The Interaction between B87 Vaccine Strain and BC6/85 of Infectious Bursa Disease Virus in SPF Chickens
Abstract
1. Introduction
2. Materials and Methods
2.1. Chickens
2.2. Virus Strains
2.3. Primers and Probes
2.4. Specificity Testing
2.5. The Generation of Standard Curve and Estimation of ELD50 Values
2.6. Experimental Design
2.7. Viral Load Detection by Real-Time RT-PCR
2.7.1. Tissue Processing
2.7.2. RNA Extraction and Real-Time RT-PCR
2.8. Statistical Analysis
2.9. Ethics Statement
3. Results
3.1. Development and Validation of Real-Time RT-PCR Assays
3.2. Viral Loads of Single and Mixed Viral Infection Groups
3.3. Viral Loads of BC6/85 in Sequential Viral Infection Groups
3.4. Viral Loads of BC6/85 in Bursa, Spleen, Kidney, and Liver
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eterradossi, N.; Saif, Y.M. Diseases of Poultry, 14th ed.; John Wiley & Sons Inc.: Ames, IA, USA, 2020; Volume 7, pp. 257–283. [Google Scholar]
- World Organisation for Animal Health. Infectious Bursal Disease (Gumboro Disease), Chapter 3.3.12. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. World Organisation for Animal Health. 2018. Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/3.03.12_IBD.pdf (accessed on 23 September 2016).
- Wang, Q.; Hu, H.; Chen, G.; Liu, H.; Wang, S.; Xia, D.; Yu, Y.; Zhang, Y.; Jiang, J.; Ma, J.; et al. Identification and assessment of pathogenicity of a naturally reassorted infectious bursal disease virus from Henan, China. Poult. Sci. 2019, 98, 6433–6444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, L.; Wu, T.; Hussain, A.; Gao, Y.; Zeng, X.; Wang, Y.; Gao, L.; Li, K.; Wang, Y.; Liu, C.; et al. Novel variant strains of infectious bursal disease virus isolated in China. Vet. Microbiol. 2019, 230, 212–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, D.; Zhang, X.; Yan, Z.; Chen, F.; Ji, J.; Qin, J.; Li, H.; Lu, J.; Xue, Y.; Liu, J.; et al. Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011. Trop. Anim. Health Prod. 2013, 45, 1107–1112. [Google Scholar] [CrossRef] [Scilit]
- Xu, M.; Lin, S.; Zhao, Y.; Jin, J.; Tang, N.; Zhang, G. Characteristics of very virulent infectious bursal disease viruses isolated from Chinese broiler chickens (2012–2013). Acta Trop. 2015, 141, 128–134. [Google Scholar] [CrossRef] [Scilit]
- Kabell, S.; Handberg, K.J.; Li, Y.; Kusk, M.; Bisgaard, M. Detection of vvIBDV in vaccinated SPF chickens. Acta Vet. Scand. 2005, 46, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Müller, R.; Käufer, I.; Reinacher, M.; Weiss, E. Immunofluorescent studies of early virus propagation after oral infection with infectious bursal disease virus (IBDV). Zent. Für Veterinärmedizin Reihe B 1979, 26, 345–352. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.F.; Huang, G.M.; Qiao, S. Early stages of infectious bursal disease virus infection in chickens detected by in situ reverse transcriptase-polymerase chain reaction. Avian Pathol. 2002, 31, 593–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdul, R.; Murgia, M.V.; Rodriguez-Palacios, A.; Lee, C.W.; Saif, Y.M. Persistence and tissue distribution of infectious bursal disease virus in experimentally infected SPF and commercial broiler chickens. Avian Dis. 2013, 57, 759–766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayasundara, J.; Walkden-Brown, S.W.; Katz, M.E.; Islam, A.F.M.F.; Renz, K.G.; McNally, J.; Hunt, P.W. Pathogenicity, tissue distribution, shedding and environmental detection of two strains of IBDV following infection of chickens at 0 and 14 days of age. Avian Pathol. 2017, 46, 242–255. [Google Scholar] [CrossRef] [Scilit]
- Aouini, R.; Laamiri, N.; Ghram, A. Viral interference between low pathogenic avian influenza H9N2 and avian infectious bronchitis viruses in vitro and in ovo. J. Virol. Methods 2018, 259, 92–99. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Ginzinger, D.G. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 2002, 30, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Tomás, G.; Hernández, M.; Marandino, A.; Panzera, Y.; Maya, L.; Hernández, D.; Pereda, A.; Banda, A.; Villegas, P.; Aguirr, S.; et al. Development and validation of a TaqMan-MGB real-time RT-PCR assay for simultaneous detection and characterization of infectious bursal disease virus. J. Virol. Methods 2012, 185, 101–107. [Google Scholar] [CrossRef] [Scilit]
- Peters, M.A.; Lin, T.L.; Wu, C.C. Real-time RT-PCR differentiation and quantitation of infectious bursal disease virus strains using dual-labeled fluorescent probes. J. Virol. Methods 2005, 127, 87–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanimura, N.; Tsukamoto, K.; Nakamura, K.; Narita, M.; Maeda, M. Association between pathogenicity of infectious bursal disease virus and viral antigen distribution detected by immunohistochemistry. Avian Dis. 1995, 39, 9–20. [Google Scholar] [CrossRef] [Scilit]
- Ashraf, S.; Abdel-Alim, G.; Al-Natour, M.Q.; Saif, Y.M. Interference between mild and pathogenic strains of infectious bursal disease virus in chickens. Avian Dis. 2005, 49, 99–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsukamoto, K.; Tanimura, N.; Mase, M.; Imai, K. Comparison of virus replication efficiency in lymphoid tissues among three infectious bursal disease virus strains. Avian Dis. 1995, 39, 844–852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whitaker-Dowling, P.; Youngner, J.S. Viral interference-dominance of mutant viruses over wild-type virus in mixed infections. Microbiol. Rev. 1987, 51, 179–191. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.J.; You, S.K.; Kim, H.; Yeh, H.Y.; Sharma, J.M. Characteristics of bursal T lymphocytes induced by infectious bursal disease virus. J. Virol. 2000, 74, 8884–8892. [Google Scholar] [CrossRef] [Scilit]




| Primer/Probe | Sequence 5′→3′ | Position a | Amplicon Size |
|---|---|---|---|
| F1 | CGACAACCTTATGCCATTCAATC | 858–880 | 84 bp |
| R1 | GTCACTATCTCCAGTTTGATGGATGT | 916–941 | |
| F2 | GGGAGAGCTCGTGTTCCAAA | 730–750 | 73 bp |
| R2 | GATGGTGGCGCCCAGTAC | 784–802 | |
| P1 | FAM-TGATTCCAACAAACGAGATAACCCAGCCA-TAMAR | 884–912 | |
| P2 | VIC-AGCGTCCAAAGCAT-MGB | 752–766 |
| Group | 0 H | 12 H | 24 H | 36 H | 48 H | 60 H | 72 H | 84 H | 96 H | 120 H | 144 H | 168 H | 192 H | 216 H | 240 H |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | B87 * | √ | √ | √ | √ | √ | √ | √ | √ | ||||||
| 2 | BC6/85 * | √ | √ | √ | √ | √ | √ | √ | √ | ||||||
| 3 | B87& BC6/85 * | √ | √ | √ | √ | √ | √ | √ | √ | ||||||
| 4 | B87 * | BC6/85 * | √ | √ | √ | √ | √ | √ | √ | √ | |||||
| 5 | B87 * | BC6/85 * | √ | √ | √ | √ | √ | √ | √ | √ | |||||
| 6 | B87 * | BC6/85 * | √ | √ | √ | √ | √ | √ | √ | √ | |||||
| 7 | / | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ | √ |
| ELD50/Reaction | B87 | ELD50/Reaction | BC6/85 | ||
|---|---|---|---|---|---|
| Mean Ct | CV | Mean Ct | CV | ||
| 100.1 | - a | 100.2 | 31.40 | 1.98 | |
| 100.8 | 32.59 | 0.82 | 101.2 | 28.35 | 0.98 |
| 101.8 | 30.23 | 0.65 | 102.2 | 24.43 | 2.63 |
| 102.8 | 26.52 | 1.17 | 103.2 | 20.41 | 3.43 |
| 103.8 | 22.62 | 1.69 | 104.2 | 17.13 | 3.03 |
| 104.8 | 18.73 | 1.38 | 105.2 | 15.01 | 2.60 |
| Organ | IBDV Strain | Day(s) Post-Inoculation | |||||||
|---|---|---|---|---|---|---|---|---|---|
| 0.5 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | ||
| Bursa | B87 | - | - | - | 4.06 ± 0.22 A | 3.81 ± 0.32 | 4.64 ± 0.35 | 4.26 ± 0.25 | 4.99 ± 0.36 |
| BC6/85 | - | 0.48 | 1.13 ± 0.02 | 4.54 ± 0.47 | 5.27 ± 0.37 | 3.80 ± 0.22 | 3.49 ± 0.32 | 3.10 ± 0.28 | |
| Blood | B87 | 0.91 ± 0.03 a | - | 1.16 ± 0.05 | 0.94 ± 0.05 a | 1.20 ± 0.09 a | - | 1.18 ± 0.11 a | 1.53 ± 0.13 a |
| BC6/85 | 3.27 ± 0.22 b | - | - | 1.29 ± 0.07 b | 2.88 ± 0.22 b | - | 0.01 b | 3.57 ± 0.26 b | |
| Spleen | B87 | - | - | - a | 1.08 ± 0.13 a | - | - | - a | 1.63 ± 0.11 |
| BC6/85 | - | - | 2.01 ± 0.12 b | 3.03 ± 0.22 b | 0.84 | 0.27 ± 0.12 | 1.20 ± 0.12 b | 2.25 ± 0.17 | |
| Kidney | B87 | - | - | 0.99 ± 0.04 | 1.75 ± 0.18 | 1.88 ± 0.16 | 2.40 ± 0.18 | 1.15 ± 0.10 | - a |
| BC6/85 | - | - | - | 2.12 ± 0.12 | 1.91 ± 0.18 | 2.84 ± 0.27 | 1.51 ± 0.20 | 1.29 ± 0.09 b | |
| Liver | B87 | - | - | - | 2.19 ± 0.20 a | - | 1.16 ± 0.17 a | - a | 1.54 ± 0.11 a |
| BC6/85 | 0.21 | - | 0.23 | 5.07 ± 0.40 b | 3.68 ± 0.32 | 3.83 ± 0.32 b | 2.03 ± 0.18 b | 2.66 ± 0.22 b | |
| Thigh muscle | B87 | 1.77 ± 0.17 | 1.15 ± 0.12 a | 2.16 ± 0.21 | 1.88 ± 0.19 | 1.34 ± 0.16 | - a | 2.37 ± 0.16 | 1.64 ± 0.11 |
| BC6/85 | 0.77 | - b | 0.05 | 1.29 ± 0.12 | 2.57 ± 0.22 | 3.57 ± 0.29 b | 0.97 | 2.15 ± 0.20 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, L.; Yang, X.; Song, Y.; Jiang, T. The Interaction between B87 Vaccine Strain and BC6/85 of Infectious Bursa Disease Virus in SPF Chickens. Viruses 2022, 14, 2111. https://doi.org/10.3390/v14102111
Chen L, Yang X, Song Y, Jiang T. The Interaction between B87 Vaccine Strain and BC6/85 of Infectious Bursa Disease Virus in SPF Chickens. Viruses. 2022; 14(10):2111. https://doi.org/10.3390/v14102111
Chicago/Turabian StyleChen, Ling, Xiaoyue Yang, Yafen Song, and Taozhen Jiang. 2022. "The Interaction between B87 Vaccine Strain and BC6/85 of Infectious Bursa Disease Virus in SPF Chickens" Viruses 14, no. 10: 2111. https://doi.org/10.3390/v14102111
APA StyleChen, L., Yang, X., Song, Y., & Jiang, T. (2022). The Interaction between B87 Vaccine Strain and BC6/85 of Infectious Bursa Disease Virus in SPF Chickens. Viruses, 14(10), 2111. https://doi.org/10.3390/v14102111
