Apoptotic Caspases Suppress Expression of Endogenous Retroviruses in HPV31+ Cells That Are Associated with Activation of an Innate Immune Response
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Reagents
2.2. Calcium-Induced Differentiation
2.3. Western Blotting
2.4. Real-Time PCR
- MLTA10: Forward TCTCACAATCCTGGAGGCTG;
- Reverse GACCAAGAAGCAAGCCCTCA
- MLT1B: Forward TGCCTGTCTCCAAACACAGT;
- Reverse TACGGGCTGAGCTTGAGTTG
- MER21C: Forward GGAGCTTCCTGATTGGCAGA;
- Reverse ATGTAGGGTGGCAAGCACTG
- MER4D: Forward CCCTAAAGAGGCAGGACACC;
- Reverse TCAAGCAATCGTCAACCAGA
- IFN-β: Forward CAGCAATTTTCAGTGTCAGAAGC;
- Reverse TCATCCTGTCCTTGAGGCAGT
- GAPDH. Forward, 5′-CTGTTGCTGTAGCCAAATTCGT-3′;
- Reverse, 5′-ACCCACTCCTCCACCTTTGAC-3′
2.5. RNA Immunoprecipitation (IP)
3. Results
3.1. Expression of Endogenous Retroviruses (ERVs) Increases upon Differentiation
3.2. Caspase Activity Suppresses ERV Transactivation
3.3. ERV dsRNA Accumulates upon Caspase Inhibition
3.4. ERV Expression Increases in Response to JAK-STAT Signaling
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McBride, A.A. Human malignancies associated with persistent HPV infection. Oncologist 2024, 29, 457–464. [Google Scholar] [CrossRef] [PubMed]
- Moody, C. Mechanisms by which HPV Induces a Replication Competent Environment in Differentiating Keratinocytes. Viruses 2017, 9, 261. [Google Scholar] [CrossRef]
- McBride, A.A. Mechanisms and strategies of papillomavirus replication. Biol. Chem. 2017, 398, 919–927. [Google Scholar] [CrossRef]
- Hoffmann, R.; Hirt, B.; Bechtold, V.; Beard, P.; Raj, K. Different modes of human papillomavirus DNA replication during maintenance. J. Virol. 2006, 80, 4431–4439. [Google Scholar] [CrossRef] [PubMed]
- Hummel, M.; Hudson, J.B.; Laimins, L.A. Differentiation-induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes. J. Virol. 1992, 66, 6070–6080. [Google Scholar] [CrossRef]
- Bedell, M.A.; Hudson, J.B.; Golub, T.R.; Turyk, M.E.; Hosken, M.; Wilbanks, G.D.; Laimins, L.A. Amplification of human papillomavirus genomes in vitro is dependent on epithelial differentiation. J. Virol. 1991, 65, 2254–2260. [Google Scholar] [CrossRef]
- Ozbun, M.A.; Meyers, C. Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b. J. Virol. 1997, 71, 5161–5172. [Google Scholar] [CrossRef]
- Cheng, S.; Schmidt-Grimminger, D.C.; Murant, T.; Broker, T.R.; Chow, L.T. Differentiation-dependent up-regulation of the human papillomavirus E7 gene reactivates cellular DNA replication in suprabasal differentiated keratinocytes. Genes. Dev. 1995, 9, 2335–2349. [Google Scholar] [CrossRef] [PubMed]
- Chien, W.M.; Parker, J.N.; Schmidt-Grimminger, D.C.; Broker, T.R.; Chow, L.T. Casein kinase II phosphorylation of the human papillomavirus-18 E7 protein is critical for promoting S-phase entry. Cell Growth Differ. 2000, 11, 425–435. [Google Scholar]
- Banerjee, N.S.; Wang, H.K.; Broker, T.R.; Chow, L.T. Human papillomavirus (HPV) E7 induces prolonged G2 following S phase reentry in differentiated human keratinocytes. J. Biol. Chem. 2011, 286, 15473–15482. [Google Scholar] [CrossRef]
- Moody, C.A.; Fradet-Turcotte, A.; Archambault, J.; Laimins, L.A. Human papillomaviruses activate caspases upon epithelial differentiation to induce viral genome amplification. Proc. Natl. Acad. Sci. USA 2007, 104, 19541–19546. [Google Scholar] [CrossRef] [PubMed]
- Huang, N.; Groover, D.; Damania, B.; Moody, C. Apoptotic caspases suppress an MDA5-driven IFN response during productive replication of human papillomavirus type 31. Proc. Natl. Acad. Sci. USA 2022, 119, e2200206119. [Google Scholar] [CrossRef]
- Youle, R.J.; Strasser, A. The BCL-2 protein family: Opposing activities that mediate cell death. Nat. Rev. Mol. Cell Biol. 2008, 9, 47–59. [Google Scholar] [CrossRef]
- Tummers, B.; Green, D.R. Caspase-8: Regulating life and death. Immunol. Rev. 2017, 277, 76–89. [Google Scholar] [CrossRef] [PubMed]
- Glover, H.L.; Schreiner, A.; Dewson, G.; Tait, S.W.G. Mitochondria and cell death. Nat. Cell Biol. 2024, 28, 170–177. [Google Scholar] [CrossRef]
- Van Opdenbosch, N.; Lamkanfi, M. Caspases in Cell Death, Inflammation, and Disease. Immunity 2019, 50, 1352–1364. [Google Scholar] [CrossRef]
- Pradeu, T.; Thomma, B.; Girardin, S.E.; Lemaitre, B. The conceptual foundations of innate immunity: Taking stock 30 years later. Immunity 2024, 57, 613–631. [Google Scholar] [CrossRef]
- Rehwinkel, J.; Gack, M.U. RIG-I-like receptors: Their regulation and roles in RNA sensing. Nat. Rev. Immunol. 2020, 20, 537–551. [Google Scholar] [CrossRef] [PubMed]
- Dvorkin, S.; Cambier, S.; Volkman, H.E.; Stetson, D.B. New frontiers in the cGAS-STING intracellular DNA-sensing pathway. Immunity 2024, 57, 718–730. [Google Scholar] [CrossRef]
- Chen, H.; Ning, X.; Jiang, Z. Caspases control antiviral innate immunity. Cell Mol. Immunol. 2017, 14, 736–747. [Google Scholar] [CrossRef]
- White, M.J.; McArthur, K.; Metcalf, D.; Lane, R.M.; Cambier, J.C.; Herold, M.J.; van Delft, M.F.; Bedoui, S.; Lessene, G.; Ritchie, M.E.; et al. Apoptotic caspases suppress mtDNA-induced STING-mediated type I IFN production. Cell 2014, 159, 1549–1562. [Google Scholar] [CrossRef] [PubMed]
- Rongvaux, A.; Jackson, R.; Harman, C.C.; Li, T.; West, A.P.; de Zoete, M.R.; Wu, Y.; Yordy, B.; Lakhani, S.A.; Kuan, C.Y.; et al. Apoptotic caspases prevent the induction of type I interferons by mitochondrial DNA. Cell 2014, 159, 1563–1577. [Google Scholar] [CrossRef] [PubMed]
- Ning, X.; Wang, Y.; Jing, M.; Sha, M.; Lv, M.; Gao, P.; Zhang, R.; Huang, X.; Feng, J.M.; Jiang, Z. Apoptotic Caspases Suppress Type I Interferon Production via the Cleavage of cGAS, MAVS, and IRF3. Mol. Cell 2019, 74, 19–31.e7. [Google Scholar] [CrossRef] [PubMed]
- Sears, N.; Sen, G.C.; Stark, G.R.; Chattopadhyay, S. Caspase-8-mediated cleavage inhibits IRF-3 protein by facilitating its proteasome-mediated degradation. J. Biol. Chem. 2011, 286, 33037–33044. [Google Scholar] [CrossRef] [PubMed]
- Russ, E.; Iordanskiy, S. Endogenous Retroviruses as Modulators of Innate Immunity. Pathogens 2023, 12, 162. [Google Scholar] [CrossRef]
- Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [Google Scholar] [CrossRef]
- Kovalskaya, E.; Buzdin, A.; Gogvadze, E.; Vinogradova, T.; Sverdlov, E. Functional human endogenous retroviral LTR transcription start sites are located between the R and U5 regions. Virology 2006, 346, 373–378. [Google Scholar] [CrossRef]
- Dopkins, N.; Nixon, D.F. Activation of human endogenous retroviruses and its physiological consequences. Nat. Rev. Mol. Cell Biol. 2024, 25, 212–222. [Google Scholar] [CrossRef]
- Chiappinelli, K.B.; Strissel, P.L.; Desrichard, A.; Li, H.; Henke, C.; Akman, B.; Hein, A.; Rote, N.S.; Cope, L.M.; Snyder, A.; et al. Inhibiting DNA Methylation Causes an Interferon Response in Cancer via dsRNA Including Endogenous Retroviruses. Cell 2015, 162, 974–986. [Google Scholar] [CrossRef]
- Roulois, D.; Loo Yau, H.; Singhania, R.; Wang, Y.; Danesh, A.; Shen, S.Y.; Han, H.; Liang, G.; Jones, P.A.; Pugh, T.J.; et al. DNA-Demethylating Agents Target Colorectal Cancer Cells by Inducing Viral Mimicry by Endogenous Transcripts. Cell 2015, 162, 961–973. [Google Scholar] [CrossRef]
- Soto, D.; Song, C.; McLaughlin-Drubin, M.E. Epigenetic Alterations in Human Papillomavirus-Associated Cancers. Viruses 2017, 9, 248. [Google Scholar] [CrossRef] [PubMed]
- Mac, M.; Moody, C.A. Epigenetic Regulation of the Human Papillomavirus Life Cycle. Pathogens 2020, 9, 483. [Google Scholar] [CrossRef] [PubMed]
- Kalantari, M.; Lee, D.; Calleja-Macias, I.E.; Lambert, P.F.; Bernard, H.U. Effects of cellular differentiation, chromosomal integration and 5-aza-2′-deoxycytidine treatment on human papillomavirus-16 DNA methylation in cultured cell lines. Virology 2008, 374, 292–303. [Google Scholar] [CrossRef] [PubMed]
- Ruesch, M.N.; Stubenrauch, F.; Laimins, L.A. Activation of papillomavirus late gene transcription and genome amplification upon differentiation in semisolid medium is coincident with expression of involucrin and transglutaminase but not keratin-10. J. Virol. 1998, 72, 5016–5024. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.; Laimins, L.A. Differentiation of HPV-containing cells using organotypic “raft” culture or methylcellulose. Methods Mol. Med. 2005, 119, 157–169. [Google Scholar] [CrossRef]
- Price, A.M.; Steinbock, R.T.; Di, C.; Hayer, K.E.; Li, Y.; Herrmann, C.; Parenti, N.A.; Whelan, J.N.; Weiss, S.R.; Weitzman, M.D. Adenovirus prevents dsRNA formation by promoting efficient splicing of viral RNA. Nucleic Acids Res. 2022, 50, 1201–1220. [Google Scholar] [CrossRef]
- Canadas, I.; Thummalapalli, R.; Kim, J.W.; Kitajima, S.; Jenkins, R.W.; Christensen, C.L.; Campisi, M.; Kuang, Y.; Zhang, Y.; Gjini, E.; et al. Tumor innate immunity primed by specific interferon-stimulated endogenous retroviruses. Nat. Med. 2018, 24, 1143–1150. [Google Scholar] [CrossRef]
- Moody, C.A.; Laimins, L.A. Human papillomaviruses activate the ATM DNA damage pathway for viral genome amplification upon differentiation. PLoS Pathog. 2009, 5, e1000605. [Google Scholar] [CrossRef]
- Palii, S.S.; Van Emburgh, B.O.; Sankpal, U.T.; Brown, K.D.; Robertson, K.D. DNA methylation inhibitor 5-Aza-2′-deoxycytidine induces reversible genome-wide DNA damage that is distinctly influenced by DNA methyltransferases 1 and 3B. Mol. Cell Biol. 2008, 28, 752–771. [Google Scholar] [CrossRef]
- Burgers, W.A.; Blanchon, L.; Pradhan, S.; de Launoit, Y.; Kouzarides, T.; Fuks, F. Viral oncoproteins target the DNA methyltransferases. Oncogene 2007, 26, 1650–1655. [Google Scholar] [CrossRef]
- Yeung, C.L.; Tsang, T.Y.; Yau, P.L.; Kwok, T.T. Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3. Oncotarget 2017, 8, 12158–12173. [Google Scholar] [CrossRef] [PubMed]
- Domansky, A.N.; Kopantzev, E.P.; Snezhkov, E.V.; Lebedev, Y.B.; Leib-Mosch, C.; Sverdlov, E.D. Solitary HERV-K LTRs possess bi-directional promoter activity and contain a negative regulatory element in the U5 region. FEBS Lett. 2000, 472, 191–195. [Google Scholar] [CrossRef]
- Chuong, E.B.; Elde, N.C.; Feschotte, C. Regulatory evolution of innate immunity through co-option of endogenous retroviruses. Science 2016, 351, 1083–1087. [Google Scholar] [CrossRef]
- Faulkner, G.J.; Kimura, Y.; Daub, C.O.; Wani, S.; Plessy, C.; Irvine, K.M.; Schroder, K.; Cloonan, N.; Steptoe, A.L.; Lassmann, T.; et al. The regulated retrotransposon transcriptome of mammalian cells. Nat. Genet. 2009, 41, 563–571. [Google Scholar] [CrossRef] [PubMed]
- Dunn, C.A.; Romanish, M.T.; Gutierrez, L.E.; van de Lagemaat, L.N.; Mager, D.L. Transcription of two human genes from a bidirectional endogenous retrovirus promoter. Gene 2006, 366, 335–342. [Google Scholar] [CrossRef]
- Weber, F.; Wagner, V.; Rasmussen, S.B.; Hartmann, R.; Paludan, S.R. Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J. Virol. 2006, 80, 5059–5064. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, M.; Guo, X.; Zhang, B.; Li, H.; Liu, Y.; Han, J.; Jia, L.; Li, L. Endogenous Retrovirus Elements Are Co-Expressed with IFN Stimulation Genes in the JAK-STAT Pathway. Viruses 2022, 15, 60. [Google Scholar] [CrossRef] [PubMed]
- Ezeonwumelu, I.J.; Garcia-Vidal, E.; Ballana, E. JAK-STAT Pathway: A Novel Target to Tackle Viral Infections. Viruses 2021, 13, 2379. [Google Scholar] [CrossRef]
- Dopkins, N.; O’Mara, M.M.; Lawrence, E.; Fei, T.; Sandoval-Motta, S.; Nixon, D.F.; Bendall, M.L. A field guide to endogenous retrovirus regulatory networks. Mol. Cell 2022, 82, 3763–3768. [Google Scholar] [CrossRef]
- Hurst, T.P.; Magiorkinis, G. Epigenetic Control of Human Endogenous Retrovirus Expression: Focus on Regulation of Long-Terminal Repeats (LTRs). Viruses 2017, 9, 130. [Google Scholar] [CrossRef]
- Chen, R.; Ishak, C.A.; De Carvalho, D.D. Endogenous Retroelements and the Viral Mimicry Response in Cancer Therapy and Cellular Homeostasis. Cancer Discov. 2021, 11, 2707–2725. [Google Scholar] [CrossRef]
- Dias Junior, A.G.; Sampaio, N.G.; Rehwinkel, J. A Balancing Act: MDA5 in Antiviral Immunity and Autoinflammation. Trends Microbiol. 2019, 27, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, S.; Mu, X.; Yang, F.; Greenwald, E.; Park, J.W.; Jacob, E.; Zhang, C.Z.; Hur, S. Breaching Self-Tolerance to Alu Duplex RNA Underlies MDA5-Mediated Inflammation. Cell 2018, 172, 797–810.e13. [Google Scholar] [CrossRef] [PubMed]
- Zhao, K.; Du, J.; Peng, Y.; Li, P.; Wang, S.; Wang, Y.; Hou, J.; Kang, J.; Zheng, W.; Hua, S.; et al. LINE1 contributes to autoimmunity through both RIG-I- and MDA5-mediated RNA sensing pathways. J. Autoimmun. 2018, 90, 105–115. [Google Scholar] [CrossRef]
- Hong, S.; Mehta, K.P.; Laimins, L.A. Suppression of STAT-1 expression by human papillomaviruses is necessary for differentiation-dependent genome amplification and plasmid maintenance. J. Virol. 2011, 85, 9486–9494. [Google Scholar] [CrossRef] [PubMed]
- Ito, J.; Sugimoto, R.; Nakaoka, H.; Yamada, S.; Kimura, T.; Hayano, T.; Inoue, I. Systematic identification and characterization of regulatory elements derived from human endogenous retroviruses. PLoS Genet. 2017, 13, e1006883. [Google Scholar] [CrossRef]
- Subramanian, R.P.; Wildschutte, J.H.; Russo, C.; Coffin, J.M. Identification, characterization, and comparative genomic distribution of the HERV-K (HML-2) group of human endogenous retroviruses. Retrovirology 2011, 8, 90. [Google Scholar] [CrossRef]
- Sverdlov, E.D. Perpetually mobile footprints of ancient infections in human genome. FEBS Lett. 1998, 428, 1–6. [Google Scholar] [CrossRef]
- Durnaoglu, S.; Lee, S.K.; Ahnn, J. Human Endogenous Retroviruses as Gene Expression Regulators: Insights from Animal Models into Human Diseases. Mol. Cells 2021, 44, 861–878. [Google Scholar] [CrossRef]
- Zhou, B.; Qi, F.; Wu, F.; Nie, H.; Song, Y.; Shao, L.; Han, J.; Wu, Z.; Saiyin, H.; Wei, G.; et al. Endogenous Retrovirus-Derived Long Noncoding RNA Enhances Innate Immune Responses via Derepressing RELA Expression. mBio 2019, 10, 10–128. [Google Scholar] [CrossRef]
- Curty, G.; Menezes, A.N.; Brant, A.C.; de Mulder Rougvie, M.; Moreira, M.A.M.; Soares, M.A. Expression of Retroelements in Cervical Cancer and Their Interplay with HPV Infection and Host Gene Expression. Cancers 2021, 13, 3513. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Foroozesh, M.; Qin, Z. Transactivation of human endogenous retroviruses by tumor viruses and their functions in virus-associated malignancies. Oncogenesis 2019, 8, 6. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Del Valle, L.; Miley, W.; Whitby, D.; Ochoa, A.C.; Flemington, E.K.; Qin, Z. Transactivation of human endogenous retrovirus K (HERV-K) by KSHV promotes Kaposi’s sarcoma development. Oncogene 2018, 37, 4534–4545. [Google Scholar] [CrossRef] [PubMed]
- Sutkowski, N.; Conrad, B.; Thorley-Lawson, D.A.; Huber, B.T. Epstein-Barr virus transactivates the human endogenous retrovirus HERV-K18 that encodes a superantigen. Immunity 2001, 15, 579–589. [Google Scholar] [CrossRef]
- Jansz, N.; Faulkner, G.J. Endogenous retroviruses in the origins and treatment of cancer. Genome Biol. 2021, 22, 147. [Google Scholar] [CrossRef]
- Alldredge, J.; Kumar, V.; Nguyen, J.; Sanders, B.E.; Gomez, K.; Jayachandran, K.; Zhang, J.; Schwarz, J.; Rahmatpanah, F. Endogenous Retrovirus RNA Expression Differences between Race, Stage and HPV Status Offer Improved Prognostication among Women with Cervical Cancer. Int. J. Mol. Sci. 2023, 24, 1492. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Studstill, C.; Huang, N.; Sundstrom, S.; Moscoso, S.; Zhang, H.; Damania, B.; Moody, C. Apoptotic Caspases Suppress Expression of Endogenous Retroviruses in HPV31+ Cells That Are Associated with Activation of an Innate Immune Response. Viruses 2024, 16, 1695. https://doi.org/10.3390/v16111695
Studstill C, Huang N, Sundstrom S, Moscoso S, Zhang H, Damania B, Moody C. Apoptotic Caspases Suppress Expression of Endogenous Retroviruses in HPV31+ Cells That Are Associated with Activation of an Innate Immune Response. Viruses. 2024; 16(11):1695. https://doi.org/10.3390/v16111695
Chicago/Turabian StyleStudstill, Caleb, Ning Huang, Shelby Sundstrom, Samantha Moscoso, Huirong Zhang, Blossom Damania, and Cary Moody. 2024. "Apoptotic Caspases Suppress Expression of Endogenous Retroviruses in HPV31+ Cells That Are Associated with Activation of an Innate Immune Response" Viruses 16, no. 11: 1695. https://doi.org/10.3390/v16111695
APA StyleStudstill, C., Huang, N., Sundstrom, S., Moscoso, S., Zhang, H., Damania, B., & Moody, C. (2024). Apoptotic Caspases Suppress Expression of Endogenous Retroviruses in HPV31+ Cells That Are Associated with Activation of an Innate Immune Response. Viruses, 16(11), 1695. https://doi.org/10.3390/v16111695