Transcriptome Sequencing Analysis of Birch (Betula platyphylla Sukaczev) under Low-Temperature Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant-Material Treatment and RNA Isolation
2.2. Transcriptome Analysis
2.3. Quantitative RT-PCR Analysis
3. Results
3.1. Statistics of Transcriptome Sequencing Data
3.2. Analysis of Differentially Expressed Genes (DEGs)
3.3. Gene Ontology (GO) and KEGG Enrichment of the DEGs
3.4. Analysis of DEGs Related to Calcium Signal Transduction Pathway
3.5. Analysis of Hormone and Signal Transduction Pathways-Related DEGs
3.6. Identification of DEGs Related to Starch and Sucrose Metabolic Pathways
3.7. Identification of DEGs Related to Lipid Metabolism
3.8. Identification of DEGs Related to Amino Acid Biosynthetic Pathway
3.9. Identification of DEGs Related to Photosynthesis
3.10. Transcription Factors Involved in Low-Temperature Response
3.11. Validation of RNA-Seq Based DEGs Results by qRT-PCR
4. Discussion
4.1. Ca2+ Signal Transduction under Low Temperature
4.2. Plant Hormone-Dependent Pathways under Low Temperature
4.3. Low-Temperature Stress Signal Induces Cell Protection Process
4.4. Transcription Factors Involved in Response to Cold Stress
4.5. Effects of Low-Temperature Stress on Photosynthesis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
Gene | Primer | Primer Sequence |
---|---|---|
18S RNA | 18S-R | GCAGGTTAGCGAAATGCGATAC |
18S RNA | 18S-F | GAGGTAGCTTCGGGCGCAACT |
Bpev01.c1851.g0002 | BP001R | CGAAGGTTGTTCCTATTGGAGGT |
Bpev01.c1851.g0002 | BP001F | CATCTCCAATCTCAACCTCTGTTCC |
Bpev01.c1851.g0001 | BP002R | CAGCTTCTTGTTGAGCCAATCTC |
Bpev01.c1851.g0001 | BP002F | GCGGTCTCTTCCCTTGCTTAAATG |
Bpev01.c1189.g0015 | BP003R | GAGATCCTGTTGCCTTCCAGTAC |
Bpev01.c1189.g0015 | BP003F | AGCTTGATGGGAAGAGACCAG |
Bpev01.c1161.g0015 | BP004R | GTCGGTCGATTGCGAGGTTG |
Bpev01.c1161.g0015 | BP004F | GACCTCTGCATCCCACTCTG |
Bpev01.c1161.g0014 | BP005R | GTCGGTCGATTGCGAGGTTG |
Bpev01.c1161.g0014 | BP005F | GACCTCTGCATCCCACTCTCTG |
Bpev01.c0455.g0003 | BP006R | GCTGCCATGCTTCCTGTCTC |
Bpev01.c0455.g0003 | BP006F | ACTTCCGGGATTTCGTTTCCAC |
Bpev01.c0390.g0007 | BP007R | CTTTCCAATGGGCTTGTCCG |
Bpev01.c0390.g0007 | BP007F | CGGACGAGGAGTTGGTGAATC |
Bpev01.c0357.g0068 | BP008R | GCTTTCCAATACCCAGACACCG |
Bpev01.c0357.g0068 | BP008F | TCGATTCCACCCAACTGATGAG |
Bpev01.c0210.g0037 | BP009R | CCATTCGGGTACTTCCGGTC |
Bpev01.c0210.g0037 | BP009F | CCTGTGTTGTCGTTGGCTTC |
Bpev01.c0162.g0012 | BP010R | GTCTAGCTCCGTTCGGGTAC |
Bpev01.c0162.g0012 | BP010F | ACTTATCCACCGGCTTGAACC |
Bpev01.c0073.g0013 | BP011R | CTCTGAATATCCTTCGCCGTCCC |
Bpev01.c0073.g0013 | BP011F | CCGGGAGGACGAAGTTCAAG |
Bpev01.c0001.g0070 | BP012R | CAAGGCCAAAGATGCTTCAAGACAC |
Bpev01.c0001.g0070 | BP012F | TACTTGTCTCAAGATGCTCCTCTG |
Bpev01.c0001.g0069 | BP013R | CCTTGGTCGCCCTGTTAGTC |
Bpev01.c0001.g0069 | BP013F | GCAGGACAGGAGTGGGATAC |
Bpev01.c0000.g0209 | BP014R | GTTGCTGTTGGAGTTGAATTTCGG |
Bpev01.c0000.g0209 | BP014F | CCTTTGCATCTTACCCTTCTTGCTC |
Sample | Raw Date | Clean Date | Base Number | Q20% | Q30% | GC Content 1 | Mapped Ratio |
---|---|---|---|---|---|---|---|
CK_rep1 | 25,672,243 | 25,670,448 | 7.68 Gb | 97.63% | 93.76% | 47.07% | 96.07% |
CK_rep2 | 28,604,148 | 28,602,122 | 8.56 Gb | 97.69% | 93.93% | 47.16% | 96.34% |
1h_rep1 | 28,418,115 | 22,838,434 | 6.83 Gb | 97.77% | 94.08% | 47.14% | 96.64% |
1h_rep2 | 27,638,049 | 27,255,820 | 8.16 Gb | 97.56% | 93.60% | 46.90% | 96.52% |
1.5h_rep1 | 22,409,000 | 23,396,121 | 7.00 Gb | 97.68% | 93.92% | 47.33% | 96.42% |
1.5h_rep2 | 23,397,739 | 23,729,617 | 7.10 Gb | 97.58% | 93.71% | 47.05% | 96.43% |
1.5h_rep3 | 23,731,305 | 24,169,972 | 7.23 Gb | 97.64% | 93.82% | 46.63% | 96.46% |
2h_rep1 | 24,171,686 | 22,157,427 | 6.63 Gb | 97.58% | 93.67% | 47.48% | 96.16% |
2h_rep2 | 22,840,004 | 23,331,820 | 6.98 Gb | 97.65% | 93.85% | 47.10% | 96.29% |
2.5h_rep1 | 27,257,640 | 24,693,732 | 7.39 Gb | 97.56% | 93.63% | 47.09% | 96.30% |
2.5h_rep2 | 24,695,387 | 24,822,662 | 7.43 Gb | 97.76% | 94.02% | 48.47% | 96.33% |
3h_rep1 | 24,824,310 | 28,740,756 | 8.60 Gb | 97.67% | 93.85% | 47.46% | 96.24% |
3h_rep2 | 22,158,962 | 27,162,399 | 8.13 Gb | 97.90% | 94.35% | 47.73% | 96.47% |
Average | 25,062,968 | 25,120,872 | 7.52 Gb | 97.50% | 93.60% | 47.28% | 96.36% |
Items | ID | DEGs | All | p-Value |
---|---|---|---|---|
Metabolic pathways | ko01100 | 349 | 2246 | 6.39 × 10−26 |
Biosynthesis of secondary metabolites | ko01110 | 210 | 1107 | 1.87 × 10−24 |
Ribosome | ko03010 | 76 | 364 | 2.58 × 10−11 |
Biosynthesis of amino acids | ko01230 | 46 | 251 | 4.57 × 10−6 |
Carbon metabolism | ko01200 | 43 | 273 | 0.0002 |
Phenylpropanoid biosynthesis | ko00940 | 41 | 166 | 1.89 × 10−8 |
Plant hormone signal transduction | ko04075 | 39 | 273 | 0.00195 |
Plant-pathogen interaction | ko04626 | 30 | 170 | 0.00034 |
Starch and sucrose metabolism | ko00500 | 30 | 165 | 0.000218 |
Cysteine and methionine metabolism | ko00270 | 23 | 121 | 0.00066 |
Glycolysis/gluconeogenesis | ko00010 | 23 | 116 | 0.000396 |
MAPK signaling pathway-plant | ko04016 | 21 | 134 | 0.00812 |
Amino sugar and nucleotide sugar metabolism | ko00520 | 18 | 131 | 0.0382 |
Pyruvate metabolism | ko00620 | 18 | 86 | 0.000949 |
Fatty acid metabolism | ko01212 | 18 | 69 | 9.62 × 10−5 |
Purine metabolism | ko00230 | 17 | 100 | 0.00828 |
DNA replication | ko03030 | 14 | 50 | 0.000304 |
Valine, leucine, and isoleucine degradation | ko00280 | 13 | 51 | 0.00104 |
beta-Alanine metabolism | ko00410 | 13 | 50 | 0.000887 |
Flavonoid biosynthesis | ko00941 | 13 | 22 | 9.57 × 10−7 |
Fructose and mannose metabolism | ko00051 | 12 | 64 | 0.0131 |
Glycerolipid metabolism | ko00561 | 12 | 60 | 0.00858 |
Fatty acid biosynthesis | ko00061 | 12 | 43 | 0.000823 |
Carbon fixation in photosynthetic organisms | ko00710 | 11 | 69 | 0.0426 |
Phenylalanine metabolism | ko00360 | 11 | 32 | 0.000316 |
Phenylalanine, tyrosine and tryptophan biosynthesis | ko00400 | 10 | 56 | 0.0289 |
Fatty acid degradation | ko00071 | 10 | 47 | 0.0111 |
Propanoate metabolism | ko00640 | 10 | 43 | 0.0066 |
Tyrosine metabolism | ko00350 | 9 | 40 | 0.0116 |
Pantothenate and CoA biosynthesis | ko00770 | 9 | 28 | 0.00161 |
alpha-Linolenic acid metabolism | ko00592 | 8 | 44 | 0.0442 |
Carotenoid biosynthesis | ko00906 | 8 | 29 | 0.00627 |
Sphingolipid metabolism | ko00600 | 8 | 27 | 0.00439 |
Fatty acid elongation | ko00062 | 7 | 35 | 0.0398 |
Lysine degradation | ko00310 | 7 | 34 | 0.0355 |
Biotin metabolism | ko00780 | 7 | 16 | 0.0013 |
ABC transporters | ko02010 | 6 | 26 | 0.0332 |
Butanoate metabolism | ko00650 | 6 | 19 | 0.0103 |
Lysine biosynthesis | ko00300 | 6 | 15 | 0.0041 |
Other glycan degradation | ko00511 | 5 | 19 | 0.0334 |
Riboflavin metabolism | ko00740 | 5 | 18 | 0.0282 |
Biosynthesis of secondary metabolites-unclassified | ko00999 | 5 | 12 | 0.00762 |
Monobactam biosynthesis | ko00261 | 4 | 14 | 0.0449 |
Glycosphingolipid biosynthesis-globo and isoglobo series | ko00603 | 4 | 9 | 0.0143 |
Monoterpenoid biosynthesis | ko00902 | 4 | 8 | 0.0105 |
Stilbenoid, diarylheptanoid, and gingerol biosynthesis | ko00945 | 4 | 7 | 0.00746 |
Gene_ID | Time | logFC | Function |
---|---|---|---|
Bpev01.c0480.g0081 | 2 h | 4.57 | Calmodulin-like, CML38 |
Bpev01.c1074.g0005 | 2.5 h | 4.66 | Calmodulin-like, CML25 |
Bpev01.c1074.g0006 | 3 h | 4.48 | Calcium-binding EF-hand family protein |
Bpev01.c1074.g0007 | 2.5 h | 3.94 | Calcium-binding EF-hand family protein |
Bpev01.c0147.g0007 | 1 h | 3.4 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c0274.g0041 | 1 h | 3.6 | Calcium-binding EF-hand family protein |
Bpev01.c0445.g0003 | 1 h | 2.48 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c0420.g0021 | 1 h | 2.43 | Calmodulin binding protein-like |
Bpev01.c0027.g0187 | 2.5 h | 2.94 | Ca2+-dependent modulator of ICR1, CMI1 |
Bpev01.c0088.g0124 | 1 h | 3.79 | Ca2+-dependent modulator of ICR1, CMI1 |
Bpev01.c2029.g0005 | 1 h | 3.38 | Calmodulin binding protein-like |
Bpev01.c0180.g0001 | 1 h | 3.08 | Ca2+-dependent modulator of ICR1, CMI1 |
Bpev01.c0281.g0075 | 2.5 h | 2.7 | Calmodulin-like, CML30 |
Bpev01.c0011.g0001 | 1 h | 2.52 | EF hand calcium-binding protein family |
Bpev01.c0328.g0033 | 1 h | 2.05 | Calmodulin-like, CML46 |
Bpev01.c0821.g0019 | 1 h | 1.96 | IQ calmodulin-binding motif family protein |
Bpev01.c0145.g0021 | 1 h | 1.91 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c0088.g0130 | 1 h | 2.96 | Calmodulin-like, CML30 |
Bpev01.c2409.g0002 | 1 h | 1.68 | Calcium-dependent protein kinase 1 |
Bpev01.c0511.g0002 | 1 h | 1.56 | CBL-interacting protein kinase 5 |
Bpev01.c0022.g0034 | 1 h | 1.54 | Calcium-dependent protein kinase 28 |
Bpev01.c1700.g0004 | 1 h | 2.06 | Calcium-dependent protein kinase family protein |
Bpev01.c0159.g0009 | 1 h | 1.44 | Copine (calcium-dependent phospholipid-binding protein) family |
Bpev01.c0324.g0014 | 3 h | 1.49 | CBL-interacting protein kinase 7 |
Bpev01.c1519.g0006 | 1 h | 1.4 | Calmodulin binding protein-like |
Bpev01.c0052.g0090 | 1 h | 2.12 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domains |
Bpev01.c0570.g0019 | 1 h | 1.37 | Calmodulin-like, CML30 |
Bpev01.c0318.g0004 | 3 h | 1.36 | Calmodulin-like, CML5 |
Bpev01.c0126.g0019 | 2.5 h | 1.55 | Calmodulin-like, CML5 |
Bpev01.c0029.g0091 | 1 h | 1.35 | Calcium-dependent protein kinase 19 |
Bpev01.c0044.g0059 | 1 h | 1.32 | CBL-interacting protein kinase 25 |
Bpev01.c0147.g0003 | 1 h | 1.9 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c1106.g0007 | 3 h | 1.17 | CBL-interacting protein kinase 20 |
Bpev01.c2470.g0003 | 1 h | 1.17 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c1002.g0005 | 1 h | 1.11 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c0298.g0010 | 3 h | 1.4 | Calcium-dependent lipid-binding (CaLB domain) family protein |
Bpev01.c0763.g0002 | 2.5 h | 1.74 | Calmodulin-like, CML30 |
Bpev01.c0145.g0018 | 2.5 h | 1.97 | Calcium-binding EF-hand family protein |
Bpev01.c0022.g0125 | 1 h | 1.01 | Calcium-dependent phosphotriesterase superfamily protein |
Bpev01.c0036.g0009 | 1 h | 1 | Plant calmodulin-binding protein |
Bpev01.c0135.g0041 | 1 h | −1.1 | Calmodulin-binding protein |
Bpev01.c0523.g0005 | 1 h | −1.1 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein |
Bpev01.c3512.g0001 | 1 h | −1.14 | Calcium-binding EF-hand family protein |
Bpev01.c1359.g0001 | 1 h | −1.38 | Na+/Ca2+ exchanger, NCL |
Bpev01.c2062.g0001 | 1 h | −1.44 | Na+/Ca2+ exchanger, NCL |
Bpev01.c2002.g0003 | 1 h | −1.71 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein |
Bpev01.c1295.g0001 | 1 h | −1.88 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein |
Bpev01.c2062.g0002 | 1 h | −1.94 | Na+/Ca2+ exchanger, NCL |
Bpev01.c0442.g0045 | 1 h | −1.99 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein |
Bpev01.c0127.g0096 | 2.5 h | −3.34 | Calmodulin binding protein |
Gene_ID | Time | logFC | Function |
---|---|---|---|
ABA | |||
Bpev01.c0870.g0008 | 2.5 h | 4.01 | ABA 8′-hydroxylase, polypeptide 1 |
Bpev01.c0352.g0006 | 1 h | 3.75 | Protein phosphatase 2C family protein |
Bpev01.c0294.g0006 | 2.5 h | 3.66 | Nine-cis-epoxycarotenoid dioxygenase 3 |
Bpev01.c0115.g0107 | 1 h | 3.92 | Protein phosphatase 2C family protein |
Bpev01.c0129.g0031 | 2.5 h | 2.04 | Protein phosphatase 2C family protein |
Bpev01.c1183.g0023 | 1 h | 1.9 | Protein phosphatase 2C family protein |
Bpev01.c0455.g0029 | 1 h | 1.81 | Protein phosphatase 2C family protein, PP2CG1 |
Bpev01.c0015.g0093 | 3 h | 1.57 | Protein phosphatase 2C family protein, APD5 |
Bpev01.c0268.g0003 | 1 h | 2.42 | Nine-cis-epoxycarotenoid dioxygenase 4 |
Bpev01.c0279.g0011 | 3 h | 1.26 | Protein phosphatase 2C family protein, AP2C1 |
Bpev01.c0015.g0010 | 1 h | 1.25 | ABA deficient 1, ABA1 |
Bpev01.c0500.g0004 | 1 h | 1.24 | Protein phosphatase 2C family protein |
Bpev01.c0265.g0015 | 1 h | 1.18 | Protein phosphatase 2C family protein, CIPP1 |
Bpev01.c0280.g0015 | 2.5 h | 1.67 | Protein phosphatase 2C family protein |
Bpev01.c1081.g0001 | 1 h | 1.03 | Protein phosphatase 2C family protein |
Bpev01.c0298.g0028 | 1 h | −1.26 | Beta-hydroxylase 1 |
Bpev01.c0142.g0059 | 1 h | −1.4 | Protein phosphatase 2C family protein |
Bpev01.c0467.g0019 | 1 h | −1.61 | Protein phosphatase 2C family protein, PP2C.D3 |
Bpev01.c0328.g0025 | 2.5 h | −2.79 | ABA 8′-hydroxylase, polypeptide 4 |
Bpev01.c1475.g0010 | 3 h | −1.91 | Protein phosphatase 2C family protein, PP2C62 |
Bpev01.c0245.g0042 | 1 h | −1.91 | ABA 8′-hydroxylase, polypeptide 2 |
Bpev01.c0038.g0101 | 1 h | −2.39 | Protein phosphatase 2C family protein |
Bpev01.c1272.g0023 | 2.5 h | −3.53 | ABA deficient 2, ABA2 |
Ethylene | |||
Bpev01.c1161.g0016 | 2.5 h | 5.23 | Ethylene responsive element binding factor 5 |
Bpev01.c1161.g0018 | 2.5 h | 3.67 | Ethylene responsive element binding factor 1 |
Bpev01.c1161.g0014 | 2.5 h | 4.63 | Ethylene responsive element binding factor 5 |
Bpev01.c1161.g0017 | 2.5 h | 3.12 | Ethylene responsive element binding factor 1 |
Bpev01.c1161.g0012 | 2.5 h | 4.68 | Ethylene responsive element binding factor 5 |
Bpev01.c1161.g0013 | 2.5 h | 4.62 | Ethylene responsive element binding factor 5 |
Bpev01.c0764.g0013 | 1 h | 2.86 | Ethylene response factor 1 |
Bpev01.c0343.g0032 | 1 h | 2.78 | Ethylene response factor 1 |
Bpev01.c1851.g0001 | 2.5 h | 3.7 | Ethylene responsive element binding factor 2 |
Bpev01.c1161.g0015 | 2.5 h | 4.43 | Ethylene responsive element binding factor 5 |
Bpev01.c0299.g0032 | 2.5 h | 1.95 | Ethylene-forming enzyme |
Bpev01.c0523.g0001 | 2.5 h | 1.41 | Ethylene-insensitive3-like 3 |
JA | |||
Bpev01.c0052.g0052 | 2.5 h | −2.92 | Jasmonate-zim-domain protein 10, Jaz 10 |
Bpev01.c0136.g0009 | 1 h | −1.62 | N-MYC down-regulated-like 1 |
Bpev01.c0423.g0007 | 1 h | −1.98 | 4-coumarate: CoA ligase 3 |
Bpev01.c0161.g0057 | 2.5 h | −2.5 | Jasmonic acid carboxyl methyltransferase |
GA | |||
Bpev01.c0118.g0033 | 2.5 h | 3.05 | Gibberellin 3-oxidase 1 |
Bpev01.c0094.g0034 | 1 h | −1.09 | Gibberellin-regulated family protein |
Bpev01.c1673.g0004 | 1 h | −1.25 | Gibberellin-regulated family protein |
Bpev01.c0411.g0004 | 1 h | −2.18 | Gibberellin-regulated family protein |
Bpev01.c1170.g0013 | 1 h | −5 | Gibberellin-regulated family protein |
SA | |||
Bpev01.c0343.g0021 | 1 h | 7.67 | Pathogenesis-related gene 1 |
Bpev01.c0154.g0058 | 1 h | 2.58 | Pathogenesis-related thaumatin superfamily protein |
Bpev01.c1477.g0007 | 1 h | 1.97 | Pathogenesis-related family protein |
Bpev01.c0889.g0015 | 1 h | 1.46 | Pathogenesis-related thaumatin superfamily protein |
Bpev01.c0022.g0043 | 1 h | 1.89 | Pathogenesis-related thaumatin superfamily protein |
Bpev01.c0082.g0060 | 1 h | −2.32 | Pathogenesis-related thaumatin superfamily protein |
Bpev01.c1688.g0003 | 1.5 h | −2.26 | Pathogenesis-related family protein |
Bpev01.c1525.g0004 | 2.5 h | −2.88 | Pathogenesis-related thaumatin superfamily protein |
Bpev01.c0889.g0016 | 1 h | −2.42 | Pathogenesis-related thaumatin superfamily protein |
Bpev01.c1688.g0002 | 3 h | −3.46 | Pathogenesis-related family protein |
Bpev01.c0030.g0023 | 1 h | −2.64 | Pathogenesis-related thaumatin superfamily protein |
Gene_ID | Time | logFC | Function |
---|---|---|---|
Bpev01.c0162.g0017 | 1 h | 5.07 | Beta-glucosidase 45 |
Bpev01.c0080.g0100 | 1 h | 4.58 | PfkB-like carbohydrate kinase family protein |
Bpev01.c0283.g0018 | 1 h | 3.15 | Beta-amylase 5 |
Bpev01.c0092.g0014 | 1 h | 2.77 | Beta glucosidase 41 |
Bpev01.c0275.g0002 | 1 h | 2.59 | Sucrose-phosphate synthase family protein |
Bpev01.c1949.g0001 | 1 h | 2.07 | Chloroplast beta-amylase |
Bpev01.c0000.g0208 | 1 h | 1.76 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
Bpev01.c0842.g0013 | 1 h | 1.54 | Trehalose-6-phosphate synthase |
Bpev01.c0053.g0012 | 1 h | 1.42 | Beta glucosidase 11 |
Bpev01.c0016.g0107 | 1 h | 1.58 | Sucrose phosphate synthase 3F |
Bpev01.c0264.g0007 | 1 h | 1.26 | Glycosyl hydrolases family 31 protein |
Bpev01.c1918.g0005 | 1 h | 1.32 | Glycosyl hydrolase family protein |
Bpev01.c2037.g0001 | 3 h | 1.14 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein |
Bpev01.c0294.g0013 | 1 h | 1.19 | Sucrose synthase 3 |
Bpev01.c0478.g0015 | 1 h | 1.01 | Starch branching enzyme 2.2 |
Bpev01.c0727.g0009 | 1 h | −1.24 | Sucrose synthase 6 |
Bpev01.c0762.g0008 | 1 h | −1.29 | PfkB-like carbohydrate kinase family protein |
Bpev01.c0145.g0042 | 1 h | −1.95 | O-Glycosyl hydrolases family 17 protein |
Bpev01.c0051.g0185 | 1 h | −1.51 | Sucrose synthase 4 |
Bpev01.c0127.g0110 | 1 h | −1.53 | Beta-glucosidase 47 |
Bpev01.c2368.g0004 | 1 h | −1.57 | O-Glycosyl hydrolases family 17 protein |
Bpev01.c0141.g0019 | 1 h | −1.58 | Glycosyl hydrolase 9C2 |
Bpev01.c0263.g0003 | 1 h | −2.55 | O-Glycosyl hydrolases family 17 protein |
Bpev01.c0717.g0033 | 1 h | −1.77 | Nudix hydrolase homolog 14 |
Bpev01.c1136.g0002 | 1 h | −1.84 | Glycosyl hydrolase 9B18 |
Bpev01.c0127.g0064 | 1 h | −1.91 | O-Glycosyl hydrolases family 17 protein |
Bpev01.c1526.g0006 | 1 h | −2.06 | Glycosyl hydrolase 9B1 |
Bpev01.c1187.g0006 | 1 h | −2.68 | Glycosyl hydrolases family 32 protein |
Bpev01.c0470.g0030 | 2.5 h | −4.96 | Beta glucosidase 17 |
Gene_ID | 1 h | 1.5 h | 2 h | 2.5 h | 3 h |
---|---|---|---|---|---|
Bpev01.c0552.g0011 | 8.94 | - | - | - | 8.66 |
Bpev01.c0062.g0066 | 5.1 | - | - | - | - |
Bpev01.c0870.g0008 | - | - | - | 4.01 | 3.62 |
Bpev01.c0294.g0006 | - | - | - | 3.66 | 3.02 |
Bpev01.c1114.g0003 | 3.53 | - | - | - | - |
Bpev01.c1092.g0004 | 5.29 | 3.41 | - | 3.17 | 3.55 |
Bpev01.c1153.g0001 | 3.32 | - | - | - | - |
Bpev01.c0118.g0033 | - | - | - | 3.05 | - |
Bpev01.c0517.g0001 | 2.94 | - | - | - | - |
Bpev01.c0574.g0036 | 2.39 | - | - | - | - |
Bpev01.c0094.g0036 | 2.77 | 2.19 | - | - | - |
Bpev01.c1335.g0003 | 2.08 | - | - | - | - |
Bpev01.c0940.g0001 | 3.97 | 1.97 | - | 3.03 | - |
Bpev01.c0364.g0019 | 1.95 | - | - | - | - |
Bpev01.c0050.g0029 | 2.82 | 1.86 | - | 1.83 | - |
Bpev01.c0261.g0045 | 1.83 | - | - | - | - |
Bpev01.c0020.g0005 | 1.72 | - | - | - | - |
Bpev01.c1100.g0005 | - | - | - | 1.69 | - |
Bpev01.c0374.g0017 | 1.64 | - | - | - | - |
Bpev01.c0569.g0008 | 1.53 | - | - | 1.32 | 1.24 |
Bpev01.c0901.g0021 | 1.99 | 1.48 | - | 2.03 | 1.41 |
Bpev01.c0015.g0012 | 1.41 | 1.42 | - | - | - |
Bpev01.c0480.g0025 | 1.4 | - | - | - | - |
Bpev01.c0841.g0011 | 1.34 | - | - | - | - |
Bpev01.c0401.g0013 | 1.33 | - | - | - | - |
Bpev01.c0063.g0018 | 1.29 | - | - | - | - |
Bpev01.c1135.g0005 | 1.26 | - | - | - | - |
Bpev01.c0015.g0010 | 1.25 | - | - | - | - |
Bpev01.c0018.g0112 | 1.22 | - | - | - | - |
Bpev01.c0275.g0035 | 1.81 | 1.21 | - | - | - |
Bpev01.c0473.g0025 | 1.1 | - | - | - | - |
Bpev01.c0190.g0079 | 1.04 | - | - | - | - |
Bpev01.c1060.g0006 | −1 | - | - | - | - |
Bpev01.c0575.g0024 | −1.01 | - | - | - | - |
Bpev01.c0038.g0134 | −1.03 | - | - | - | - |
Bpev01.c1828.g0001 | −1.04 | - | - | - | - |
Bpev01.c0850.g0003 | −2.16 | −1.04 | - | - | - |
Bpev01.c0821.g0002 | −1.04 | - | - | - | - |
Bpev01.c0892.g0002 | −1.06 | - | - | - | - |
Bpev01.c0496.g0022 | −1.08 | - | - | - | - |
Bpev01.c0147.g0001 | −1.96 | −1.09 | - | −2.91 | −2 |
Bpev01.c0052.g0167 | −1.11 | - | - | - | - |
Bpev01.c0717.g0003 | −1.19 | −1.11 | - | - | - |
Bpev01.c0425.g0035 | −1.19 | −1.16 | - | −1.55 | - |
Bpev01.c0038.g0045 | −1.43 | −1.17 | - | - | - |
Bpev01.c0854.g0013 | −1.22 | - | - | - | - |
Bpev01.c0555.g0007 | −1.25 | - | - | - | - |
Bpev01.c0166.g0013 | −1.26 | - | - | - | - |
Bpev01.c0298.g0028 | −1.26 | - | - | - | - |
Bpev01.c0027.g0082 | −1.26 | - | - | - | - |
Bpev01.c2636.g0002 | −1.29 | - | - | - | - |
Bpev01.c0652.g0023 | −1.31 | - | - | - | - |
Bpev01.c0449.g0049 | −1.33 | - | - | - | - |
Bpev01.c1534.g0010 | −2.15 | −1.34 | - | - | −1.38 |
Bpev01.c1475.g0006 | −2.23 | −1.36 | - | - | - |
Bpev01.c0045.g0058 | −1.37 | - | - | - | - |
Bpev01.c1170.g0009 | −1.39 | - | - | - | - |
Bpev01.c0506.g0024 | −2.39 | −1.43 | - | - | - |
Bpev01.c1484.g0012 | - | −1.44 | - | - | - |
Bpev01.c0645.g0001 | −1.44 | - | - | - | - |
Bpev01.c0275.g0066 | −1.44 | - | - | - | - |
Bpev01.c0842.g0018 | −1.5 | - | - | - | - |
Bpev01.c0163.g0009 | −1.78 | −1.52 | - | −1.43 | - |
Bpev01.c0052.g0192 | −1.53 | - | - | - | - |
Bpev01.c0531.g0014 | −1.54 | - | - | - | - |
Bpev01.c1714.g0001 | −1.54 | - | - | - | - |
Bpev01.c0327.g0073 | −1.55 | - | - | - | - |
Bpev01.c1382.g0026 | −1.58 | - | - | - | - |
Bpev01.c1080.g0002 | −1.52 | −1.58 | - | −1.79 | - |
Bpev01.c0458.g0015 | −2.9 | −1.6 | - | - | - |
Bpev01.c0190.g0038 | −1.6 | - | - | - | - |
Bpev01.c0114.g0058 | −2.25 | −1.64 | - | −1.76 | - |
Bpev01.c0052.g0046 | −1.67 | - | - | - | - |
Bpev01.c0213.g0061 | - | −1.67 | - | - | - |
Bpev01.c1044.g0004 | −1.68 | - | - | - | - |
Bpev01.c0135.g0028 | −1.69 | - | - | - | - |
Bpev01.c1627.g0007 | −2.7 | −1.73 | - | −3.79 | - |
Bpev01.c0052.g0017 | −1.78 | - | - | - | - |
Bpev01.c0237.g0054 | −1.8 | - | - | - | - |
Bpev01.c0169.g0048 | −2.9 | −1.81 | - | - | - |
Bpev01.c1414.g0002 | −2.4 | −1.82 | - | - | - |
Bpev01.c1006.g0017 | −1.88 | - | - | - | - |
Bpev01.c0473.g0007 | −1.9 | - | - | - | - |
Bpev01.c0245.g0042 | −1.91 | - | - | - | - |
Bpev01.c0253.g0008 | −1.95 | - | - | - | - |
Bpev01.c0027.g0080 | −2.11 | - | - | - | - |
Bpev01.c0053.g0009 | −2.12 | - | - | - | - |
Bpev01.c1312.g0005 | −2.53 | −2.15 | - | - | - |
Bpev01.c0523.g0003 | −2.2 | - | - | - | - |
Bpev01.c2716.g0001 | −2.28 | - | - | −3.31 | - |
Bpev01.c0000.g0055 | −2.49 | −2.28 | - | −2.21 | −1.75 |
Bpev01.c0457.g0037 | −2.3 | - | - | - | - |
Bpev01.c0680.g0004 | −2.33 | - | - | - | - |
Bpev01.c0224.g0002 | −2.49 | - | - | - | −1.19 |
Bpev01.c0161.g0057 | - | - | - | −2.5 | - |
Bpev01.c0038.g0153 | −2.26 | −2.56 | - | - | - |
Bpev01.c1529.g0009 | −2.64 | - | - | - | - |
Bpev01.c1272.g0023 | −2.8 | - | - | −3.53 | - |
Bpev01.c0275.g0067 | −2.82 | - | - | - | - |
Bpev01.c1836.g0006 | −2.87 | - | - | - | - |
Bpev01.c0939.g0009 | −3.05 | - | - | - | - |
Bpev01.c0046.g0006 | −2.76 | −3.16 | −1.95 | −3.68 | - |
Bpev01.c0217.g0001 | −3.17 | - | - | −2.85 | - |
Bpev01.c1574.g0002 | −3.49 | - | - | −6.21 | - |
Bpev01.c0312.g0012 | - | - | - | −3.66 | - |
Bpev01.c0261.g0078 | - | −3.81 | - | −5.58 | - |
Bpev01.c0565.g0007 | - | −3.92 | - | −4.55 | - |
Bpev01.c0594.g0020 | - | - | - | −4.92 | - |
Bpev01.c0227.g0002 | −2.41 | −8.16 | - | −4.96 | - |
Gene_ID | Time | logFC | Funchtion |
---|---|---|---|
Bpev01.c0015.g0143 | 1 h | 9.63 | N-acetyl-l-glutamate synthase 2 |
Bpev01.c0112.g0007 | 3 h | 8.44 | Pyridoxal-5′-phosphate-dependent enzyme family protein |
Bpev01.c0511.g0007 | 3 h | 7.44 | Aldolase superfamily protein |
Bpev01.c0115.g0053 | 1 h | 4.03 | Aldolase superfamily protein |
Bpev01.c0274.g0001 | 1 h | 2.69 | ATP phosphoribosyl transferase 2 |
Bpev01.c0148.g0010 | 1 h | 4.59 | Branched-chain amino acid transaminase 2 |
Bpev01.c0462.g0003 | 1 h | 2.08 | 3-deoxy-d-arabino-heptulosonate 7-phosphate synthase |
Bpev01.c0082.g0091 | 2.5 h | 2.37 | HOPW1-1-interacting 1 |
Bpev01.c0083.g0021 | 1 h | 1.85 | Phosphofructokinase 2 |
Bpev01.c0137.g0017 | 1 h | 2.58 | Cysteine synthase D1 |
Bpev01.c0425.g0050 | 1 h | 1.31 | Aldolase superfamily protein |
Bpev01.c2707.g0004 | 1 h | 1.26 | Cytosolic NADP+-dependent isocitrate dehydrogenase |
Bpev01.c0929.g0016 | 1 h | 1.2 | O-acetylserine (thiol) lyase (OAS-TL) isoform A1 |
Bpev01.c0146.g0019 | 1 h | 1.16 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein |
Bpev01.c0145.g0054 | 1 h | 1.57 | Glutamine synthase clone R1 |
Bpev01.c0517.g0019 | 1 h | 1.04 | D-ribulose-5-phosphate-3-epimerase |
Bpev01.c0112.g0020 | 1 h | 1 | Serine acetyltransferase 2;2 |
Bpev01.c0000.g0226 | 1.5 h | −1.02 | Aspartate aminotransferase |
Bpev01.c0198.g0001 | 1 h | −1.59 | Enolase 1 |
Bpev01.c0169.g0035 | 1 h | −1.1 | Pyruvate kinase family protein |
Bpev01.c0192.g0016 | 1 h | −1.24 | Arginase |
Bpev01.c1518.g0002 | 1 h | −1.12 | Ketol-acid reductoisomerase |
Bpev01.c0120.g0017 | 1 h | −1.12 | D-3-phosphoglycerate dehydrogenase |
Bpev01.c0874.g0032 | 1 h | −1.13 | Dihydrodipicolinate synthase |
Bpev01.c0146.g0013 | 1 h | −1.14 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein |
Bpev01.c2230.g0005 | 1 h | −1.15 | Pyruvate kinase family protein |
Bpev01.c0192.g0009 | 1 h | −1.24 | RNA 3′-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta |
Bpev01.c1356.g0002 | 1 h | −1.28 | Dehydroquinate dehydratase, putative / shikimate dehydrogenase, putative |
Bpev01.c2160.g0012 | 2.5 h | −1.31 | Glyceraldehyde-3-phosphate dehydrogenase of plastid 2 |
Bpev01.c1534.g0010 | 1 h | −2.15 | Plastidic pyruvate kinase beta subunit 1 |
Bpev01.c0275.g0025 | 1 h | −1.35 | Aspartate kinase-homoserine dehydrogenase ii |
Bpev01.c0683.g0005 | 1 h | −1.49 | Methionine adenosyltransferase 3 |
Bpev01.c1040.g0016 | 1 h | −1.5 | Glyceraldehyde-3-phosphate dehydrogenase C2 |
Bpev01.c1115.g0006 | 1 h | −1.78 | Pyridoxal-5′-phosphate-dependent enzyme family protein |
Bpev01.c0000.g0150 | 1 h | −2.03 | 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase 1 |
Bpev01.c0449.g0055 | 1 h | −1.83 | Semialdehyde dehydrogenase family protein |
Bpev01.c3196.g0001 | 1 h | −2.32 | Dihydrodipicolinate reductase |
Bpev01.c0652.g0026 | 1 h | −2.34 | Shikimate kinase 1 |
Bpev01.c0279.g0010 | 1 h | −2.53 | Glutamine-dependent asparagine synthase 1 |
Bpev01.c0167.g0024 | 1.5 h | −2.65 | Tyrosine transaminase family protein |
Gene_ID | Time | logFC | Function |
---|---|---|---|
Bpev01.c0154.g0066 | 1.5 h | 4.19 | Ferretin 1 |
Bpev01.c1891.g0002 | 1.5 h | 4.02 | Photosystem II reaction center protein A |
Bpev01.c1891.g0006 | 1.5 h | 3.49 | Photosystem II reaction center protein C |
Bpev01.c1891.g0007 | 1.5 h | 3.05 | Photosystem I, PsaA/PsaB protein |
Bpev01.c1286.g0001 | 2.5 h | 1.7 | Phosphoenolpyruvate carboxykinase 1 |
Bpev01.c0088.g0023 | 1 h | 1.43 | STT7 homolog STN7 |
Bpev01.c0299.g0030 | 1 h | 1.37 | Fibrillin |
Bpev01.c0245.g0079 | 1 h | 1.76 | Ferric reduction oxidase 7 |
Bpev01.c1657.g0013 | 1 h | 1.16 | J-domain protein required for chloroplast accumulation response 1 |
Bpev01.c0088.g0011 | 1 h | 1.46 | Hydroxyproline-rich glycoprotein family protein |
Bpev01.c1275.g0002 | 1 h | 1.05 | Photosystem II subunit R |
Bpev01.c0062.g0077 | 1 h | 1.04 | DegP protease 1 |
Bpev01.c0038.g0100 | 1 h | 1.01 | Chloroplast sensor kinase |
Bpev01.c0536.g0012 | 1.5 h | −1.05 | Ferredoxin 3 |
Bpev01.c0142.g0012 | 1 h | −1.14 | Photosystem II reaction center PsbP family protein |
Bpev01.c0118.g0021 | 1 h | −1.23 | Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein |
Bpev01.c0005.g0002 | 1 h | −1.24 | Translocon at the outer envelope membrane of chloroplasts 75-III |
Bpev01.c1024.g0015 | 1 h | −1.34 | S-adenosylmethionine carrier 1 |
Bpev01.c0298.g0026 | 1 h | −1.39 | Septum site-determining protein (MIND) |
Bpev01.c0327.g0054 | 1 h | −1.52 | Tubulin/FtsZ family protein |
Bpev01.c0615.g0010 | 1 h | −2.68 | Chlorophyll A-B binding family protein |
TF Family | Total | 1 h | 1.5 h | 2 h | 2.5 h | 3 h |
---|---|---|---|---|---|---|
C2H2 | 58 | 53 | 11 | 6 | 16 | 14 |
AP2-EREBP | 42 | 29 | 25 | 14 | 24 | 24 |
MYB-HB-like | 27 | 21 | 7 | 0 | 7 | 6 |
NAM | 20 | 18 | 5 | 0 | 6 | 3 |
WD40-like | 20 | 16 | 5 | 0 | 4 | 0 |
WRKY | 16 | 15 | 2 | 0 | 5 | 5 |
bHLH | 15 | 12 | 1 | 0 | 2 | 1 |
Hap3/NF-YB | 15 | 1 | 13 | 0 | 10 | 0 |
PHD | 14 | 10 | 2 | 1 | 0 | 0 |
Homobox-WOX | 10 | 10 | 3 | 0 | 1 | 2 |
bZIP | 8 | 8 | 0 | 0 | 0 | 0 |
GRAS | 8 | 7 | 4 | 0 | 5 | 3 |
Znf-B | 7 | 5 | 6 | 0 | 4 | 4 |
C2C2-Dof | 6 | 4 | 1 | 0 | 2 | 2 |
C2C2-GATA | 6 | 4 | 1 | 0 | 2 | 2 |
BTB-POZ | 5 | 4 | 1 | 0 | 2 | 0 |
C3H | 5 | 4 | 2 | 1 | 3 | 2 |
C3H-WRC/GRF | 5 | 2 | 3 | 0 | 3 | 0 |
HSF-type-DNA-binding | 5 | 4 | 3 | 0 | 3 | 2 |
A20-like | 4 | 4 | 1 | 0 | 2 | 0 |
HD-ZIP | 4 | 2 | 2 | 0 | 2 | 1 |
References
- Thomashow, M.F. PLANT COLD ACCLIMATION: Freezing Tolerance Genes and Regulatory Mechanisms. Annu. Rev. Plant Boil. 1999, 50, 571–599. [Google Scholar] [CrossRef]
- Wang, X.; Zhao, Q.; Ma, C.-L.; Zhang, Z.H.; Cao, H.-L.; Kong, Y.-M.; Yue, C.; Hao, X.-Y.; Chen, L.; Ma, J.-Q.; et al. Global transcriptome profiles of Camellia sinensis during cold acclimation. BMC Genom. 2013, 14, 1–15. [Google Scholar] [CrossRef]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Uemura, M.; Yoshida, S. Studies on Freezing Injury in Plant Cells. Plant Physiol. 1986, 80, 187–195. [Google Scholar] [CrossRef]
- Dodd, A.N.; Jakobsen, M.K.; Baker, A.J.; Telzerow, A.; Hou, S.-W.; Laplaze, L.; Barrot, L.; Poethig, R.S.; Haseloff, J.; Webb, A.A. Time of day modulates low-temperature Ca2+signals in Arabidopsis. Plant J. 2006, 48, 962–973. [Google Scholar] [CrossRef]
- Qi, J.; Song, C.P.; Wang, B.; Zhou, J.; Kangasjärvi, J.; Zhu, J.K.; Gong, Z. Reactive oxygen species signaling and stomatal movement in plant responses to drought stress and pathogen attack J. J. Integr. Plant Biol. 2018, 60, 805–826. [Google Scholar] [CrossRef]
- Mathur, S.; Agrawal, D.; Jajoo, A. Photosynthesis: Response to high temperature stress. J. Photochem. Photobiol. B Boil. 2014, 137, 116–126. [Google Scholar] [CrossRef]
- Wu, G.; Xianlong, T.; Deguang, Y.; Crops, X.J.J. Research Progress on Physiology of Plant Cold Hardiness. Crops 2008, 3, S311. [Google Scholar]
- Jeong, S.W.; Choi, S.M.; Lee, D.S.; Ahn, S.N.; Hur, Y.; Chow, W.S.; Park, Y.-I. Differential susceptibility of photosynthesis to light-chilling stress in rice (Oryza sativa L.) depends on the capacity for photochemical dissipation of light. Mol. Cells 2002, 13, 419–428. [Google Scholar]
- Jan, W.; András, O.; Ravi, A.; Wu, C.J.N.A.R. The C-Terminal Region of Drosophila Heat Shock Factor (HSF) Contains a Constitutively Functional Transactivation Domain. Nucl. Acids Res. 1996, 24, 367–374. [Google Scholar]
- Krause, E.; Dathe, M.; Wieprecht, T.; Bienert, M. Noncovalent immobilized artificial membrane chromatography, an improved method for describing peptide-lipid bilayer interactions. J. Chromatogr. A 1999, 849, 125–133. [Google Scholar] [CrossRef]
- Medina, J.; Catala, R.; Salinas, J. The CBFs: Three arabidopsis transcription factors to cold acclimate. Plant Sci. 2011, 180, 3–11. [Google Scholar] [CrossRef]
- Nakashima, K.; Ito, Y.; Yamaguchi-Shinozaki, K. Transcriptional Regulatory Networks in Response to Abiotic Stresses in Arabidopsis and Grasses. Plant Physiol. 2009, 149, 88–95. [Google Scholar] [CrossRef]
- Zhu, J.K.; Chinnusamy, V.; Ohta, M.; Kanrar, S.; Lee, B.H.; Agarwal, M. ICE1, a regulator of cold induced transcriptome and freezing tolerance in plants. Genes Dev. 2003, 17, 1043–1054. [Google Scholar]
- Zhu, J.K.; Agarwal, M.; Kapoor, A. Snow1: Interacts with Ice1 and regulates CBF expression and freezing tolerance in Arabidopsis. U.S. Patent No. 7,378,573, 27 May 2008. [Google Scholar]
- Agarwal, M.; Hao, Y.; Kapoor, A.; Dong, C.-H.; Fujii, H.; Zheng, X.; Zhu, J.-K. A R2R3 Type MYB Transcription Factor Is Involved in the Cold Regulation of CBF Genes and in Acquired Freezing Tolerance. J. Boil. Chem. 2006, 281, 37636–37645. [Google Scholar] [CrossRef]
- Shi, Y.; Tian, S.; Hou, L.; Huang, X.; Zhang, X.; Guo, H.; Yang, S. Ethylene Signaling Negatively Regulates Freezing Tolerance by Repressing Expression of CBF and Type-A ARR Genes in Arabidopsis. Plant Cell 2012, 24, 2578–2595. [Google Scholar] [CrossRef]
- Sharma, R.; Singh, G.; Bhattacharya, S.; Singh, A. Comparative transcriptome meta-analysis of Arabidopsis thaliana under drought and cold stress. PLoS ONE 2018, 13, e203266. [Google Scholar] [CrossRef]
- Yun, M.; Dai, X.; Xu, Y.; Wei, L.; Zheng, X.; Zeng, D.; Pan, Y.; Lin, X.; Liu, H.; Zhang, D.J.C. COLD1 confers chilling tolerance in rice. Cell 2015, 6, 1209–1221. [Google Scholar]
- Gu, H.; Hagberg, P.; Zhou, W. Cold pretreatment enhances microspore embryogenesis in oilseed rape (Brassica napus L.). Plant Growth Regul. 2004, 42, 137–143. [Google Scholar] [CrossRef]
- Ito, Y.; Katsura, K.; Maruyama, K.; Taji, T.; Kobayashi, M.; Seki, M. Functional analysis of rice dreb1/cbf-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol. 2006, 47, 141–153. [Google Scholar] [CrossRef]
- Winfield, M.O.; Lu, C.; Wilson, I.D.; Coghill, J.A.; Edwards, K.J. Plant responses to cold: Transcriptome analysis of wheat. Plant Biotechnol. J. 2010, 8, 749–771. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Du, Z.-X.; Kong, J.; Chen, L.-N.; Qiu, Y.-H.; Li, G.-F.; Meng, X.-H.; Zhu, S.-F. Transcriptome Analysis of Nicotiana tabacum Infected by Cucumber mosaic virus during Systemic Symptom Development. PLoS ONE 2012, 7, e43447. [Google Scholar] [CrossRef]
- Hu, H.; You, J.; Fang, Y.; Zhu, X.; Qi, Z.; Xiong, L.J.P.M.B. Erratum to: Characterization of transcription factor geneSNAC2conferring cold and salt tolerance in rice. Plant Mol. Biol. 2010, 72, 567–568. [Google Scholar] [CrossRef]
- Huang, G.-T.; Ma, S.-L.; Bai, L.-P.; Zhang, L.; Ma, H.; Jia, P.; Liu, J.; Zhong, M.; Guo, Z.-F. Signal transduction during cold, salt, and drought stresses in plants. Mol. Boil. Rep. 2011, 39, 969–987. [Google Scholar] [CrossRef] [PubMed]
- Kurepin, L.V.; Dahal, K.P.; Savitch, L.V.; Singh, J.; Bode, R.; Ivanov, A.G.; Hurry, V.M.; Hüner, N.P.A. Role of CBFs as Integrators of Chloroplast Redox, Phytochrome and Plant Hormone Signaling during Cold Acclimation. Int. J. Mol. Sci. 2013, 14, 12729–12763. [Google Scholar] [CrossRef]
- Dong, C.-J.; Li, L.; Cao, N.; Shang, Q.M.; Zhang, Z.-G. Roles of phenylalanine ammonia-lyase in low temperature tolerance in cucumber seedlings. Chin. J. Appl. Ecol. 2015, 26, 2041–2049. [Google Scholar]
- Savitch, L.V.; Harney, T.; Hüner, N.P.A. Sucrose metabolism in spring and winter wheat in response to high irradiance, cold stress and cold acclimation. Physiol. Plant. 2000, 108, 270–278. [Google Scholar] [CrossRef]
- Christenhusz, M.J.; Byng, J.W. The number of known plants species in the world and its annual increase. Phytotaxa 2016, 261, 201. [Google Scholar] [CrossRef]
- Doyle, J. CTAB Total DNA Isolation. Mol. Tech. Taxon. 1991, 57, 283–293. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatrics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Salojärvi, J.; Smolander, O.-P.; Nieminen, K.; Rajaraman, S.; Safronov, O.; Safdari, P.; Lamminmaki, A.; Immanen, J.; Lan, T.; Tanskanen, J.; et al. Genome sequencing and population genomic analyses provide insights into the adaptive landscape of silver birch. Nat. Genet. 2017, 49, 904–912. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Rau, A.; Gallopin, M.; Celeux, G.; Jaffrézic, F. Data-based filtering for replicated high-throughput transcriptome sequencing experiments. Bioinformatrics 2013, 29, 2146–2152. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatrics 2009, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
- Pruitt, K.D.; Tatusova, T.; Maglott, N.R. NCBI Reference Sequence (RefSeq): A curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2004, 33, D501–D504. [Google Scholar] [CrossRef]
- Amos, B.; Rolf, A. The SWISS-PROT protein sequence data bank and its supplement TrEMBL in 1999. Nucleic Acids Res. 1999, 27, 49–54. [Google Scholar]
- Minoru, K.; Susumu, G. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar]
- Chen, J.; Xia, X.; Yin, W. A poplar DRE-binding protein gene, PeDREB2L, is involved in regulation of defense response against abiotic stress. Gene 2011, 483, 36–42. [Google Scholar] [CrossRef]
- Dai, Z.; Sheridan, J.M.; Gearing, L.J.; Moore, D.L.; Su, S.; Wormald, S.; Wilcox, S.; O’Connor, L.; Dickins, R.A.; Blewitt, M.E.; et al. edgeR: A versatile tool for the analysis of shRNA-seq and CRISPR-Cas9 genetic screens. F1000Research 2014, 3. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.M.; Lai, C.P.; Chen, L.F.O.; Chan, M.T.; Shaw, J.F. Arabidopsis SFAR4 is a novel GDSL-type esterase involved in fatty acid degradation and glucose tolerance. Bot. Stud. 2015, 56, 33. [Google Scholar] [CrossRef] [PubMed]
- Valmonte, G.R.; Arthur, K.; Higgins, C.M.; MacDiarmid, R.M. Calcium-Dependent Protein Kinases in Plants: Evolution, Expression and Function. Plant Cell Physiol. 2014, 55, 551–569. [Google Scholar] [CrossRef]
- Ma, W.; Berkowitz, G.A. Ca2+ conduction by plant cyclic nucleotide gated channels and associated signaling components in pathogen defense signal transduction cascades. New Phytol. 2010, 190, 566–572. [Google Scholar] [CrossRef]
- Huang, C.; Ding, S.; Zhang, H.; Du, H.; An, L. CIPK7 is involved in cold response by interacting with CBL1 in Arabidopsis thaliana. Plant Sci. 2011, 181, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Miao, Y.; Shao, L.; Hu, T.; Yang, P. De novo transcriptome sequencing and gene expression profiling of Elymus nutans under cold stress. BMC Genom. 2016, 17, 1–19. [Google Scholar] [CrossRef]
- Chen, C.; Zhang, Y.; Xu, Z.; Luan, A.; Mao, Q.; Feng, J.; Xie, T.; Gong, X.; Wang, X.; Chen, H.; et al. Transcriptome Profiling of the Pineapple under Low Temperature to Facilitate Its Breeding for Cold Tolerance. PLoS ONE 2016, 11, e163315. [Google Scholar] [CrossRef][Green Version]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Rivero, R.M.; Ruiz, J.M.; García, P.C.; Lopez-Lefebre, L.R.; Sánchez, E.; Romero, L. Resistance to cold and heat stress: Accumulation of phenolic compounds in tomato and watermelon plants. Plant Sci. 2001, 160, 315–321. [Google Scholar] [CrossRef]
- Michalak, A. Phenolic Compounds and Their Antioxidant Activity in Plants Growing under Heavy Metal Stress. J. Environ. Stud. 2006, 15, 523–530. [Google Scholar]
- Asada, M.; Nishimura, T.; Ifuku, K.; Mino, H. Location of the extrinsic subunit PsbP in photosystem II studied by pulsed electron-electron double resonance. Biochim. Biophys. Acta (BBA) Bioenerg. 2018, 1859, 394–399. [Google Scholar] [CrossRef] [PubMed]
- Abeynayake, S.W.; Etzerodt, T.P.; Jonavičienė, K.; Byrne, S.; Asp, T.; Boelt, B. Fructan metabolism and changes in fructan composition during cold acclimation in perennial ryegrass. J. Front. Plant Sci. 2015, 6, 329. [Google Scholar] [CrossRef] [PubMed]
- Li, H.-W.; Zang, B.-S.; Deng, X.-W.; Wang, X.-P. Overexpression of the trehalose-6-phosphate synthase gene OsTPS1 enhances abiotic stress tolerance in rice. Planta 2011, 234, 1007–1018. [Google Scholar] [CrossRef] [PubMed]
- Dionne, J.; Rochefort, S.; Huff, D.R.; Desjardins, Y.; Bertrand, A.; Castonguay, Y. Variability for Freezing Tolerance among 42 Ecotypes of Green-Type Annual Bluegrass. Crop. Sci. 2010, 50, 321–336. [Google Scholar] [CrossRef]
- Chen, S.; Lin, X.; Zhang, D.; Li, Q.; Zhao, X.; Chen, S. Genome-Wide Analysis of NAC Gene Family in Betula pendula. Forests 2019, 10, 741. [Google Scholar] [CrossRef]
- Ritonga, F.N.; Chen, S. Physiological and Molecular Mechanism Involved in Cold Stress Tolerance in Plants. Plants 2020, 9, 560. [Google Scholar] [CrossRef]
- Wang, F.; Chen, S.; Liang, D.; Qu, G.-Z.; Chen, S.; Zhao, X.-Y. Transcriptomic analyses of Pinus koraiensis under different cold stresses. BMC Genom. 2020, 21, 10–14. [Google Scholar] [CrossRef]
- Caspy, I.; Nelson, N. Structure of the plant photosystem I. Biochem. Soc. Trans. 2018, 46, 285–294. [Google Scholar] [CrossRef]
- Pyke, K. The genetic control of plastid division in higher plants. Am. J. Bot. 1997, 84, 1017–1027. [Google Scholar] [CrossRef]
- Ishikita, H.; Stehlik, D.; Golbeck, J.H.; Knapp, E.-W. Electrostatic Influence of PsaC Protein Binding to the PsaA/PsaB Heterodimer in Photosystem I. Biophys. J. 2005, 90, 1081–1089. [Google Scholar] [CrossRef]
DEGs | 1 h | 1.5 h | 2 h | 2.5 h | 3 h | Total |
---|---|---|---|---|---|---|
All_DEGs | 3197 | 881 | 79 | 859 | 451 | 3491 |
Up-regulated | 1656 | 494 | 67 | 470 | 378 | 1764 |
Down-regulated | 1541 | 387 | 12 | 389 | 73 | 1727 |
TF Family | Total | 1 h | 1.5 h | 2 h | 2.5 h | 3 h |
---|---|---|---|---|---|---|
C2H2 | 58 | 53 | 11 | 6 | 16 | 14 |
AP2-EREBP | 42 | 29 | 25 | 14 | 24 | 24 |
MYB-HB-like | 27 | 21 | 7 | 0 | 7 | 6 |
NAM | 20 | 18 | 5 | 0 | 6 | 3 |
WD40-like | 20 | 16 | 5 | 0 | 4 | 0 |
WRKY | 16 | 15 | 2 | 0 | 5 | 5 |
bHLH | 15 | 12 | 1 | 0 | 2 | 1 |
Hap3/NF-YB | 15 | 1 | 13 | 0 | 10 | 0 |
PHD | 14 | 10 | 2 | 1 | 0 | 0 |
Homobox-WOX | 10 | 10 | 3 | 0 | 1 | 2 |
bZIP | 8 | 8 | 0 | 0 | 0 | 0 |
GRAS | 8 | 7 | 4 | 0 | 5 | 3 |
Znf-B | 7 | 5 | 6 | 0 | 4 | 4 |
C2C2-Dof | 6 | 4 | 1 | 0 | 2 | 2 |
C2C2-GATA | 6 | 4 | 1 | 0 | 2 | 2 |
BTB-POZ | 5 | 4 | 1 | 0 | 2 | 0 |
C3H | 5 | 4 | 2 | 1 | 3 | 2 |
C3H-WRC/GRF | 5 | 2 | 3 | 0 | 3 | 0 |
HSF-type-DNA-binding | 5 | 4 | 3 | 0 | 3 | 2 |
A20-like | 4 | 4 | 1 | 0 | 2 | 0 |
HD-ZIP | 4 | 2 | 2 | 0 | 2 | 1 |
Gene_ID | Time | logFC | Function |
---|---|---|---|
Calcium signal pathway | |||
Bpev01.c1074.g0005 | 2.5 h | 4.66 | Calmodulin-like, CML25 |
Bpev01.c0480.g0081 | 2 h | 4.57 | Calmodulin-like, CML38 |
Bpev01.c1074.g0006 | 3 h | 4.48 | Calcium-binding EF-hand family protein |
Bpev01.c1074.g0007 | 2.5 h | 3.94 | Calcium-binding EF-hand family protein |
Bpev01.c0088.g0124 | 1 h | 3.79 | Ca2+-dependent modulator of ICR1, CMI1 |
Hormone | |||
Bpev01.c0343.g0021 | 1 h | 7.67 | Pathogenesis-related gene 1 |
Bpev01.c1161.g0016 | 2.5 h | 5.23 | Ethylene responsive element binding factor 5 |
Bpev01.c1161.g0012 | 2.5 h | 4.68 | Ethylene responsive element binding factor 5 |
Bpev01.c1161.g0014 | 2.5 h | 4.63 | Ethylene responsive element binding factor 5 |
Bpev01.c0870.g0008 | 2.5 h | 4.01 | ABA 8′-hydroxylase, polypeptide 1 |
Starch and sucrose metabolism | |||
Bpev01.c0162.g0017 | 1 h | 5.07 | Beta-glucosidase 45 |
Bpev01.c0080.g0100 | 1 h | 4.58 | PfkB-like carbohydrate kinase family protein |
Bpev01.c0283.g0018 | 1 h | 3.15 | Beta-amylase 5 |
Bpev01.c0092.g0014 | 1 h | 2.77 | Beta glucosidase 41 |
Bpev01.c0275.g0002 | 1 h | 2.59 | Sucrose-phosphate synthase family protein |
Amino acids biosynthesis | |||
Bpev01.c0015.g0143 | 1 h | 9.63 | N-acetyl-l-glutamate synthase 2 |
Bpev01.c0112.g0007 | 3 h | 8.44 | Pyridoxal-5′-phosphate-dependent enzyme family protein |
Bpev01.c0511.g0007 | 3 h | 7.44 | Aldolase superfamily protein |
Bpev01.c0148.g0010 | 1 h | 4.59 | Branched-chain amino acid transaminase 2 |
Bpev01.c0115.g0053 | 1 h | 4.03 | Aldolase superfamily protein |
Photosynthesis | |||
Bpev01.c0154.g0066 | 1.5 h | 4.19 | Ferritin 1 |
Bpev01.c1891.g0002 | 1.5 h | 4.02 | Photosystem II reaction center protein A |
Bpev01.c1891.g0006 | 1.5 h | 3.49 | Photosystem II reaction center protein C |
Bpev01.c1891.g0007 | 1.5 h | 3.05 | Photosystem I, PsaA/PsaB protein |
Bpev01.c0245.g0079 | 1 h | 1.76 | Ferric reduction oxidase 7 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, S.; Zhang, D.; Chen, S.; Chen, S. Transcriptome Sequencing Analysis of Birch (Betula platyphylla Sukaczev) under Low-Temperature Stress. Forests 2020, 11, 970. https://doi.org/10.3390/f11090970
Yan S, Zhang D, Chen S, Chen S. Transcriptome Sequencing Analysis of Birch (Betula platyphylla Sukaczev) under Low-Temperature Stress. Forests. 2020; 11(9):970. https://doi.org/10.3390/f11090970
Chicago/Turabian StyleYan, Siyu, Dawei Zhang, Song Chen, and Su Chen. 2020. "Transcriptome Sequencing Analysis of Birch (Betula platyphylla Sukaczev) under Low-Temperature Stress" Forests 11, no. 9: 970. https://doi.org/10.3390/f11090970
APA StyleYan, S., Zhang, D., Chen, S., & Chen, S. (2020). Transcriptome Sequencing Analysis of Birch (Betula platyphylla Sukaczev) under Low-Temperature Stress. Forests, 11(9), 970. https://doi.org/10.3390/f11090970