First Report of Fusarium vanettenii Causing Fusarium Root Rot in Fatsia japonica in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Identification of Etiological Agents
2.2. Morphological Identification
2.3. DNA Extraction, PCR Amplification, and Sequencing
2.4. Phylogenetic Analysis
2.5. Pathogenicity Tests
3. Results
3.1. Natural Symptoms
3.2. Morphological Identificiation of the Isolates
3.3. Molecular Characterization
3.4. Pathogenicity Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Luo, W. Shade-tolerant Foliage Plants—Octocotyledon. Gardening 1997, 5, 15. [Google Scholar]
- Fan, L. High-quality greening ornamental plants. Octagonal gold plate. Agric. Sci. Technol. Newsl. 2004, 8, 24–25. [Google Scholar]
- Liu, J.; Cao, D. Practical application of ground cover plants in landscape greening. South. Agric. Hortic. Floric. 2010, 4, 33–34. [Google Scholar]
- Du, R.; Zhu, L.; Zhou, Y.; Li, F. Application analysis of landscape plant resources in horticulture in Guiyang city. South. Hortic. 2013, 5, 42–44. [Google Scholar]
- Qiu, S.; Chen, J.; Zhang, X.; Qiu, W.; Hu, Z. Uses and propagation technology of anise goldpan. Mod. Agric. Sci. Technol. 2014, 11, 173. [Google Scholar]
- Lu, Z. Clinical experience in the treatment of liver cancer with octagonal gold plate. J. Zhejiang Coll. Tradit. Chin. Med. 1995, 2, 13. [Google Scholar]
- Ma, J. Treatment of 178 cases of esophageal cardia cancer by Compound Anise Jinpan Tang. Liaoning J. Tradit. Chin. Med. 1985, 8, 23. [Google Scholar]
- Rabodonirina, M.; Piens, M.A.; Monier, M.F.; Guého, E.; Fière, D.; Mojon, M. Fusarium infections in immunocompromised patients: Case reports and literature review. Eur. J. Clin. Microbiol. Infect. Dis. 1994, 13, 152–161. [Google Scholar] [CrossRef]
- Vismer, H.F.; Marasas, W.F.O.; Rheeder, J.P.; Joubert, J.J. Fusarium dimerum as a cause of human eye infections. Med. Mycol. 2002, 40, 399–406. [Google Scholar] [CrossRef]
- Dean, R.; Van Kan, J.A.; Pretorius, Z.A. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- O’donnell, K.; Ward, T.J.; Robert, V.A.R.G.; Crous, P.W.; Geiser, D.M.; Kang, S. DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 2015, 43, 583–595. [Google Scholar] [CrossRef]
- Qiu, J.; Lu, Y.; He, D.; Lee, Y.W.; Ji, F.; Xu, J.; Shi, J. Fusarium fujikuroi species complex associated with rice, maize, and soybean from Jiangsu province, China: Phylogenetic, pathogenic, and toxigenic analysis. Plant Dis. 2020, 104, 2193–2201. [Google Scholar] [CrossRef]
- Gams, W.; Nirenberg, H.I.; Seifert, K.A.; Brayford, D.; Thrane, U. Proposal to conserve the name Fusarium sambucinum (Hyphomycetes). Taxon 1997, 46, 111–113. [Google Scholar] [CrossRef]
- Snyder, W.C.; Hansen, H.N. The species concept in Fusarium. Am. J. Bot. 1940, 27, 64–67. [Google Scholar] [CrossRef]
- Gerlach, W.; Nirenberg, H.I. The genus Fusarium: A pictorial atlas. Mitteilungen aus der Biologischen Bundesanstalt fuer Land und Forstwirtschaft. Berl. Dahl. 1982, 209, 1–406. [Google Scholar] [CrossRef]
- Link, J.H.F. Observationes in ordines plantarum naturales. Dissertatio Ima. Ges. Naturforschender Freunde Zu Berlin. Magazin. 1809, 3, 3–42. [Google Scholar]
- Kelly, A.; Proctor, R.H.; Belzile, F.; Chulze, S.N.; Clear, R.M.; Cowger, C.; Elmer, W.; Lee, T.; Obanor, F.; Waalwijk, C.; et al. The geographic distribution and complex evolutionary history of the NX-2 trichothecene chemotype from Fusarium graminearum. Fungal Genet. Biol. 2016, 95, 39–48. [Google Scholar] [CrossRef]
- Cui, W.L.; Bian, J.Y.; Li, D.W.; Wang, J.W.; Huang, L. First report of leaf blight on Chinese fir (Cunninghamia lanceolata) caused by Bipolaris setariae in China. Plant Dis. 2020, 104, 2523. [Google Scholar] [CrossRef]
- Chung, P.C.; Wu, H.Y.; Wang, Y.W.; Ariyawansa, H.A.; Hu, H.P.; Hung, T.H.; Tzean, S.S.; Chung, C.L. Diversity and pathogenicity of Colletotrichum species causing strawberry anthracnose in Taiwan and description of a new species, Colletotrichum miaoliense sp. nov. Sci. Rep. 2020, 10, 146. [Google Scholar] [CrossRef]
- Geiser, D.M.; Aoki, T.; Bacon, C.W. One fungus, one name: Defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology 2013, 103, 400–408. [Google Scholar] [CrossRef]
- Lombard, L.; van der Merwe, N.A.; Groenewald, J.Z.; Crous, P.W. Generic concepts in Nectriaceae. Stud. Mycol. 2015, 80, 189–245. [Google Scholar] [CrossRef]
- Crous, P.W.; Lombard, L.; Sandoval-Denis, M. Fusarium: More than a node or a foot-shaped basal cell. Stud. Mycol. 2021, 98, 100116. [Google Scholar] [CrossRef]
- O’Donnell, K.; Whitaker, B.K.; Laraba, I.; Proctor, R.H.; Brown, D.W.; Broders, K.; Kim, H.S.; McCormick, S.P.; Busman, M.; Aoki, T.; et al. DNA sequence-based identification of Fusarium: A work in progress. Plant Dis. 2022, 106, 1597–1609. [Google Scholar] [CrossRef]
- Hong, J.P.; Guo, M.X.; He, Y.C. A newly recorded species of Fusarium in China. J. Fungal Res. 2007, 5, 129–130, 133. [Google Scholar]
- Sampietro, D.A.; Marín, P.; Iglesias, J. A molecular based strategy for rapid diagnosis of toxigenic Fusarium species associated to cereal grains from Argentina. Fungal Biol. 2010, 114, 74–81. [Google Scholar] [CrossRef]
- Yli-Mattila, T.; Paavanen-Huhtala, S.; Bulat, S.A.; Alekhina, I.A.; Nirenberg, H.I. Molecular, morphological and phylogenetic analysis of the Fusarium avenaceum/F. arthrosporioides/F. tricinctum species complex—A polyphasic approach. Mycol. Res. 2002, 106, 655–669. [Google Scholar] [CrossRef]
- Damm, U.; Mostert, L.; Crous, P.W.; Fourie, P.H. Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia 2008, 20, 87–102. [Google Scholar] [CrossRef]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef]
- O’Donnell, K.; Nirenberg, H.I.; Aoki, T.; Cigelnik, E. A multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species. Mycoscience 2000, 41, 61–78. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/ nt. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Zhang, D.; Gao, F.; Jakovli’c, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Xu, T.; Xu, X.; Dai, T.; Liu, T. The New Report of Root Rot on Fatsia japonica Caused by Phytophthora nicotianae in China. Forests 2023, 14, 1459. [Google Scholar] [CrossRef]
- Ho, H.H. The taxonomy and biology of Phytophthora and Pythium. J. Bacteriol. Mycol. 2018, 6, 40–45. [Google Scholar] [CrossRef]
- Wang, G.L. Study on Scab-anthranoge of Fatsia japonica. J. Zhejiang For. Sci. Technol. 2007, 27, 64–67. Available online: https://kns.cnki.net/kcms/detail/detail.aspx?FileName=ZJLK200705016&DbName=CJFQ2007 (accessed on 15 May 2023).
- Shi, N.N.; Du, Y.X.; Chen, F.R.; Ruan, H.C.; Yang, X.J. First report of leaf spot caused by Colletotrichum fructicola on Japanese Fatsia (Fatsia japonica) in Fujian Province in China. Plant Dis. 2017, 101, 1552. [Google Scholar] [CrossRef]
- Li, Y.L.; Wang, S.B.; Wang, Y.H.; Lin, Q.K.; Zhou, Z. First Report of Botryosphaeria dothidea Causing a Leaf Wilt on Fatsia japonica in Henan Province, China. Plant Dis. 2018, 102, 450. [Google Scholar] [CrossRef]
- Mehrabi-Koushki, M.; Artand, S.; Ahmadpour, S.A. Botryosphaeria dothidea causes stem canker on Fatsia japonica in Iran. Australas. Plant Dis. Notes 2021, 16, 31. [Google Scholar] [CrossRef]
- Garibaldi, A.; Gilardi, G.; Gullino, M.L. First Report of Alternaria Leaf Blight of Aralia japonica Caused by Alternaria panax in Europe. Plant Dis. 2004, 88, 82. [Google Scholar] [CrossRef]
- Deng, J.X.; Paul, N.C.; Park, M.S.; Yu, S.H. Molecular characterization, morphology, and pathogenicity of Alternaria panax from araliaceous plants in Korea. Mycol. Prog. 2013, 12, 383–396. [Google Scholar] [CrossRef]
- Porter, L.; Pasche, J.; Chen, W.; Harveson, R. Isolation, identification, storage, pathogenicity tests, hosts, and geographic range of Fusarium solani f. sp. pisi causing Fusarium root rot of Pea. Plant Health Prog. 2015, 16, 136–145. [Google Scholar] [CrossRef]
- Rubin, D.; Deeba, K.; Bishnu, B.M. First report of root rot disease on Solanum lycopersicum L. caused by Fusarium vanettenii in India. J. Phytopathol. 2021, 169, 752–756. [Google Scholar]




| Locus | Primer | Sequence (5′-3′) | PCR Conditions | Reference |
|---|---|---|---|---|
| The internal Transcribed Spacer (ITS) | ITS1 | TCCGTAGGTGAACCTGCGG | 94 °C, 3 min; (94 °C, 30 s, 55 °C, 30 s; 72 °C, 30 s) × 35; 72 °C, 10 min | [30] |
| ITS4 | TCCTCCGCTTATTGATATGC | |||
| Elongation factor 1-alpha (TEF1) | EF-1 | ATGGGTAAGGA(A/G)GACAAGAC | 94 °C, 3 min; (94 °C, 30 s, 63 °C, 30 s; 72 °C, 45 s) × 35; 72 °C, 10 min | [28,29] |
| EF-1H | GTGGGGCATTTACCCCGCC | |||
| RNA polymerase II genes (RPB2) | RPB2-5F2 | TTGCTATCGACAAAGAGATCC | 94 °C, 3 min; (94 °C, 30 s, 57 °C, 30 s; 72 °C, 1 min) × 35; 72 °C, 10 min | [31] |
| fRPB2-7cR | ATATAAGACGCGAACCCTTTT |
| Isolate | DNA Target | GenBank Accession No. | Blast Match Sequence | |
|---|---|---|---|---|
| Reference Accession No. | Sequence Identity (%) | |||
| BJ4-1 | ITS | PP059592 | Fusarium sp. JCM 28442 (LC133858.1) | 100% (590/590) |
| RPB2 | PP066262 | F. vanettenii F330 (OR371940.1) | 100% (915/915) | |
| TEF1 | PP140664 | F. vanettenii F330 (OQ511144.1) | 99.43% (700/704) | |
| BJ5-2 | ITS | PP060633 | Fusarium sp. JCM 28442 (LC133858.1) | 100% (590/590) |
| RPB2 | PP066263 | F. vanettenii F274 (OR371921.1) | 100% (913/913) | |
| TEF1 | PP145300 | F. vanettenii F310 (OQ511138.1) | 99.29% (716/737) | |
| BJ5-6 | ITS | PP060634 | Fusarium sp. JCM 28442 (LC133858.1) | 100% (590/590) |
| RPB2 | PP078612 | F. vanettenii F127 (OR371880.1) | 99.89% (915/916) | |
| TEF1 | PP145301 | F. vanettenii 840047 (AB513842.1) | 99.72% (733/935) | |
| Species | Voucher | GenBank Accession Numbers | ||
|---|---|---|---|---|
| ITS | RPB2 | TEF1 | ||
| Fusarium vanettenii | NRRL 22820 | DQ094310 | EU329532 | AF178355 |
| Fusarium vanettenii | CBS 123669 | KM231796 | KM232215 | KM231925 |
| Fusarium breve | NRRL 28009 | DQ094351 | EF470135 | DQ246869 |
| Fusarium breve | NRRL 32792 | DQ094561 | EU329621 | DQ247101 |
| Fusarium borneense | NRRL 22579 | NR169885 | EU329515 | AF178352 |
| Fusarium bataticola | NRRL 22402 | OR519899 | MW218100 | DQ247681 |
| Fusarium crassum | NRRL 46703 | EU329712 | EU329661 | HM347126 |
| Fusarium cucurbiticola | NRRL 22153 | DQ094302 | EU329492 | DQ236344 |
| Fusarium cicatricum | CBS 125552 | MH863560 | HQ728145 | HM626644 |
| Fusarium ferrugineum | NRRL 32437 | DQ094446 | EU329581 | DQ246979 |
| Fusarium helgardnirenbergiae | NRRL 22387 | NR169883 | EU329505 | AF178339 |
| Fusarium illudens | NRRL 22090 | JX171601 | EU329488 | KZ303538 |
| Fusarium liriodendri | NRRL 22389 | DQ094314 | EU329506 | OP920672 |
| Fusarium mori | NRRL 22230 | DQ094305 | EU329499 | AB674290 |
| Fusarium parceramosum | CBS 115695 | OP782205 | JX435249 | JX435149 |
| Fusarium piperis | NRRL 22570 | NR169886 | EU329513 | AF178360 |
| Fusarium pseudoradicicola | NRRL 25137 | JF740899 | JF741084 | JF740757 |
| Fusarium protoensiforme | NRRL 22178 | AF178399 | EU329498 | DQ094313 |
| Fusarium staphyleae | NRRL 22316 | MH582406 | EU329502 | AF178361 |
| Fusarium solani | NRRL 25388 | MH582401 | EU329535 | DQ246858 |
| Fusarium solani | MRC 2565 | MH582400 | MH582226 | MH582420 |
| Fusarium virguliforme | NRRL 31041 | MN310695 | JX171643 | HM453369 |
| Fusarium venezuelense | NRRL 22395 | NR172367 | EU329507 | AF178341 |
| Fusarium waltergamsii | NRRL 32323 | DQ094420 | EU329576 | DQ246951 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.; Dai, T.; Wu, C. First Report of Fusarium vanettenii Causing Fusarium Root Rot in Fatsia japonica in China. Forests 2024, 15, 805. https://doi.org/10.3390/f15050805
Xu X, Dai T, Wu C. First Report of Fusarium vanettenii Causing Fusarium Root Rot in Fatsia japonica in China. Forests. 2024; 15(5):805. https://doi.org/10.3390/f15050805
Chicago/Turabian StyleXu, Xiaoqiao, Tingting Dai, and Cuiping Wu. 2024. "First Report of Fusarium vanettenii Causing Fusarium Root Rot in Fatsia japonica in China" Forests 15, no. 5: 805. https://doi.org/10.3390/f15050805
APA StyleXu, X., Dai, T., & Wu, C. (2024). First Report of Fusarium vanettenii Causing Fusarium Root Rot in Fatsia japonica in China. Forests, 15(5), 805. https://doi.org/10.3390/f15050805

