A Novel Plasmid DNA-Based Foot and Mouth Disease Virus Minigenome for Intracytoplasmic mRNA Production
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. RNA Isolation and cDNA Synthesis
2.3. FMDV Growth Kinetics Analysis
2.4. Construction of FMDV Minigenome Vectors: pKLS3 and pKLS3_GFP
2.5. Evaluation of Hepatitis Delta Virus Ribozyme (hdv) Activity by In Vitro Transcription
2.6. Construction of ‘Helper Plasmids’ for the FMDV Minigenome
2.7. Transfection
2.8. Inhibition of RNA Dependent RNA Polymerase (RdRp) Activities by Ribavirin
2.9. Molecular Docking of Ribavirin on FMDV RdRp
3. Results
3.1. Selection of the High Growth FMDV Strain
3.2. Components of pKLS3 Minigenome
3.3. Functional Evaluation of pKLS3 as An FMDV Minigenome
3.4. Enhancement of the GFP Expression Level by pCAGGS_P3
3.5. pKLS3_GFP as a Tool to Screen Antiviral Drug Targeting FMDV RdRp
3.6. Molecular Docking of Ribavirin on FMDV RdRp
4. Discussion
5. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- van Rensburg, H.G.; Henry, T.M.; Mason, P.W. Studies of genetically defined chimeras of a European type A virus and a South African Territories type 2 virus reveal growth determinants for foot-and-mouth disease virus. J. Gen. Virol. 2004, 85, 61–68. [Google Scholar] [CrossRef]
- Carrillo, C.; Tulman, E.R.; Delhon, G.; Lu, Z.; Carreno, A.; Vagnozzi, A.; Kutish, G.F.; Rock, D.L. Comparative Genomics of Foot-and-Mouth Disease Virus. J. Virol. 2005, 79, 6487–6504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belsham, G.J. Translation and Replication of FMDV RNA. Foot Mouth Dis. Virus 2005, 288, 43–70. [Google Scholar]
- Sobrino, F.; Jiménez-Claverob, M.A.; Núñeza, J.I.; Rosas, M.F.; Baranowski, E.; Ley, V.S.M. Foot-and-mouth disease virus: A long known virus, but a current threat. Vet. Res. 2001, 32, 1–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belsham, G.J.; Martinez-Salas, E. Genome organization, translation and replication of foot-and-mouth disease virus RNA. In Foot-and-Mouth Disease Virus: Current Research and Emerging Trends; Caister Academic Press: Poole, UK, 2004; pp. 13–42. [Google Scholar]
- Kloc, A.; Rai, D.K.; Rieder, E. The roles of picornavirus untranslated regions in infection and innate immunity. Front. Microbiol. 2018, 9, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Harris, T.J.; Brown, F. The location of the ploy(C) tract in the RNA of foot-and-mouth disease virus. J. Gen. Virol. 1976, 33, 493–501. [Google Scholar] [CrossRef] [PubMed]
- Rieder, E.; Bunch, T.; Mason, P.W.; Brown, F. Genetically engineered foot-and-mouth disease viruses with poly(C) tracts of two nucleotides are virulent in mice. J. Virol. 1993, 67, 5139–5145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanda, T.; Ozawa, M.; Tsukiyama-Kohara, K. IRES-mediated translation of foot-and-mouth disease virus (FMDV) in cultured cells derived from FMDV-susceptible and -insusceptible animals. BMC Vet. Res. 2016, 12, 66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Salas, E.; Francisco-Velilla, R.; Fernandez-Chamorro, J.; Lozano, G.; Diaz-Toledano, R. Picornavirus IRES elements: RNA structure and host protein interactions. Virus Res. 2015, 206, 62–73. [Google Scholar] [CrossRef]
- Miras, M.; Sempere, R.N.; Kraft, J.J.; Miller, W.A.; Aranda, M.A.; Truniger, V. Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking. New Phytol. 2014, 202, 233–246. [Google Scholar] [CrossRef] [Green Version]
- Serrano, P.; Pulido Rodriguez, M.; Sáiz, M.; Martínez-Salas, E. The 3′ end of the foot-and-mouth disease virus genome establishes two distinct long-range RNA-RNA interactions with the 5′ and region. J. Gen. Virol. 2006, 87, 3013–3022. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Guo, J.; Jin, Y.; Yang, F.; He, J.; Lv, L.; Zhang, K.; Wu, Q.; Liu, X.; Cai, X. Engineering Foot-and-Mouth Disease Viruses with Improved Growth Properties for Vaccine Development. PLoS ONE 2013, 8, e55228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.H.; Zhang, R.H.; Lin, S.L.; Li, P.F.; Lan, J.J.; Song, S.S.; Gao, J.-M.; Wang, Y.; Xie, Z.-J.; Li, F.-C.; et al. The functional role of the 3′ untranslated region and poly(a) tail of duck hepatitis a virus type 1 in viral replication and regulation of ires-mediated translation. Front. Microbiol. 2018, 9, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Herold, J.; Andino, R. Poliovirus Requires a Precise 5′ End for Efficient Positive-Strand RNA Synthesis. J. Virol. 2000, 74, 6394–6400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Svitkin, Y.V.; Sonenberg, N. A highly efficient and robust in vitro translation system for expression of picornavirus and hepatitis C virus RNA genomes. Methods Enzymol. 2007, 429, 53–82. [Google Scholar] [PubMed]
- Geng, G.; Yu, C.; Li, X.; Yuan, X. Variable 3′polyadenylation of Wheat yellow mosaic virus and its novel effects on translation and replication. Virol. J. 2019, 16, 23. [Google Scholar] [CrossRef]
- Rieder, E.; Baxt, B.; Lubroth, J.; Mason, P.W. Vaccines prepared from chimeras of foot-and-mouth disease virus (FMDV) induce neutralizing antibodies and protective immunity to multiple serotypes of FMDV. J. Virol. 1994, 68, 7092–7098. [Google Scholar] [CrossRef] [Green Version]
- Blignaut, B.; Visser, N.; Theron, J.; Rieder, E.; Maree, F.F. Custom-engineered chimeric foot-and-mouth disease vaccine elicits protective immune responses in Pigs. J. Gen. Virol. 2011, 92, 849–859. [Google Scholar] [CrossRef]
- Saravanan, T.; Kumar, C.A.; Reddy, G.R.; Dechamma, H.J.; Nagarajan, G.; Ravikumar, P.; Gunnam, S.; Suryanarayana, V.V.S. Construction of genome-length cDNA for foot-and- mouth disease virus serotype Asia 1 IND 63/72 vaccine strain. Mol. Biol. 2011, 2, 39–45. [Google Scholar]
- Baranowski, E.; Molina, N.; Núñez, J.I.; Sobrino, F.; Sáiz, M. Recovery of Infectious Foot-and-Mouth Disease Virus from Suckling Mice after Direct Inoculation with In Vitro-Transcribed RNA. J. Virol. 2003, 77, 11290–11295. [Google Scholar] [CrossRef] [Green Version]
- Liu, G.; Liu, Z.; Xie, Q.; Chen, Y.; Bao, H.; Chang, H.; Liu, X. Generation of an infectious cDNA clone of an FMDV strain isolated from swine. Virus Res. 2004, 104, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Herod, M.R.; Lasecka-Dykes, L.; Wright, C.; Ward, J.C.; McLean, T.C.; Forrest, S.; Jackson, T.; Tuthill, T.J.; Rowlands, D.J.; Stonehouse, N.J.; et al. Genetic economy in picornaviruses: Foot-and-mouth disease virus replication exploits alternative precursor cleavage pathways. PLoS Pathog. 2017, 13, e1006666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herod, M.R.; Loundras, E.-A.; Ward, J.C.; Tulloch, F.; Rowlands, D.J.; Stonehouse, N.J. Employing transposon mutagenesis to investigate foot-and-mouth disease virus replication. J. Gen. Virol. 2015, 96, 3507–3518. [Google Scholar] [CrossRef] [Green Version]
- Tulloch, F.A.; Pathania, U.S.; Luke, G.A.; Nicholson, J.; Stonehouse, N.J.; Rowlands, D.J.; Jackson, T.; Tuthill, T.; Haas, J.; Lamond, A.I.; et al. FMDV replicons encoding green fluorescent protein are replication competent. J. Virol. Methods 2014, 209, 35–40. [Google Scholar] [CrossRef]
- Herod, M.R.; Ferrer-Orta, C.; Loundras, E.-A.; Ward, J.C.; Verdaguer, N.; Rowlands, D.J.; Stonehouse, N.J. Both cis and trans Activities of Foot-and-Mouth Disease Virus 3D Polymerase Are Essential for Viral RNA Replication. J. Virol. 2016, 90, 6864–6883. [Google Scholar] [CrossRef] [Green Version]
- Chang, Y.; Zheng, H.; Shang, Y.; Jin, Y.; Wang, G.; Shen, X.; Liu, X. Recovery of infectious foot-and-mouth disease virus from full-length genomic cDNA clones using an RNA polymerase i system. Acta Biochim. Biophys. Sin. 2009, 41, 998–1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lian, K.; Yang, F.; Zhu, Z.; Cao, W.; Jin, Y.; Li, D.; Zhang, K.; Guo, J.; Zheng, H.; Liu, X. Recovery of infectious type Asia1 foot-and-mouth disease virus from suckling mice directly inoculated with an RNA polymerase I/II-driven unidirectional transcription plasmid. Virus Res. 2015, 208, 73–81. [Google Scholar] [CrossRef]
- Lekcharoensuk, P.; Wiriyarat, W.; Petcharat, N.; Lekcharoensuk, C.; Auewarakul, P.; Richt, J.A. Cloned cDNA of A/swine/Iowa/15/1930 internal genes as a candidate backbone for reverse genetics vaccine against influenza A viruses. Vaccine 2012, 30, 1453–1459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaisirirat, T.; Kaewborisuth, C.; Petcharat, N.; Lekcharoensuk, P. Expression of T7 RNA polymerase (T7 RNAP) in Escherichia coli. In Proceedings of 57th Kasetsart University Annual Conference: Plants, Animals, Veterinary Medicine, Agricultural Extension and Home Economics; Kasetsart University: Bangkok, Thailand, 2017; pp. 425–432. [Google Scholar]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [Green Version]
- Ferrer-Orta, C.; Arias, A.; Perez-Luque, R.; Escarmís, C.; Domingo, E.; Verdaguer, N. Structure of foot-and-mouth disease virus RNA-dependent RNA polymerase and its complex with a template-primer RNA. J. Biol. Chem. 2004, 279, 47212–47221. [Google Scholar] [CrossRef] [Green Version]
- Benkert, P.; Biasini, M.; Schwede, T. Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics 2011, 27, 343–350. [Google Scholar] [CrossRef]
- Lovell, S.C.; Davis, I.W.; Arendall, W.B., III; Bakker, P.I.W.; Word, J.; Prisant, M.; Richardson, J.S.; Richardson, D.C. Structure validation by Calpha geometry: Phi, psi and Cbeta deviation. Proteins Struct. Funct. Genet. 2003, 50, 437–450. [Google Scholar] [CrossRef]
- Theerawatanasirikul, S.; Kuo, C.J.; Phecharat, N.; Chootip, J.; Lekcharoensuk, C.; Lekcharoensuk, P. Structural-based virtual screening and in vitro assays for small molecules inhibiting the feline coronavirus 3CL protease as a surrogate platform for coronaviruses. Antiviral Res. 2020, 182, 104927. [Google Scholar] [CrossRef] [PubMed]
- Trott, O.; Olson, A.J. Auto Dock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [PubMed] [Green Version]
- Dallakyan, S.; Olson, A.J. Small-molecule library screening by docking with PyRx. Methods Mol. Biol. 2015, 1263, 243–250. [Google Scholar]
- Agudo, R.; Ferrer-Orta, C.; Arias, A.; De La Higuera, I.; Perales, C.; Pérez-Luque, R.; Verdaguer, N.; Domingo, E. A multi-step process of viral adaptation to a mutagenic nucleoside analogue by modulation of transition types leads to extinction-escape. PLoS Pathog. 2010, 6, 85–86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beaucourt, S.; Vignuzzi, M. Ribavirin: A drug active against many viruses with multiple effects on virus replication and propagation. Molecular basis of ribavirin resistance. Curr. Opin. Virol. 2014, 8, 10–15. [Google Scholar] [CrossRef]
- Zhang, X.N.; Song, Z.G.; Jiang, T.; Shi, B.S.; Hu, Y.W.; Yuan, Z.H. Rupintrivir is a promising candidate for treating severe cases of Enterovirus-71 infection. World J. Gastroenterol. 2010, 16, 201–209. [Google Scholar] [CrossRef]
- McInerney, G.M.; King, A.M.Q.; Ross-Smith, N.; Belsham, G.J. Replication-competent foot-and-mouth disease virus RNAs lacking capsid coding sequences. J. Gen. Virol. 2000, 81, 1699–1702. [Google Scholar] [CrossRef]
- Ghiasvand, S.; Mowla, S.J.; Sadeghizadeh, M.; Bakhshinejad, B. Potential roles of 5′ UTR and 3′ UTR regions in post-transcriptional regulation of mouse Oct4 gene in BMSC and P19 cells. Iran. J. Basic Med. Sci. 2014, 17, 490–496. [Google Scholar]
- Wilkie, G.S.; Gray, N.K.; Dickson, K.S. Regulation of mRNA translation by 5′- and 3′-UTR-binding factors. Trends Biochem. Sci. 2003, 28, 182–188. [Google Scholar] [CrossRef]
- Leppek, K.; Barna, M.D.R. Functional 5′ UTR mRNA structures in eukaryotic translation regulation and how to find them. Nat. Rev. Mol. Cell Biol. 2018, 19, 158–174. [Google Scholar] [CrossRef] [PubMed]
- Falk, M.M.; Grigera, P.R.; Bergmann, I.E.; Zibert, A.; Multhaup, G.; Beck, E. Foot-and-mouth disease virus protease 3C induces specific proteolytic cleavage of host cell histone H3. J. Virol. 1990, 64, 748–756. [Google Scholar] [CrossRef] [Green Version]
- Sun, D.; Chen, S.; Cheng, A.; Wang, M. Roles of the picornaviral 3c proteinase in the viral life cycle and host cells. Viruses 2016, 8, 82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belsham, G.J.; McInerney, G.M.; Ross-Smith, N. Foot-and-Mouth Disease Virus 3C Protease Induces Cleavage of Translation Initiation Factors eIF4A and eIF4G within Infected Cells. J. Virol. 2000, 74, 272–280. [Google Scholar] [CrossRef] [Green Version]
- Silvestri, L.S.; Parilla, J.M.; Morasco, B.J.; Ogram, S.A.; Flanegan, J.B. Relationship between poliovirus negative-strand RNA synthesis and the length of the 3′ poly(A) tail. Virology 2006, 345, 509–519. [Google Scholar] [CrossRef] [Green Version]
- Bradrick, S.S.; Walters, R.W.; Gromeier, M. The hepatitis C virus 3′-untranslated region or a poly(A) tract promote efficient translation subsequent to the initiation phase. Nucleic Acids Res. 2006, 34, 1293–1303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prel, A.; Sensébé, L.; Pagès, J.C. Influence of untranslated regions on retroviral mRNA transfer and expression. BMC Biotechnol. 2013, 13, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Ford, L.P.; Bagga, P.S.; Wilusz, J. The poly(A) tail inhibits the assembly of a 3′-to-5′ exonuclease in an in vitro RNA stability system. Mol. Cell Biol. 1997, 17, 398–406. [Google Scholar] [CrossRef] [Green Version]
- Hoerr, I.; Obst, R.; Rammensee, H.G.; Jung, G. In vivo application of RNA leads to induction of specific cytotoxic T lymphocytes and antibodies. Eur. J. Immunol. 2000, 30, 1–7. [Google Scholar] [CrossRef]
- Phua, K.K.L.; Staats, H.F.; Leong, K.W.; Nair, S.K. Intranasal mRNA nanoparticle vaccination induces prophylactic and therapeutic anti-tumor immunity. Sci. Rep. 2014, 4, 4–10. [Google Scholar]
- Zeng, C.; Hou, X.; Yan, J.; Zhang, C.; Li, W.; Zhao, W.; Du, S.; Dong, Y. Leveraging mRNAs sequences to express SARS-CoV-2 antigens in vivo. BiorXiv Prepr. Serv. Biol. 2020. [Google Scholar] [CrossRef]
- Bai, H.; Lester, G.M.S.; Petishnok, L.C.; Dean, D.A. Cytoplasmic transport and nuclear import of plasmid DNA. Biosci. Rep. 2017, 37, 1–17. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequences (5′-3′) | Remark |
---|---|---|
FMDV_SF_F | TTGAAAGGGGGCGYTAGGGTYTCA | |
FMDV_SF_R | GGGTGAGYRRGCYTCGG | |
FMDV_polyC_F | TGGGCACTCCTGTTGGGG | |
FMDV_polyC_R | TCCTCAAGCGACGGCG | |
Mya98_LF_F | CCCCCCCCCCCCCYAAG | |
Mya98_P1R | CWGCRGTGACTTCRACGTC | |
KLS1_F1 | TATTCTCGAGTTGAAAGGGGGCGCTAGGGT | Underlined: XhoI |
KLS1_R1 | GTGACATCTGAGGGAAGGCCTGAATTTAGTGGCAAT | Underlined: StuI |
Primers | Sequences (5′-3′) | Remark |
---|---|---|
EGFP_F | ATTAAGGCCTATGGTGAGCAAGGGCGAGGAGCTG | Underlined: StuI Bold letter: start codon |
EGFP_R | ATATAGGCCTTTACTTGTACAGCTCGTCCATGCCGAG | Underlined: StuI Bold letter: stop codon |
Primer | Sequence (5′-3′) | Remark |
---|---|---|
ClaI_P3_F | ATCGATTTATGATCTCAATTCCTTCC | Underlined: ClaI Bold letter: start codon |
NheI_P3_R | GCTAGCTTAYGCGTCACCRCA | Underlined: NheI Bold letter: stop codon |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Semkum, P.; Kaewborisuth, C.; Thangthamniyom, N.; Theerawatanasirikul, S.; Lekcharoensuk, C.; Hansoongnern, P.; Ramasoota, P.; Lekcharoensuk, P. A Novel Plasmid DNA-Based Foot and Mouth Disease Virus Minigenome for Intracytoplasmic mRNA Production. Viruses 2021, 13, 1047. https://doi.org/10.3390/v13061047
Semkum P, Kaewborisuth C, Thangthamniyom N, Theerawatanasirikul S, Lekcharoensuk C, Hansoongnern P, Ramasoota P, Lekcharoensuk P. A Novel Plasmid DNA-Based Foot and Mouth Disease Virus Minigenome for Intracytoplasmic mRNA Production. Viruses. 2021; 13(6):1047. https://doi.org/10.3390/v13061047
Chicago/Turabian StyleSemkum, Ploypailin, Challika Kaewborisuth, Nattarat Thangthamniyom, Sirin Theerawatanasirikul, Chalermpol Lekcharoensuk, Payuda Hansoongnern, Pongrama Ramasoota, and Porntippa Lekcharoensuk. 2021. "A Novel Plasmid DNA-Based Foot and Mouth Disease Virus Minigenome for Intracytoplasmic mRNA Production" Viruses 13, no. 6: 1047. https://doi.org/10.3390/v13061047