Near-Complete Genome of SARS-CoV-2 Delta (AY.3) Variant Identified in a Dog in Kansas, USA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Quantitative Reverse Transcription PCR (qRT-PCR) for the Detection of SARS-CoV-2 RNA
2.2. SARS-CoV-2 Whole Genome Sequencing
2.3. Subconsensus Variant Analysis
2.4. Phylogenetic Analysis
3. Results
3.1. Case Description
3.2. Molecular Detection and Sequencing
3.3. Subconsensus Analysis
3.4. Phylogenetic Analysis and Comparison to Known Sequences
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef]
- Davies, N.G.; Abbott, S.; Barnard, R.C.; Jarvis, C.I.; Kucharski, A.J.; Munday, J.D.; Pearson, C.A.B.; Russell, T.W.; Tully, D.C.; Washburne, A.D.; et al. Estimated Transmissibility and Impact of SARS-CoV-2 Lineage B.1.1.7 in England. Science 2021, 372, eabg3055. [Google Scholar] [CrossRef] [PubMed]
- Pearson, C.A.B.; Russell, T.W.; Davies, N.G.; Kucharski, A.J.; Edmunds, W.J.; Eggo, R.M. Estimates of Severity and Transmissibility of Novel South African SARS-CoV-2 Variant 501Y.V2. CMMID Repos. 2021, in press. [Google Scholar]
- Allen, H.; Vusirikala, A.; Flannagan, J.; Twohig, K.A.; Zaidi, A.; COG-UK Consortium; Groves, N.; Lopez-Bernal, J.; Harris, R.; Charlett, A.; et al. Increased Household Transmission of COVID-19 Cases Associated with SARS-CoV-2 Variant of Concern B.1.617.2: A National Casecontrol Study. Public Health Engl. 2021. [Google Scholar]
- Emary, K.R.W.; Golubchik, T.; Aley, P.K.; Ariani, C.V.; Angus, B.; Bibi, S.; Blane, B.; Bonsall, D.; Cicconi, P.; Charlton, S.; et al. Efficacy of ChAdOx1 NCoV-19 (AZD1222) Vaccine against SARS-CoV-2 Variant of Concern 202012/01 (B.1.1.7): An Exploratory Analysis of a Randomised Controlled Trial. Lancet 2021, 397, 1351–1362. [Google Scholar] [CrossRef]
- Wang, P.; Casner, R.G.; Nair, M.S.; Wang, M.; Yu, J.; Cerutti, G.; Liu, L.; Kwong, P.D.; Huang, Y.; Shapiro, L.; et al. Increased Resistance of SARS-CoV-2 Variant P.1 to Antibody Neutralization. Cell Host Microbe 2021, 29, 747–751.e4. [Google Scholar] [CrossRef]
- Deng, X.; Garcia-Knight, M.A.; Khalid, M.M.; Servellita, V.; Wang, C.; Morris, M.K.; Sotomayor-González, A.; Glasner, D.R.; Reyes, K.R.; Gliwa, A.S.; et al. Transmission, Infectivity, and Antibody Neutralization of an Emerging SARS-CoV-2 Variant in California Carrying a L452R Spike Protein Mutation. medRxiv 2021. [Google Scholar] [CrossRef]
- Wu, K.; Werner, A.P.; Moliva, J.I.; Koch, M.; Choi, A.; Stewart-Jones, G.B.E.; Bennett, H.; Boyoglu-Barnum, S.; Shi, W.; Graham, B.S.; et al. MRNA-1273 Vaccine Induces Neutralizing Antibodies against Spike Mutants from Global SARS-CoV-2 Variants. bioRxiv 2021. [Google Scholar] [CrossRef]
- Wang, P.; Nair, M.S.; Liu, L.; Iketani, S.; Luo, Y.; Guo, Y.; Wang, M.; Yu, J.; Zhang, B.; Kwong, P.D.; et al. Antibody Resistance of SARS-CoV-2 Variants B.1.351 and B.1.1.7. Nature 2021, 593, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Bal, A.; Destras, G.; Gaymard, A.; Stefic, K.; Marlet, J.; Eymieux, S.; Regue, H.; Semanas, Q.; d’Aubarede, C.; Billaud, G.; et al. Two-Step Strategy for the Identification of SARS-CoV-2 Variant of Concern 202012/01 and Other Variants with Spike Deletion H69-V70, France, August to December 2020. Eurosurveillance 2021, 26, 2100008. [Google Scholar] [CrossRef]
- CDC Coronavirus Disease 2019 (COVID-19). Available online: https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-info.html (accessed on 21 September 2021).
- Cohen, J. Vaccine Designers Take First Shots at COVID-19. Science 2020, 368, 14–16. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Tenchov, R.; Smoot, J.; Liu, C.; Watkins, S.; Zhou, Q. A Comprehensive Review of the Global Efforts on COVID-19 Vaccine Development. ACS Cent. Sci. 2021, 7, 512–533. [Google Scholar] [CrossRef]
- Fontanet, A.; Autran, B.; Lina, B.; Kieny, M.P.; Karim, S.S.A.; Sridhar, D. SARS-CoV-2 Variants and Ending the COVID-19 Pandemic. Lancet 2021, 397, 952–954. [Google Scholar] [CrossRef]
- Ritchie, H.; Mathieu, E.; Rodés-Guirao, L.; Appel, C.; Giattino, C.; Ortiz-Ospina, E.; Hasell, J.; Macdonald, B.; Beltekian, D.; Roser, M. Coronavirus Pandemic (COVID-19). Our World Data. 2020. Available online: https://ourworldindata.org/coronavirus (accessed on 28 August 2021).
- Kirby, T. New Variant of SARS-CoV-2 in UK Causes Surge of COVID-19. Lancet Respir. Med. 2021, 9, e20–e21. [Google Scholar] [CrossRef]
- Happi, A.N.; Ugwu, C.A.; Happi, C.T. Tracking the Emergence of New SARS-CoV-2 Variants in South Africa. Nat. Med. 2021, 27, 372–373. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, C.; Bhattacharya, M.; Sharma, A.R.; Lee, S.-S.; Agoramoorthy, G. SARS-CoV-2 Brazil Variants in Latin America: More Serious Research Urgently Needed on Public Health and Vaccine Protection. Ann. Med. Surg. (Lond.) 2021, 66, 102428. [Google Scholar] [CrossRef]
- de Groot, R.J.; Cowley, J.A.; Enjuanes, L.; Faaberg, K.S.; Perlman, S.; Rottier, P.J.M.; Snijder, E.J.; Ziebuhr, J.; Gorbalenya, A.E. Nidovirales. In International Committee on Taxonomy of Viruses 9th Report; Elsevier: Oxford, UK, 2011. [Google Scholar]
- Sun, K.; Gu, L.; Ma, L.; Duan, Y. Atlas of ACE2 Gene Expression Reveals Novel Insights into Transmission of SARS-CoV-2. Heliyon 2021, 7, e05850. [Google Scholar] [CrossRef]
- Li, M.-Y.; Li, L.; Zhang, Y.; Wang, X.-S. Expression of the SARS-CoV-2 Cell Receptor Gene ACE2 in a Wide Variety of Human Tissues. Infect. Dis. Poverty 2020, 9, 45. [Google Scholar] [CrossRef]
- Poudel, U.; Subedi, D.; Pantha, S.; Dhakal, S. Animal Coronaviruses and Coronavirus Disease 2019: Lesson for One Health Approach. Open Vet. J. 2020, 10, 239–251. [Google Scholar] [CrossRef]
- Shi, J.; Wen, Z.; Zhong, G.; Yang, H.; Wang, C.; Huang, B.; Liu, R.; He, X.; Shuai, L.; Sun, Z.; et al. Susceptibility of Ferrets, Cats, Dogs, and Other Domesticated Animals to SARS–Coronavirus 2. Science 2020, 368, 1016–1020. [Google Scholar] [CrossRef] [Green Version]
- McAloose, D.; Laverack, M.; Wang, L.; Killian, M.L.; Caserta, L.C.; Yuan, F.; Mitchell, P.K.; Queen, K.; Mauldin, M.R.; Cronk, B.D.; et al. From People to Panthera: Natural SARS-CoV-2 Infection in Tigers and Lions at the Bronx Zoo. mBio 2020, 11, e02220-20. [Google Scholar] [CrossRef]
- Mohandas, S.; Yadav, P.D.; Shete, A.; Nyayanit, D.; Sapkal, G.; Lole, K.; Gupta, N. SARS-CoV-2 Delta Variant Pathogenesis and Host Response in Syrian Hamsters. Viruses 2021, 13, 1773. [Google Scholar] [CrossRef] [PubMed]
- Mishra, A.; Kumar, N.; Bhatia, S.; Aasdev, A.; Kanniappan, S.; Thayasekhar, A.; Gopinadhan, A.; Silambarasan, R.; Sreekumar, C.; Dubey, C.K.; et al. Natural Infection of SARS-CoV-2 Delta Variant in Asiatic Lions (Panthera Leo Persica) in India. Emerg. Infect. Dis. 2021, in press. [Google Scholar] [CrossRef]
- Stevanovic, V.; Tabain, I.; Vilibic-Cavlek, T.; Mauric Maljkovic, M.; Benvin, I.; Hruskar, Z.; Kovac, S.; Smit, I.; Miletic, G.; Hadina, S.; et al. The Emergence of SARS-CoV-2 within the Dog Population in Croatia: Host Factors and Clinical Outcome. Viruses 2021, 13, 1430. [Google Scholar] [CrossRef]
- Klaus, J.; Zini, E.; Hartmann, K.; Egberink, H.; Kipar, A.; Bergmann, M.; Palizzotto, C.; Zhao, S.; Rossi, F.; Franco, V.; et al. SARS-CoV-2 Infection in Dogs and Cats from Southern Germany and Northern Italy during the First Wave of the COVID-19 Pandemic. Viruses 2021, 13, 1453. [Google Scholar] [CrossRef]
- Barroso-Arévalo, S.; Rivera, B.; Domínguez, L.; Sánchez-Vizcaíno, J.M. First Detection of SARS-CoV-2 B.1.1.7 Variant of Concern in an Asymptomatic Dog in Spain. Viruses 2021, 13, 1379. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Hamer, S.A.; Ghai, R.R.; Zecca, I.B.; Auckland, L.D.; Roundy, C.M.; Davila, E.; Busselman, R.E.; Tang, W.; Pauvolid-Corrêa, A.; Killian, M.L.; et al. SARS-CoV-2 B.1.1.7 Variant of Concern Detected in a Pet Dog and Cat after Exposure to a Person with COVID-19, USA. Transbound. Emerg. Dis. 2021. [Google Scholar] [CrossRef]
- Dimonte, S.; Babakir-Mina, M.; Hama-Soor, T.; Ali, S. Genetic Variation and Evolution of the 2019 Novel Coronavirus. PHG 2021, 24, 54–66. [Google Scholar] [CrossRef]
- Chakraborty, C.; Sharma, A.R.; Bhattacharya, M.; Agoramoorthy, G.; Lee, S.-S. Evolution, Mode of Transmission, and Mutational Landscape of Newly Emerging SARS-CoV-2 Variants. mBio 2021, 12, e0114021. [Google Scholar] [CrossRef]
- Jo, W.K.; Drosten, C.; Drexler, J.F. The Evolutionary Dynamics of Endemic Human Coronaviruses. Virus Evol. 2021, 7. [Google Scholar] [CrossRef] [PubMed]
- Dhama, K.; Patel, S.K.; Sharun, K.; Pathak, M.; Tiwari, R.; Yatoo, M.I.; Malik, Y.S.; Sah, R.; Rabaan, A.A.; Panwar, P.K.; et al. SARS-CoV-2 Jumping the Species Barrier: Zoonotic Lessons from SARS, MERS and Recent Advances to Combat This Pandemic Virus. Travel Med. Infect. Dis. 2020, 37, 101830. [Google Scholar] [CrossRef] [PubMed]
- Xia, X. Domains and Functions of Spike Protein in SARS-CoV-2 in the Context of Vaccine Design. Viruses 2021, 13, 109. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Yang, C.; Xu, X.; Xu, W.; Liu, S. Structural and Functional Properties of SARS-CoV-2 Spike Protein: Potential Antivirus Drug Development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
- Broer, R.; Boson, B.; Spaan, W.; Cosset, F.-L.; Corver, J. Important Role for the Transmembrane Domain of Severe Acute Respiratory Syndrome Coronavirus Spike Protein during Entry. J. Virol. 2006, 80, 1302–1310. [Google Scholar] [CrossRef] [Green Version]


| Primer Name | Primer Sequence |
|---|---|
| 2019-nCoV_N1-F | GACCCCAAAATCAGCGAAAT |
| 2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG |
| 2019-nCoV_N1-P | FAM-ACCCCGCATTACGTTTGGTGGACC-IBFQ |
| ORF | NT Position | AA Position | AA Change | Identified In |
|---|---|---|---|---|
| 1ab | 6754 | 2153 | T > I | Never |
| 1ab | 7145 | |||
| 1ab | 7151 | |||
| 1ab | 10,733 | |||
| S | 23,309 | |||
| S | 25,272 | 1227 | M > L | Never |
| M | 26,895 | |||
| N | 29,127 | 279 | P > Q | Alpha lineage |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Doerksen, T.; Lu, A.; Noll, L.; Almes, K.; Bai, J.; Upchurch, D.; Palinski, R. Near-Complete Genome of SARS-CoV-2 Delta (AY.3) Variant Identified in a Dog in Kansas, USA. Viruses 2021, 13, 2104. https://doi.org/10.3390/v13102104
Doerksen T, Lu A, Noll L, Almes K, Bai J, Upchurch D, Palinski R. Near-Complete Genome of SARS-CoV-2 Delta (AY.3) Variant Identified in a Dog in Kansas, USA. Viruses. 2021; 13(10):2104. https://doi.org/10.3390/v13102104
Chicago/Turabian StyleDoerksen, Tyler, Andrea Lu, Lance Noll, Kelli Almes, Jianfa Bai, David Upchurch, and Rachel Palinski. 2021. "Near-Complete Genome of SARS-CoV-2 Delta (AY.3) Variant Identified in a Dog in Kansas, USA" Viruses 13, no. 10: 2104. https://doi.org/10.3390/v13102104
APA StyleDoerksen, T., Lu, A., Noll, L., Almes, K., Bai, J., Upchurch, D., & Palinski, R. (2021). Near-Complete Genome of SARS-CoV-2 Delta (AY.3) Variant Identified in a Dog in Kansas, USA. Viruses, 13(10), 2104. https://doi.org/10.3390/v13102104

