamo, E.; Korhonen, E.M. Sindbis virus outbreak and evidence for geographical expansion in Finland, 2021. Eurosurveillance 2022, 27, 2200580. [Google Scholar] [CrossRef]
- Powers, A.M.; Roehrig, J.T. Alphaviruses. In Diagnostic Virology Protocols; Methods in Molecular Biology; Springer Nature: Clifton, NJ, USA, 2011; Volume 665, pp. 17–38. [Google Scholar] [CrossRef]
- Armstrong, P.; Borovsky, D.; Shope, R.E.; Morris, C.D.; Mitchell, C.J.; Karabatsos, N.; Komar, N.; Spielman, A. Sensitive and specific colorimetric dot assay to detect eastern equine encephalomyelitis viral RNA in mosquitoes (Diptera: Culicidae) after polymerase chain reaction amplification. J. Med. Entomol. 1995, 32, 42–52. [Google Scholar] [CrossRef]
- Vodkin, M.H.; Streit, T.; Mitchell, C.J.; McLaughlin, G.L.; Novak, R.J. PCR-based detection of arboviral RNA from mosquitoes homogenized in detergent. BioTechniques 1994, 17, 114–116. [Google Scholar] [PubMed]
- Brightwell, G.; Brown, J.M.; Coates, D.M. Genetic targets for the detection and identification of Venezuelan equine encephalitis viruses. Arch. Virol. 1998, 143, 731–742. [Google Scholar] [CrossRef] [PubMed]
- Linssen, B.; Kinney, R.M.; Aguilar, P.; Russell, K.L.; Watts, D.M.; Kaaden, O.R.; Pfeffer, M. Development of Reverse Transcription-PCR Assays Specific for Detection of Equine Encephalitis Viruses. J. Clin. Microbiol. 2000, 38, 1527–1535. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. Muscle: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Okonechnikov, K.; Golosova, O.; Fursov, M.; UGENE team. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef]
- Abdullah, N.; Ahemad, N.; Aliazis, K.; Khairat, J.E.; Lee, T.C.; Ahmad, A.S.A.; Adnan, N.A.A.; Macha, N.O.; Hassan, S.S. The Putative Roles and Functions of Indel, Repetition and Duplication Events in Alphavirus Non-Structural Protein 3 Hypervariable Domain (nsP3 HVD) in Evolution, Viability and Re-Emergence. Viruses 2021, 13, 1021. [Google Scholar] [CrossRef]
- Faye, M.; Faye, O.; Diagne, M.M.; Fall, G.; Weidmann, M.; Sembene, M.; Sall, A.A.; Faye, O. Full-Genome Characterization and Genetic Evolution of West African Isolates of Bagaza Virus. Viruses 2018, 10, 193. [Google Scholar] [CrossRef]
- Gaye, A.; Faye, O.; Diagne, C.T.; Faye, O.; Diallo, D.; Weaver, S.C.; Sall, A.A.; Diallo, M. Oral susceptibility of Aedes aegypti (Diptera: Culicidae) from Senegal for dengue serotypes 1 and 3 viruses. Trop. Med. Int. Health 2014, 19, 1355–1359. [Google Scholar] [CrossRef]
- Lwande, U.W.; Obanda, V.; Bucht, G.; Mosomtai, G.; Otieno, V.; Ahlm, C.; Evander, M. Global Emergence of Alphaviruses known to cause arthralgia in humans. ProQuest. 2015. Available online: https://www.proquest.com/openview/e7bc8d8e27bd278fca0da51c44870d4d/ (accessed on 2 May 2024).
- Dimaculangan, M. Development and Application of Molecular Assays for Mosquito-Borne Alphaviruses in South Africa. 2021. Available online: http://hdl.handle.net/11660/11674 (accessed on 2 May 2024).
- Forrester, N.L.; Palacios, G.; Tesh, R.B.; Savji, N.; Guzman, H.; Sherman, M.; Weaver, S.C.; Lipkin, W.I. Genome-Scale Phylogeny of the Alphavirus Genus Suggests a Marine Origin. J. Virol. 2012, 86, 2729–2738. [Google Scholar] [CrossRef]
- Romeiro, M.F.; de Souza, W.M.; Tolardo, A.L.; Vieira, L.C.; Henriques, D.A.; de Araujo, J.; Siqueira, C.E.H.; Colombo, T.E.; Aquino, V.H.; Fonseca, B.A.L.; et al. A real-time RT-PCR for rapid detection and quantification of mosquito-borne alphaviruses. Arch. Virol. 2016, 161, 3171–3177. [Google Scholar] [CrossRef]
- Sane, J.; Kurkela, S.; Levanov, L.; Nikkari, S.; Vaheri, A.; Vapalahti, O. Development and evaluation of a real-time RT-PCR assay for Sindbis virus detection. J. Virol. Methods. 2012, 179, 185–188. [Google Scholar] [CrossRef] [PubMed]
- Ummul Haninah, A.; Vasan, S.S.; Ravindran, T.; Chandru, A.; Lee, H.L.; Shamala Devi, S. Development and evaluation of a one-step SYBR-Green I-based real-time RT-PCR assay for the detection and quantification of Chikungunya virus in human, monkey and mosquito samples. Trop. Biomed. 2010, 27, 611–623. [Google Scholar] [PubMed]
- Lutomiah, J.; Mulwa, F.; Mutisya, J.; Koskei, E.; Langat, S.; Nyunja, A.; Koka, H.; Konongoi, S.; Chepkorir, E.; Ofula, V.; et al. Probable contribution of Culex quinquefasciatus mosquitoes to the circulation of chikungunya virus during an outbreak in Mombasa County, Kenya, 2017–2018. Parasit Vectors 2021, 14, 138. [Google Scholar] [CrossRef] [PubMed]
- Jansen, S.; Lühken, R.; Helms, M.; Pluskota, B.; Pfitzner, W.P.; Oerther, S.; Becker, N.; Schmidt-Chanasit, J.; Heitmann, A. Vector Competence of Mosquitoes from Germany for Sindbis Virus. Viruses 2022, 14, 2644. [Google Scholar] [CrossRef] [PubMed]
- Ochieng, C.; Lutomiah, J.; Makio, A.; Koka, H.; Chepkorir, E.; Yalwala, S.; Mutisya, J.; Musila, L.; Khamadi, S.; Richardson, J.; et al. Mosquito-borne arbovirus surveillance at selected sites in diverse ecological zones of Kenya; 2007–2012. Virol. J. 2013, 10, 140. [Google Scholar] [CrossRef]
- Sammels, L.M.; Lindsay, M.D.; Poidinger, M.; Coelen, R.J.; Mackenzie, J.S. Geographic distribution and evolution of Sindbis virus in Australia. J. Gen. Virol. 1999, 80, 739–748. [Google Scholar] [CrossRef]
- Calisher, C.H.; Karabatsos, N.; Lazuick, J.S.; Monath, T.P.; Wolff, K.L. Reevaluation of the western equine encephalitis antigenic complex of alphaviruses (family Togaviridae) as determined by neutralization tests. Am. J. Trop. Med. Hyg. 1988, 38, 447–452. [Google Scholar] [CrossRef]
- Kurkela, S.; Manni, T.; Vaheri, A.; Vapalahti, O. Causative agent of Pogosta disease isolated from blood and skin lesions. Emerg. Infect. Dis. 2004, 10, 889–894. [Google Scholar] [CrossRef]
- Shirako, Y.; Niklasson, B.; Dalrymple, J.M.; Strauss, E.G.; Strauss, J.H. Structure of the Ockelbo virus genome and its relationship to other Sindbis viruses. Virology 1991, 182, 753–764. [Google Scholar] [CrossRef]
Names | Primers and Probe | Protein | Nucleotide Position a | CG% | Product Size |
---|---|---|---|---|---|
FP1 | 5′-AAACGCAGGAAGAACCAACT-3′ | NsP3 | 5354–5373 | 45 | |
RP1 | 3′-ACCGTCGAAAAGTGATCCGA-5′ | 5460–5441 | 45 | 107 bp | |
P1 | 3′-6FAM—TCGTCCGCAGAGCTAGTGCTTG—BHQ1-5′ | 5381–5402 | 59.09 |
ID | Sample Types | Place of Isolation | Date of Collection | Specie | A.N. or Reference | Viruses Identified | BBKV qRT-PCR Assay (Ct) |
---|---|---|---|---|---|---|---|
286219 | PM | Barkedji | 2016 | C. neavei | CRORA | Barkedji | Negative |
286313 | PM | Barkedji | 2016 | C. poicilipes | CRORA | Barkedji | Negative |
286109 | PM | Barkedji | 2016 | C. perfuscus | CRORA | Barkedji | Negative |
286116 | PM | Barkedji | 2016 | C. neavei | CRORA | Barkedji | Negative |
286085 | PM | Barkedji | 2016 | C. perfuscus | CRORA | Barkedji | Negative |
286066 | PM | Barkedji | 2016 | C. neavei | CRORA | Barkedji | Negative |
286126 | PM | Barkedji | 2016 | C. neavei | CRORA | Barkedji | Negative |
286206 | PM | Barkedji | 2016 | C. neavei | CRORA | Barkedji | Negative |
288198 | PM | Barkedji | 2016 | C. poicilipes | CRORA | Barkedji | Negative |
286307 | PM | Barkedji | 2016 | C. neavei | CRORA | Usutu | Negative |
288129 | PM | Barkedji | 2016 | C. neavei | CRORA | Usutu | Negative |
286125 | PM | Barkedji | 2016 | C. neavei | CRORA | Usutu | Negative |
S27 AP | Serum | Uganda | 1953 | Human | AF369024.2 | Chikungynya | Negative |
ArAAMT/7 | Serum | Côte d’Ivoire | 1973 | A. africanus | CRORA | YF | Negative |
SH328056 | Serum | Senegal | 2020 | Human | MZ513007 | RVF | Negative |
MR766 | Serum | Uganda | 1947 | R. monkey | AY632535.2 | Zika | Negative |
Dengue 2 | Serum | New Guinea | 1974 | Human | AF038403.1 | Dengue 2 | Negative |
Dengue 1 | Serum | Cincinnati | 1944 | Human | CRORA | Dengue 1 | Negative |
ArD76986 | Serum | Senegal | 1990 | C. poicilipes | KJ131500 | West Nile 1 | Negative |
ARY168 | Serum | Senegal | NA | NA | CRORA | Babanki | 25.8 |
ARMG932 | Serum | Madagascar | 1984 | C. decens | CRORA | Babanki | 37.3 |
ID | Place of Isolation | Specie | Date of Collection | In Vitro Isolation+ IFA | Conventional Pan-Alphavirus RT-PCR | BBKV qRT-PCR (Ct) |
---|---|---|---|---|---|---|
PM 288115 | Barkedji | C. poicilipes | 2016 | SINV | Positive | 39.68 |
PM 288118 | Barkedji | C. neavei | 2016 | SINV | Positive | 35.9 |
PM 288121 | Barkedji | C. neavei | 2016 | SINV | Positive | 36.78 |
PM 286319 | Barkedji | C. neavei | 2016 | SINV | Positive | 37.65 |
PM 286273 | Barkedji | C. ethiopicus | 2016 | SINV | Positive | 37.35 |
PM 288064 | Barkedji | C. poicilipes | 2016 | Negative | Positive | 24.07 |
PM 286344 | Barkedji | C. poicilipes | 2016 | Negative | Positive | 39.29 |
PM 352693 | Kedougou | A. funestus | 2020 | Negative | Negative | 38.57 |
PM 352668 | Kedougou | A. argenteopunctatus | 2020 | Negative | Negative | 38.2 |
PM 352455 | Kedougou | A. aegypti | 2020 | Negative | Negative | 36.92 |
PM 352456 | Kedougou | A. aegypti | 2020 | Negative | Negative | 35.48 |
PM 322196 | Kedougou | A. cumminsii | 2020 | Negative | Negative | 36.9 |
PM 322195 | Kedougou | A. luteocephalus | 2020 | Negative | Negative | 36.6 |
PM 352598 | Kedougou | A. aegypti | 2020 | Negative | Negative | 37.34 |
PM 322194 | Kedougou | A. luteocephalus | 2020 | Negative | Negative | Negative |
PM 286270 | Barkedji | C. poicilipes | 2016 | Negative | Negative | Negative |
PM 286220 | Barkedji | C. neavei | 2016 | Negative | Negative | Negative |
PM 352681 | Kedougou | A. furcifer | 2020 | Negative | Negative | Negative |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Faye, M.; Ban, M.; Top, F.K.; Ndiaye, E.H.; Thiaw, F.D.; Fall, G.; Diagne, M.M.; Sall, A.A.; Diallo, M.; Choumet, V.; et al. Establishment of a New Real-Time Molecular Assay for the Detection of Babanki Virus in Africa. Viruses 2024, 16, 1841. https://doi.org/10.3390/v16121841
Faye M, Ban M, Top FK, Ndiaye EH, Thiaw FD, Fall G, Diagne MM, Sall AA, Diallo M, Choumet V, et al. Establishment of a New Real-Time Molecular Assay for the Detection of Babanki Virus in Africa. Viruses. 2024; 16(12):1841. https://doi.org/10.3390/v16121841
Chicago/Turabian StyleFaye, Martin, Mathilde Ban, Fatou Kiné Top, El Hadji Ndiaye, Fatou Diène Thiaw, Gamou Fall, Moussa Moise Diagne, Amadou Alpha Sall, Mawlouth Diallo, Valérie Choumet, and et al. 2024. "Establishment of a New Real-Time Molecular Assay for the Detection of Babanki Virus in Africa" Viruses 16, no. 12: 1841. https://doi.org/10.3390/v16121841
APA StyleFaye, M., Ban, M., Top, F. K., Ndiaye, E. H., Thiaw, F. D., Fall, G., Diagne, M. M., Sall, A. A., Diallo, M., Choumet, V., & Faye, O. (2024). Establishment of a New Real-Time Molecular Assay for the Detection of Babanki Virus in Africa. Viruses, 16(12), 1841. https://doi.org/10.3390/v16121841