Next Article in Journal
Causes of Decline in the Korean Fir Based on Spatial Distribution in the Mt. Halla Region in Korea: A Meta-Analysis
Previous Article in Journal
Transcriptome Sequencing and Differential Expression Analysis Reveal Molecular Mechanisms for Starch Accumulation in Chestnut
 
 
Due to scheduled maintenance work on our database systems, there may be short service disruptions on this website between 10:00 and 11:00 CEST on June 14th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Response of Nitrogen Metabolism in Masson Pine Needles to Elevated CO2

1
Key Laboratory of Forestry Genetics & Biotechnology of Ministry of Education, Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
2
Baisha State-Owned Forest Farm, Shanghang 364200, China
*
Author to whom correspondence should be addressed.
Forests 2020, 11(4), 390; https://doi.org/10.3390/f11040390
Submission received: 6 February 2020 / Revised: 29 March 2020 / Accepted: 31 March 2020 / Published: 1 April 2020
(This article belongs to the Section Forest Ecology and Management)

Abstract

:
To explore the response of nitrogen metabolism in Masson pine (Pinus massoniana) to high CO2 concentrations, needles from one-year-old seedlings were used as materials to detect key enzyme activities, gene expression and different forms of nitrogen metabolites after CO2 stress for different durations (0 h, 6 h, 12 h, 24 h). The results show that elevated CO2 affected the efficiency of nitrogen metabolism in Masson pine needles, inhibiting the expression of key genes involved in nitrogen metabolism, including glutamate synthase (GOGAT), nitrite reductase (NiR), glutamine synthase (GS), nitrate reductase (NR) and glutamate dehydrogenase (GDH), and decreasing the activities of GOGAT, NiR, and GS. The decrease in enzyme activities and gene expression caused a decrease in different forms of nitrogen metabolites, including total nitrogen, ammonium, nitrite and specific amino acids. With prolonged stress, the nitrate content increased first and then decreased. In this study, the response pattern of nitrogen metabolism to CO2 stress in Masson pine needles was described, which may aid future research on nitrogen utilization in Masson pine.

1. Introduction

With the advent of the industrial revolution, the concentration of CO2 in the atmosphere has increased as a result of human activities. According to the Global Carbon Project (GCP), the global atmospheric CO2 concentration reached 407.38 ± 0.1 ppm averaged over 2018, and will rise to approximately 500 ppm by the middle of this century and to 700–1260 ppm by the end of this century [1,2]. The effect of increased CO2 concentrations on the environment, especially on plants, is obvious because the rate at which plants adapt to CO2 does not parallel the rate at which the CO2 concentration increases [3,4].
In terms of plant nutrients, elevated CO2 will accelerate the demands of plants for nutrients, and nitrogen is usually the limiting nutrient in plants [5,6]. The increase of CO2 concentration in the environment enhanced the photosynthetic efficiency of plants, and the absorption and reduction of nitrogen elements in plants require energy and the reducing force provided by photosynthetic carbon metabolism, and the subsequent synthesis of various amino acids also requires a light reaction to provide a carbon skeleton [7,8]. Therefore, nitrogen metabolism in plants is closely related to photosynthetic carbon metabolism.
It is well known that the nitrogen absorbed by plants during the growth process mainly comes from two types of mineral nitrogen sources, ammonium (NH4+) and nitrate (NO3). Studies have shown that different plants have different utilization efficiency of different forms of nitrogen under elevated CO2. For inorganic nitrogen, Men [9] found that the concentration of NO3 and NH4+ in leaves of winter wheat (Triticum aestivum) decreased under increased CO2 conditions in an air chamber. Xu [10] also noted that an increase in the CO2 concentration inhibited the reduction of NO3 and reduced the nitrogen content in the flag leaves of winter wheat. For coniferous plants, Bassirirad et al. [11] and Su [12] showed that the NO3 concentration in Loblolly pine (Pinus taeda) and Camphor pine (Pinus sylvestris var. mongolica) increased with the enrichment of atmospheric CO2, while the NH4+ concentration did not change significantly, and Johnson et al. [13] suggested that CO2 stress would lead to a decrease in the concentration of NH4+ in Ponderosa pine (Pinus ponderosa). According to previous reports, it can be seen that compared with crops, NO3 may be a more nitrogen source that coniferous plants tend to use under CO2 stress. In terms of amino acids, previous studies on species including rice (Oryza sativa) [14], European red pine (Pinus sylvestris) [15] and cotton (Gossypium spp) [16] indicated that elevated CO2 would lead to the increase of amino acids. For the total nitrogen, Han [17], Wang [18] and Li [19] proved that enrichment CO2 concentration would inhibit total nitrogen level in plants.
Regarding nitrogen assimilation, studies found that a high concentration of CO2 could increase the activity of nitrate reductase (NR) or glutamine synthase (GS) in Brassica napus [20]. However, some scholars have noted that elevated CO2 leads to decreased NR activity in wheat leaves [21]. Bauer [22] and Constable [23] confirmed that the increased CO2 would not affect the NR activity of Eastern White Pine (Pinus strobus) and Loblolly pine. This may suggest that herbs have more plasticity in function than coniferous plants under increased CO2 concentrations.
Masson pine (Pinus massoniana) is widely distributed in subtropical areas of China. Due to its tolerance to drought and barren lands, it has become the main pioneer tree species for afforestation and vegetation restoration in China [24,25]. At present, studies on nitrogen metabolism in Masson pine mainly focus on the effects of nitrogen deposition [26] and industrial pollution [27] on nitrogen distribution or the use of new technology to detect the nitrogen content in leaves [28]. However, few studies regarding nitrogen metabolism under CO2 stress have been performed. Based on the previous research progress in conifers, we speculated that, when the environmental CO2 concentration increased, the utilization efficiency of nitrogen in different forms would be different. Masson pine might be more inclined to use NO3 as a nitrogen source. The content of amino acids would increase, and the total nitrogen level would decrease. In terms of enzyme activity, the activity of NR would not be affected by elevated CO2, while that of other key enzymes would decrease or remained unchanged with the extension of treatment time. In addition, the response of key genes involved in the regulation of nitrogen metabolism to CO2 stress has been rarely studied. Will their expression level be consistent with changes in enzyme activity and nitrogen content in different forms? In order to confirm the above hypothesis, in this study, Masson pine was exposed to high CO2 concentrations, and the changes in nitrogen with different forms, in the corresponding regulatory enzymes activities and genes expression level were detected, to fill the gap in this field, reveal the influence of CO2 stress on nitrogen transport and redistribution in Masson pine and to provide a scientific basis for fertilizer management and selection strategies in response to climate change.

2. Materials and Methods

2.1. Plant Materials and Experimental Design

One-year-old Masson pine seedlings, obtained from the seed orchard of the Baisha state-owned forest farm, Shanghang, Fujian Province, China (25°15’ N, 116°62’ E), were used in this study. Three individuals of the same clones with similar heights and uniform vigorous growth were chosen as the materials. After 10 days of recovery, the seedlings were subsequently moved into a growth chamber. The growth conditions were 10 h light/14 h dark cycles at 25 °C in the chamber. Air containing approximately 800–1000 ppm CO2 (approximately two times the ambient CO2 concentration) was aerated into the growth chamber constantly for at least 24 h. The CO2 concentration in the chamber was monitored by an infrared CO2 analysis reader (SenseAir, Delsbo, Sweden). Three biological replicates for each treatment were sampled at 0 h (control check group, CK), 6 h, 12 h, 24 h, and every sample was divided into three parts, two of which were immediately stored in liquid nitrogen for RNA extraction and nitrogen metabolite analysis, and the other one was used for related enzyme activity detection.

2.2. Determination of the Content of Different Forms of Nitrogen

Samples with different treatment times were dried at 80 °C to a constant weight. Then, 0.2 g of sample was weighed, and the total nitrogen was determined by the Kjeldahl method [29].
Samples (1 g) treated with different stress treatment times were cut into pieces, ground with a small amount of double distilled water (ddH2O) in a mortar, transferred into a dry triangular flask, supplemented with ddH2O to a final volume of 20 mL, oscillated and finally allowed to rest for clarification. For NH4+ determination, 5 mL of supernatant was extracted and placed in a 25 mL volumetric flask, and then 2.5 mL of reaction buffer A (0.1 M phenol, 0.3 mM sodium nitroprusside (Na2Fe(CN)5NO·2H2O), stored in a brown bottle at 4 °C), 2.5 mL reaction buffer B (0.25 M NaOH, 0.05 M Na2HPO4, 0.2 M Na3PO4, 7 mM NaClO, stored in a brown bottle at 4 °C) and 0.5 mL masking agent (1.4 M Seignette salt (C4H12KNaO10), 0.3 M EDTA-2Na, 0.05 M NaOH) were added. Then, the mixed solution was adjusted to 25 mL with ddH2O and measured at 625 nm. For NO3 determination, 2 mL supernatant was extracted, and then, 18 mL acetic acid and 0.4 g mixed powder (BaSO4: α-naphthylamine: zinc powder: p-aminobenzene sulfonic acid: MnSO4: citric acid = 100:2:2:4:10:75) were added. Then, the mixture was vigorously shaken for 1 min and centrifuged at 4000 rpm for 5 min, and the supernatant was measured at 520 nm. For NO2, 5 mL supernatant was extracted and mixed with 0.2 mL chromogenic agent (0.58 M sulfanilamide (C6H8N2O2S), 15 mM hydrochloric acid N-(1-naphthyl) ethylenediamine (C12H14N2·2HCl), 2 N H3PO4). Then, the mixed solution was adjusted to 25 mL with ddH2O, allowed to stand for 1 h and measured at 543 nm [30].

2.3. Free Amino Acid Detection

A total of 20 mg of sample was weighed in a 2 mL microcentrifuge tube. After the addition of 400 μL of extraction buffer (acetonitrile: methanol: water, 2:2:1, containing adonitol 1 μg·mL−1 as the internal standard), the samples were vortexed for 30 s, homogenized at 35 Hz for 4 min, and sonicated for 5 min in an ice-water bath. The homogenate and sonicate cycle was repeated 3 times, followed by incubation at −20 °C for 1 h and centrifugation at 12000 rpm and 4 °C for 15 min. The resulting supernatants were transferred to LC-MS vials and stored at −80 °C. The quality control sample was prepared by mixing an equal aliquot of the supernatants from all of the samples.
LC-MS/MS analyses were performed using a UHPLC system (1290, Agilent Technologies, Santa Clara, CA, USA) with a UPLC HSS T3 column (2.1 mm × 100 mm, 1.8 μm, Waters, Milford, MA, USA) coupled to Q Exactive (Orbitrap MS, Thermo, Waltham, MA, USA). Mobile phase A was 0.1% formic acid in water for the positive mode, and 5 mmol∙L−1 ammonium acetate in water for the negative mode. Mobile phase B was acetonitrile. The elution gradient was set as follows: 0 min, 1% B; 1 min, 1% B; 8 min, 99% B; 10 min, 99% B; 10.1 min, 1% B; and 12 min, 1% B. The flow rate was 0.5 mL·min−1. The injection volume was 2 μL. The QE mass spectrometer was used for its ability to acquire MS/MS spectra on an information-dependent basis (IDA) during an LC/MS experiment. In this mode, the acquisition software Xcalibur version 4.0.27 (Thermo, Waltham, MA, USA) continuously evaluates the full-scan survey MS data as it collects and triggers the acquisition of MS/MS spectra depending on preselected criteria. Electron spray ionization (ESI) source conditions were set as follows: The sheath gas flow rate was 45 Arb, Aux gas flow rate was 15 Arb, capillary temperature was 400 °C, full MS resolution was 70,000, MS/MS resolution was 17,500, collision energy was 20/40/60 eV in the NCE model, and the spray voltage was 4.0 kV (positive) or −3.6 kV (negative).

2.4. Nitrogen Metabolism Enzyme Activities

The activity of glutamine synthase (GS) was determined by homogenizing the fresh sample (g) with the extraction buffer (0.05 M Tris-HCl, 2 mM Mg2+, 2 mM dithiothreitol (DTT), 0.4 M saccharose, pH 8.0) at a 1:10 ratio in an ice-water bath and centrifuging for 10 min at 4000 rpm. Then, 400 μL supernatant was mixed with 175 μL reaction mixture (0.1 mM Tris-HCl, 80 mM Mg2+, 20 mM sodium 2-aminopentanedioate (C5H8NNaO4), 20 mM cysteine, 2 mM EDTA, 80mM hydroxylamine hydrochloride (NH3OHCl), pH 7.4), and reacted at 25 °C for 30 min. Then, 250 μL chromogenic agent (0.2 M trichloroacetic acid (TCA), 0.37 M FeCl3, 0.6 M HCl) was added. Samples were centrifuged at 4000 rpm for 5 min and the absorbance of γ-glutamylmonohydroxamate (γ-GHM) in the supernatant was measured at 540 nm. The activity determination of nitrate reductase (NR) was first mixed and homogenized 0.1 g fresh sample with 1 mL, 0.1 M phosphate buffer in ice-water bath, and the supernatant was obtained after centrifuging for 10 min at 4000 rpm. The reaction was incubated for 30 min at 25 °C after the addition of 100 µL of enzyme extract to 500 µL of reaction buffer (20 mM NADH, 20 mM KNO3). The 500 µL chromogenic agent (60 mM sulfanilic acid (C6H7NO3S), 3 M HCl, 1.4 mM α-naphthylamine) was then added and the samples were measured colorimetrically at 540 nm after incubating for 20 min at 25 °C. The activities of glutamate dehydrogenase (GDH) and glutamate synthase (GOGAT) were determined by the decline rate of NADH absorbance at 340 nm in a reaction consisting of 900 µL protein extract (0.1 g fresh sample added into 1 mL, 0.1 M Tris-HCl, pH 8.0, homogenizing in ice-water bath and then centrifuging for 10 min at 4000 rpm) and 100 µL of reaction buffer for GDH (0.1 M Tris-HCl, 1.5 M NH4Cl, 0.25 M α-ketoglutarate, 7.5 mM NADH, pH 8.0) or for GOGAT (0.1 M Tris-HCl, 10 mM dithiothreitol (DTT), 0.25 M α-ketoglutarate, 7.5 mM NADH, pH 8.6). For nitrite reductase (NiR) activity, the enzyme extract was obtained by homogenizing 0.1 g fresh sample and 1 mL extraction buffer (50 mM phosphate buffer, 1 mM EDTA, 3 mM cysteine, pH 7.5). Then, the reaction was incubated for 60 min at 25 °C after mixing 100 µL enzyme extract with 400 µL reaction buffer (50 mM Tris-HCl, 0.5 mM KNO2, 1 mM methylviologen, pH 7.5) and 120 μL 0.12 M Na2S2O4. The reaction was stopped by adding 200 μL, 1 M zinc acetate. Then, 350 μL supernatant was added with 700 μL chromogenic agent (60 mM sulfanilic acid, 3 M HCl, 1.4 mM α-naphthylamine), and measured under 540 nm.

2.5. RNA Extraction, Complementary DNA (cDNA) Synthesis and Quantitative Real-Time PCR (qRT-PCR)

Total RNA from seedlings under four treatment conditions (0 h, 6 h, 12 h and 24 h) was extracted with three biological replicates for each treatment using the Plant RNA Isolation kit (Tiangen Biotech, Beijing, China). Then, first-strand cDNA was synthesized with FastKing gDNA Dispelling RT SuperMix (item number: KR118-02, Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. For qRT-PCR, the mixtures consisted of 10 µL of 2× ChamQTM Universal SYBR® qPCR Master Mix (item number: Q711-02, Vazyme Biotech, Nanjing, China), 0.4 µL of forward primer and reverse primer, 2 µL of cDNA, and 7.2 µL of ddH2O. The qRT-PCR program was set up in three stages: (1) 95 °C for 30 s (preincubation), (2) 95 °C for 10 s, 60 °C for 30 s, 72 °C for 30 s, repeated 40 times (amplification), (3) 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s (melting curves). The qRT-PCR quality was estimated based on the melting curves. Alpha-tubulin (TUA) was used as the internal control [31]. The gene-specific primers employed are shown in Table 1. Three independent biological replicates and three technical replicates for each biological replicate were run. Quantification was achieved using comparative cycle threshold (Ct) values, and gene expression levels were calculated using the 2−∆∆Ct method [31].

2.6. Statistical Analysis

The significance was determined by t-test using SPSS version 22.0 statistical software (IBM, New York, NY, USA) (p < 0.05). Differences in the effects of CO2 on various treatments were determined by one-way ANOVA with Duncan’s new multiple tests. The raw data of metabolite detection were converted into a common format, and adducts were achieved using XCMS online [32] (http://metlin.scripps.edu/xcms/), which provides a complete metabolomics workflow, including feature detection, retention time correction, alignment, annotation and analysis [32]. The ion strength of each detection peak was determined by combining the retention time and mass-to-charge ratio (m/z) values. The peak was detected, and the metabolite was obtained by the quartile interval denoising method; the missing value of the original data was obtained using half of the minimum value [33].

3. Results

3.1. Changes in Different N Forms under CO2 Stress

As shown in Figure 1, different forms of nitrogen have different expression trends under CO2 stress. Among them, there was no significant difference in the total nitrogen content in Masson pine needles after 6 h of treatment compared with 0 h of treatment. When treated for 12 h, the content decreased significantly and maintained a low level until 24 h (Figure 1A). The NO3 content first increased with increasing treatment time, peaked at 6 h, and then continued to decline. The content was lower at 24 h than at 0 h (Figure 1B). The NO2 content decreased rapidly in the early stage of treatment (6 h) and remained at a low level (Figure 1C), while NH4+ showed a trend of continuous decrease (Figure 1D). In general, with increasing CO2 stress treatments, different forms of nitrogen showed a downward trend.

3.2. Free Amino Acids

The changes in the contents of twenty common free amino acids under CO2 stress are shown in Table 2. The contents of different amino acids in the elevated CO2 environment were different. Among them, the contents of asparagine, histidine, arginine and tryptophan increased with increasing stress time and reached a maximum value at 24 h, while the content of amino acids such as glutamate, glutamine, proline and valine decreased with increasing treatment time; the difference between the different treatment times reached a significant level (p < 0.05). However, the change in concentration of aspartate, glycine, cysteine, phenylalanine, lysine and tyrosine showed no significant difference under CO2 stress. The total amount of amino acids did not differ significantly at 0 h, 6 h and 12 h but increased significantly at 24 h (Table 2). In general, the amount of amino acids increased with increasing stress time.

3.3. Enzyme Activities and Gene Expression

An increase in the CO2 concentration resulted in increased GDH (Figure 2A) and NR (Figure 2C) activities, among which GDH was significantly different between different treatments, while NR activity was only slightly upregulated after 6 h, and no significant difference existed between treatment groups. Other enzyme activities decreased with increasing stress time (Figure 2E,G,I), among which GS was the most obvious.
The expression patterns of key genes involved in nitrogen metabolism in a high CO2 environment is shown in Figure 2. Among them, the expression of NR continued to decrease, reaching the lowest value at 24 h, and there was a significant difference between the expression levels corresponding to each treatment time node (Figure 2D). The expression trends of GDH and GS were similar. Their expression levels no longer changed significantly after 12 h of stress treatment (Figure 2B,H). Interestingly, the expression levels of NiR and GOGAT decreased first, and there were no differences at 6 h and 12 h. However, after 24 h, the expression levels increased again but did not return to the untreated level (0 h). The expression levels at 24 h increased significantly compared with those at 6 h and 12 h (Figure 2F,J). Overall, the expression of all genes showed a downregulated trend with increased treatment time.

4. Discussion

4.1. Effects of Elevated CO2 on Different Nitrogen Forms

Plants showed great flexibility and differences in the uptake and metabolism of different nitrogen forms under stress [34]. The results of this experiment show that with an increasing CO2 concentration, the NO3 content in Masson pine needles increased slightly in the early stage (0–12 h) and later (after 24 h) was lower than that in the control (0 h). Previous studies have found that when the concentration of CO2 in the plasma membrane increases, the conversion efficiency of CO2 to HCO3 also increased at the same time, resulting in the difference between the concentration of HCO3 inside and outside the plasma membrane. The absorption of NO3 is coupled with the transmembrane exchange of HCO3. Therefore, with the outflow of HCO3 in the plasma membrane, increasing NO3 will enter the plasma membrane, leading to an increase in its content [35,36]. On the other hand, the contents of NO2 and NH4+ decreased continuously with increasing stress time, reaching the lowest value at 24 h (Figure 1C,D). Thornton [37] noted that plants had feedback regulation on the absorption and metabolism of NH4+, NO2 and NO3; therefore, an increase in the NO3 content may cause a decrease in the other two forms of nitrogen. Furthermore, Ma [38] noted that an increase in the amino acid content would also inhibit the absorption and metabolism of inorganic nitrogen by plants. In general, the content of amino acids increased with increasing stress time and reached a maximum value at 24 h, particularly for threonine, arginine and tryptophan (Table 2). Therefore, the increase in the amino acid content may also be another explanation for the decline in the NH4+, NO2, and NO3 contents after 24 h. In terms of the total nitrogen content, there was no significant change within 6 h; however, it began to decrease after 12 h and was lower at 12 h than at 0 h, eventually reaching a significant level. Studies have shown that an increase in the CO2 concentration will reduce the total nitrogen concentration in plants [39,40], but the reasons vary in different reports. When Li [19] studied the change in the total nitrogen content in tea leaves under CO2 and high temperature stress, he found that the decrease in the free amino acid and caffeine contents was the main reason for the decrease in the total nitrogen content. Weigel [41] believed that the decrease in total nitrogen was related to the increase in the carbohydrate content in plants. The results of our experiment show that the main reason for the decrease in the total nitrogen in Masson pine needles may be the decrease in the inorganic nitrogen content. Perhaps because of the different responses of different species to elevated CO2 or the application of other stress treatments at the same time, there were differences in the reasons for the decrease in the total nitrogen content in leaves in different reports.

4.2. Enzyme Activities and Gene Expression Response to CO2 Stress

According to the results of this experiment, NiR and GS activities decreased with increasing treatment time under CO2 stress (Figure 2E,G). This would lead to a decrease in the contents of NH4+ and glutamine, the products catalyzed by the two reactions. This inference was confirmed by the corresponding experimental results (Figure 1D, Table 2). When Li [42] studied the response of nitrogen metabolism in cucumber (Cucumis sativus) under CO2 stress, the activity of NiR changed in a way that contrasts the changes in NiR activity in our study. It is possible that Li applied NaCl stress at the same time, resulting in inconsistent results. The response of GS was consistent with that reported in other species [43]. In addition, the activity of GOGAT showed a decreasing trend (Figure 2I), while GDH correspondingly increased at the same time (Figure 2A). GOGAT and GDH are two key enzymes involved in the transformation of α-ketoglutaric acid into glutamate in plant cells. GOGAT uses glutamine as the nitrogen source for glutamate synthesis, while GDH uses NH4+ [44]. Our results showed that under CO2 stress, the metabolic pathway of GOGAT was inhibited, and Masson pine synthesized glutamate mainly through the GDH pathway. Therefore, increasing NH4+ was consumed, leading to a decrease in its content (Figure 1D). On the other hand, there was no significant difference in the NR activity in each treatment, indicating that NR was not affected by CO2 stress (Figure 2C). Interestingly, the NR response patterns were significantly different from those previously reported. The results of Torralbo et al. [45] were consistent with this experiment. Perez-Lopez et al. [46] noted that increasing the CO2 concentration alone did not affect the activity of actual nitrate reductase (NRact). However, when NaCl stress was applied at the same time, the NRact activity increased. Zaghdoud et al. [47] showed the same NR activity response to CO2 and drought stress as Usue. Anabel et al. [48] confirmed that NR activity showed a continuous increasing trend under drought and CO2 stresses. These differences in results may be due to the differences in the materials and experimental designs used. Further experimental verification of the mechanism of NR activity under CO2 stress is needed.
At the gene level, the results show that CO2 enrichment comprehensively inhibited the expression of key genes involved in nitrogen metabolism (Figure 2B,D,F,H,G). This highlighted the phenomenon that CO2 stress could damage nitrogen assimilation in Masson pine, which might be related to the carbon pool and source imbalance in needles [45]. Notably, when Vicente [49] studied the response mode of durum wheat nitrogen metabolism genes under the stress of nitrogen supply, temperature and CO2, he found that elevated CO2, atmospheric temperature and low N supply could induce the expression of GS and Fd-GOGAT with an upregulated trend, while the expression of other genes was inhibited. We speculated that the cross-talk mechanism between different stresses was the reason for this finding [50]. On the other hand, when we analyzed the correlation between genes and enzyme activities, we found that the enzyme activity and gene expression levels of NiR, GS and GOGAT showed a similar trend. They all decreased with the extension of treatment time. Interestingly, while the enzyme activity of NR remained unchanged, the gene expression decreased gradually (Figure 2C,D). In addition, GDH gene expression was gradually downregulated, while its enzyme activity increased (Figure 2A,B). The reason for the desynchronization of the NR gene and enzyme activity may be its complex stress mechanism. The reason for the difference between the gene expression and enzyme activity of GDH was speculated to be due to the presence of two types of GDH enzymes (NADH-GDH and NADPH-GDH) in plant cells [44], and the obtained enzyme activity data might contain both expression amounts, leading to an increase in the final amount.
Noteworthily, the previous studies have shown that the nitrogen fixation ability and the changes of nitrogen in plants are also affected by soil fertility [51,52], soil microorganisms [53,54] or metal elements [55]. We studied the change of elevated CO2 content as the main factor but did not verify or discuss the influence of other factors on nitrogen metabolism of Masson pine under the same condition. With the increase of atmospheric CO2 concentration, are there other factors that can affect nitrogen in Masson pine? What are their influence patterns and mechanisms? Is there any cross-talk between these factors? Perhaps all this needs to be proved by further research.

5. Conclusions

This study attempted to explore the response patterns of nitrogen metabolism in Masson pine needles to high CO2 stress. The experimental results showed that elevated CO2 leaded to an increase in the concentration of NO3 and amino acids and a decrease in the total nitrogen, inhibiting the key genes expression, decreasing the nitrogen metabolic enzymes activites except NR. The above results were consistent with the previous hypothesis. Noteworthily, GDH showed an increasing trend under the same conditions. We speculated that Masson pine mainly synthesized glutamic acid through the GDH pathway when CO2 concentration increased (Figure 3). Additional studies on this phenomenon are needed. As the first report on the response of nitrogen metabolism to CO2 stress in Masson pine needles, this study provides a valuable basis for further research in this area.

Author Contributions

Conceptualization, F.W. and K.J.; software, X.H. and J.L.; investigation, W.F., N.L. and X.S.; resources, B.Z. and N.L.; writing—original draft preparation, F.W. and X.S.; writing—review and editing, F.W. and K.J.; visualization, F.W., J.L. All authors approved the final draft. All authors have read and agreed to the published version of the manuscript.

Funding

The research was financially supported by the National Key R&D Program of China (2017YFD0600304) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Conflicts of Interest

The authors declare that they have no competing interests.

References

  1. Gomez-Casanovas, N.; Blanc-Betes, E.; Gonzalez-Meler, M.; Azcon-Bieto, J. Changes in Respiratory Mitochondrial Machinery and Cytochrome and Alternative Pathway Activities in Response to Energy Demand Underlie the Acclimation of Respiration to Elevated CO2 in the Invasive Opuntia ficus-indica1 [OA]. Plant Physiol. 2007, 145, 49–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. GCP. Carbon Budget. Available online: http://www.globalcarbonproject.org/carbonbudget (accessed on 13 March 2020).
  3. Ehleringer, J.R.; Schulze, E.D. Ecosystem Physiology Responses to Global Change; Cambridge University Press: Cambridge, UK; London, UK, 1999; pp. 14–16. [Google Scholar]
  4. Wang, W.M.; Wang, C.; Li, C.J.; Lin, W.H. Effects of elevated atmospheric CO2 concentrations on growth of plants. Acta Bot. Boreal. Occident. Sin. 2000, 20, 676–683. [Google Scholar]
  5. Thilakarathne, C.L.; Tausz-Posch, S.; Cane, K.; Norton, R.M.; Tausz, M.; Seneweera, S. Intraspecific variation in growth and yield response to elevated CO2 in wheat depends on the differences of leaf mass per unit area. Funct. Plant Boil. 2013, 40, 185–194. [Google Scholar] [CrossRef]
  6. Wu, Q.; Zhang, C.; Yu, Z.; Zhang, J.; Zhu, C.; Zhao, Z.; Xiong, J.; Chen, J. Effects of elevated CO2 and nitrogen addition on organic carbon and aggregates in soil planted with different rice cultivars. Plant Soil 2018, 432, 245–258. [Google Scholar] [CrossRef]
  7. Kleinhofs, A.; Warner, R.L. Advances in Nitrate Assimilation; Elsevier BV: Amsterdam, The Netherlands, 1990; pp. 89–120. [Google Scholar]
  8. Lea, P.J.; Robinson, S.A.; Stewart, G.R. The Enzymology and Metabolism of Glutamine, Glutamate and Asparagine Intermediary Nitrogen Metabolism the Biochemistry of Plants; Academic Press: New York, NY, USA, 2012; pp. 44–51. [Google Scholar]
  9. Men, Z.H.; Li, S.X. Effect of CO2 concentration on nitrogen metabolism of winter wheat. Zhongguo Nongye Kexue 2005, 38, 320–326. [Google Scholar]
  10. Xu, Y.B. Effect of CO2 Enrichment on Plant Growth and Nitrogen Use of Winter Wheat. Master’s Thesis, Northwest Agriculture and Forestry University, Xianyang, China, 2012. [Google Scholar]
  11. Bassirirad, H.; Thomas, R.B.; Reynolds, J.F. Differential responses of root uptake kinetics of NH4+ and NO3 to enriched atmospheric CO2 concentration in field-grown loblolly pine. Plant Cell Environ. 1996, 16, 957–962. [Google Scholar] [CrossRef]
  12. Su, W.L. Effects of Elevation CO2 on Nitrogen Uptake Characteristic and Growth of Larix Gmelinii and Pinus Sylvestris var. Mongolica. Master’s Thesis, Northeast Forestry University, Harbin, China, 2008. [Google Scholar]
  13. Johnson, D.; Cheng, W.; Ball, J. Effects of CO2 and N fertilization on decomposition and N immobilization in ponderosa pine litter. Plant Soil 2000, 224, 115–122. [Google Scholar] [CrossRef]
  14. Pang, J.; Zhu, J.G.; Liu, G. Effects of free-air CO2 enrichment (FACE) on concentrations of various N forms in rice tissues. J. Agro-Environ. Sci. 2005, 24, 833–837. [Google Scholar]
  15. Johansson, E.M.; Fransson, P.M.A.; Finlay, R.D.; Van Hees, P. Quantitative analysis of soluble exudates produced by ectomycorrhizal roots as a response to ambient and elevated CO2. Soil Boil. Biochem. 2009, 41, 1111–1116. [Google Scholar] [CrossRef]
  16. Chen, F.J.; Ge, F.; Liu, X.H. Responses of cotton to elevated CO2 and the effects on cotton aphid occurrences. Acta Ecol. Sin. 2004, 24, 991–996. [Google Scholar]
  17. Han, X. Effects of Free Air CO2 Enrichment on Wheat Growth and Yield: The Physiological Basis. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2012. [Google Scholar]
  18. Wang, X.J. Effect of CO2 Enrichment on Growth, Root Uptake Characteristics and Efficiency in Oilseed Rape; Hunan Agricultural University: Changsha, China, 2012. [Google Scholar]
  19. Li, Z.X. Effects of Elevated CO2 and Heat Stress on Growth and Development of Tea Plant. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2016. [Google Scholar]
  20. Yang, C.; Tan, T.; Zhang, L.; Yu, J.L.; Liao, Q.; Zhang, Z.H.; Liu, Q.; Rong, X.M.; Song, H.X.; Guan, C.Y. Effects of high CO2 concentration in atmosphere on nitrogen assimilation and plant growth of Oilseeds Rape (Brassica napus L.). Ecol. Environ. Sci. 2013, 22, 1688–1694. [Google Scholar]
  21. Hocking, P.; Meyer, C. Effects of CO2 Enrichment and Nitrogen Stress on Growth, and Partitioning of Dry Matter and Nitrogen in Wheat and Maize. Funct. Plant Boil. 1991, 18, 339–356. [Google Scholar] [CrossRef]
  22. Bauer, G.; Berntson, G.M. Ammonium and nitrate acquisition by plants in response to elevated CO2 concentration: The roles of root physiology and architecture. Tree Physiol. 2001, 21, 137–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Constable, J.V.H.; BassiriRad, H.; Lussenhop, J.; Zerihun, A. Influence of elevated CO2 and mycorrhizae on nitrogen acquisition: Contrasting responses in Pinus taeda and Liquidambar styraciflua. Tree Physiol. 2001, 21, 83–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Ni, Z.; Ye, Y.; Bai, T.; Xu, M.; Xu, L.-A. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion. Molecules 2017, 22, 1528. [Google Scholar] [CrossRef] [Green Version]
  25. Ni, Z.; Zhou, P.; Xu, M.; Xu, L.-A. Development and characterization of chloroplast microsatellite markers for Pinus massoniana and their application in Pinus (Pinaceae) species. J. Genet. 2018, 97, 53–59. [Google Scholar] [CrossRef]
  26. Zhang, Y.; Zhou, Z.; Yang, Q. Nitrogen (N) Deposition Impacts Seedling Growth of Pinus massoniana via N:P Ratio Effects and the Modulation of Adaptive Responses to Low P (Phosphorus). PLoS ONE 2013, 8, e79229. [Google Scholar] [CrossRef]
  27. Guan, L.L.; Wen, D. More nitrogen partition in structural proteins and decreased photosynthetic nitrogen-use efficiency of Pinus massoniana under in situ polluted stress. J. Plant Res. 2011, 124, 663–673. [Google Scholar] [CrossRef]
  28. Ni, C.; Wang, D.; Tao, Y. Variable weighted convolutional neural network for the nitrogen content quantization of Masson pine seedling leaves with near-infrared spectroscopy. Spectrochim. Acta Part A: Mol. Biomol. Spectrosc. 2019, 209, 32–39. [Google Scholar] [CrossRef]
  29. Treder, K.; Wanic, M.; Jastrzebska, M. The Influence of interaction between spring wheat and spring barley on accumulation of nitrogen, phosphorus and potassium in plants. Ann. UMCS, Agric. 2009, 64, 94–106. [Google Scholar] [CrossRef]
  30. Zhang, Z.L.; Li, X.F. Experimental Guidance of Plant Physiology; Higher Education Press: Beijing, China, 2016; pp. 36–48. [Google Scholar]
  31. Zhu, P.; Ma, Y.; Zhu, L.; Chen, Y.; Li, R.; Ji, K.S.; Ji, K.S. Selection of Suitable Reference Genes in Pinus massoniana Lamb. Under Different Abiotic Stresses for qPCR Normalization. Forests 2019, 10, 632. [Google Scholar] [CrossRef] [Green Version]
  32. XCMS. Meta XCMS. Available online: http://metlin.scripps.edu/xcms (accessed on 5 January 2020).
  33. Li, M.; Li, Y.; Zhang, W.; Li, S.; Gao, Y.; Ai, X.; Zhang, D.; Liu, B.; Li, Q. Metabolomics analysis reveals that elevated atmospheric CO2 alleviates drought stress in cucumber seedling leaves. Anal. Biochem. 2018, 559, 71–85. [Google Scholar] [CrossRef] [PubMed]
  34. Andersen, K.; Mayor, J.R.; Turner, B.L. Plasticity in nitrogen uptake among plant species with contrasting nutrient acquisition strategies in a tropical forest. Ecology 2017, 98, 1388–1398. [Google Scholar] [CrossRef] [PubMed]
  35. Marschner, H. Functions of mineral nurtients: Macronutrients. In The Mineral Nutrition of Higher Plants, 2nd ed.; Marschner, P., Ed.; Academic Press: New York, NY, USA, 1995; pp. 229–255. [Google Scholar]
  36. Zhao, X. Effect of Elevated Root-Zone CO2 Concentration on Melon Seeding Nitrogen Absorption, Metabolism and Transport in Root. Master’s Thesis, Shengyang Agricultural University, Shenyang, China, 2012. [Google Scholar]
  37. Thornton, B.; Robinson, D. Uptake and assimilation of nitrogen from solutions containing multiple N sources. Plant Cell Environ. 2005, 28, 813–821. [Google Scholar] [CrossRef]
  38. Ma, Q.; Wang, J.; Sun, Y.; Yang, X.; Ma, J.; Li, T.; Wu, L. Elevated CO2 levels enhance the uptake and metabolism of organic nitrogen. Physiol. Plant. 2017, 162, 467–478. [Google Scholar] [CrossRef]
  39. Takatani, N.; Ito, T.; Kiba, T.; Mori, M.; Miyamoto, T.; Maeda, S.I.; Omata, T. Effects of high CO2 on growth and metabolism of Arabidopsis seedlings during growth with a constantly limited supply of nitrogen. Plant Cell Physiol. 2013, 55, 281–292. [Google Scholar] [CrossRef] [Green Version]
  40. Teng, N.; Wang, J.; Chen, T.; Wu, X.; Wang, Y.; Lin, J. Elevated CO2 induces physiological, biochemical and structural changes in leaves of Arabidopsis thaliana. New Phytol. 2006, 172, 92–103. [Google Scholar] [CrossRef]
  41. Weigel, H.J.; Manderscheid, R. Crop growth responses to free air CO2 enrichment and nitrogen fertilization: Rotating barley, ryegrass, sugar beet and wheat. Eur. J. Agron. 2012, 43, 97–107. [Google Scholar] [CrossRef]
  42. Li, S.; Li, Y.; He, X.; Li, Q.; Liu, B.; Ai, X.; Zhang, D. Response of water balance and nitrogen assimilation in cucumber seedlings to CO2 enrichment and salt stress. Plant Physiol. Biochem. 2019, 139, 256–263. [Google Scholar] [CrossRef]
  43. Vega-Mas, I.; Pérez-Delgado, C.M.; Marino, D.; Fuertes-Mendizábal, T.; González-Murua, C.; Marquez, A.J.; Betti, M.; Estavillo, J.M.; González-Moro, M.B. Elevated CO2 Induces Root Defensive Mechanisms in Tomato Plants When Dealing with Ammonium Toxicity. Plant Cell Physiol. 2017, 58, 2112–2125. [Google Scholar] [CrossRef] [Green Version]
  44. Pan, R.C.; Wang, X.Q.; Li, N.H. Plant Physiology; Higher Education Press: Beijing, China, 2012; pp. 23–36. [Google Scholar]
  45. Torralbo, F.; Vicente, R.; Morcuende, R.; González-Murua, C.; Aranjuelo, I. C and N metabolism in barley leaves and peduncles modulates responsiveness to changing CO2. J. Exp. Bot. 2018, 70, 599–611. [Google Scholar] [CrossRef] [PubMed]
  46. Pérez-López, U.; Robredo, A.; Miranda-Apodaca, J.; Lacuesta, M.; Muñoz-Rueda, A.; Petite, A.M. Carbon dioxide enrichment moderates salinity-induced effects on nitrogen acquisition and assimilation and their impact on growth in barley plants. Environ. Exp. Bot. 2013, 87, 148–158. [Google Scholar] [CrossRef]
  47. Zaghdoud, C.; Carvajal, M.; Ferchichi, A.; Ballesta, M.M. Water balance and N-metabolism in broccoli (Brassica oleracea L. var. Italica) plants depending on nitrogen source under salt stress and elevated CO2. Sci. Total. Environ. 2016, 571, 763–771. [Google Scholar] [CrossRef] [PubMed]
  48. Anabel, R.; Usue, P.; Jon, M.; Maite, L.; Amaia, M.; Alberto, M. Elevated CO2 reduces the drought effect on nitrogen metabolism in barley plants during drought and subsequent recovery. Environ. Exp. Bot. 2011, 13, 399–408. [Google Scholar]
  49. Vicente, R.; Pérez, P.; Martinez-Carrasco, R.; Usadel, B.; Kostadinova, S.; Morcuende, R. Quantitative RT–PCR Platform to Measure Transcript Levels of C and N Metabolism-Related Genes in Durum Wheat: Transcript Profiles in Elevated [CO2] and High Temperature at Different Levels of N Supply. Plant Cell Physiol. 2015, 56, 1556–1573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Reyes, T.H.; Pompeiano, A.; Pompeiano, A.; Ciurli, A.; Lu, Y.; Guglielminetti, L.; Yamaguchi, J. Nitrate Reductase Modulation in Response to Changes in C/N Balance and Nitrogen Source in Arabidopsis. Plant Cell Physiol. 2018, 59, 1248–1254. [Google Scholar] [CrossRef] [Green Version]
  51. Koch, M.; Naumann, M.; Pawelzik, E.; Gransee, A.; Thiel, H. The Importance of Nutrient Management for Potato Production Part I: Plant Nutrition and Yield. Potato Res. 2019, 63, 97–119. [Google Scholar] [CrossRef] [Green Version]
  52. Di Martino, C.; Fioretto, A.; Palmieri, D.; Torino, V.; Palumbo, G. Influence of Tomato Plant Mycorrhization on Nitrogen Metabolism, Growth and Fructification on P-Limited Soil. J. Plant Growth Regul. 2019, 38, 1183–1195. [Google Scholar] [CrossRef]
  53. Batnini, M.; Lopez-Gomez, M.; Palma, F.; Haddoudi, I.; Kallala, N.; Zribi, K.; Mrabet, M.; Mhadhbi, H. Sinorhizobium spp inoculation alleviates the effect of Fusarium oxysporum on Medicago truncatula plants by increasing antioxidant capacity and sucrose accumulation. Appl. Soil Ecol. 2020, 150, 103458. [Google Scholar] [CrossRef]
  54. Agtuca, B.J.; Stopka, S.; Tuleski, T.R.; Amaral, F.P.D.; Evans, S.; Liu, Y.; Xu, D.; Monteiro, R.A.; Koppenaal, D.W.; Tolic, L.P.; et al. In-Situ Metabolomic Analysis of Setaria viridis Roots Colonized by Beneficial Endophytic Bacteria. Mol. Plant-Microbe Interact. 2020, 33, 272–283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Moran-Duran, S.A.; Flynn, R.P.; Heerema, R.; VanLeeuwen, D. Leaf Net Photosynthesis, Leaf Greenness, and Shoot Lignin Content of Nonbearing Pecan Trees at Two Nitrogen and Nickel Application Rates. HortScience 2020, 55, 231–236. [Google Scholar] [CrossRef]
  56. Taiz, L.; Zeiger, E. Plant Physiology; Sinauer Associates Press: North Carolina, NY, USA, 2006; pp. 57–78. [Google Scholar]
Figure 1. Effects of elevated CO2 on different nitrogen forms. (A) Total nitrogen, (B) nitrate, (C) nitrite, (D) ammonium. Significant differences (p < 0.05) are indicated with lowercase letters. FW, fresh weight.
Figure 1. Effects of elevated CO2 on different nitrogen forms. (A) Total nitrogen, (B) nitrate, (C) nitrite, (D) ammonium. Significant differences (p < 0.05) are indicated with lowercase letters. FW, fresh weight.
Forests 11 00390 g001
Figure 2. Response of nitrogen metabolic enzyme activities and gene expression changes in Masson pine needles at different times under CO2 stress. Significant differences (p < 0.05) are indicated by lowercase letters. (A,B) Glutamate dehydrogenase (GDH), (C,D) nitrate reductase (NR), (E,F) nitrite reductase (NiR), (G,H) glutamine synthetase (GS), and (I,J) glutamate synthase (GOGAT). FW, fresh weight; γ-GHM, γ-glutamyl hydroxamate; NADH, nicotinamide adenine dinucleotide.
Figure 2. Response of nitrogen metabolic enzyme activities and gene expression changes in Masson pine needles at different times under CO2 stress. Significant differences (p < 0.05) are indicated by lowercase letters. (A,B) Glutamate dehydrogenase (GDH), (C,D) nitrate reductase (NR), (E,F) nitrite reductase (NiR), (G,H) glutamine synthetase (GS), and (I,J) glutamate synthase (GOGAT). FW, fresh weight; γ-GHM, γ-glutamyl hydroxamate; NADH, nicotinamide adenine dinucleotide.
Forests 11 00390 g002
Figure 3. Influence of high CO2 concentration on nitrogen metabolism regulation in Masson pine needles. Biosynthesis pathways according to Taiz [56]. The green and black rectangles represent the chloroplast and cytosol, respectively. The gene expression, enzyme activities and the content of different nitrogen forms are shown in red, blue and orange, respectively. Up- and downward-facing arrows indicate up- and downregulated expression, respectively. The blue line in NR indicates that there is no difference in the enzyme activity expression of NR, and the specific data are shown in Figure 1B. α-KG, α-Ketoglutaric acid; Fdred, Reduced ferredoxin.
Figure 3. Influence of high CO2 concentration on nitrogen metabolism regulation in Masson pine needles. Biosynthesis pathways according to Taiz [56]. The green and black rectangles represent the chloroplast and cytosol, respectively. The gene expression, enzyme activities and the content of different nitrogen forms are shown in red, blue and orange, respectively. Up- and downward-facing arrows indicate up- and downregulated expression, respectively. The blue line in NR indicates that there is no difference in the enzyme activity expression of NR, and the specific data are shown in Figure 1B. α-KG, α-Ketoglutaric acid; Fdred, Reduced ferredoxin.
Forests 11 00390 g003
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer Sequence (5’→3’)
qGS_FForwardGACTTCTGAACAGCAAAATGGTC
qGS_RReverseGCAATCAGTTTAGATGGGCATAG
qNR_FForwardAACTGACAGCACTCTGAAACTCC
qNR_RReverseAATATACATGTGGCCGTGAGAAG
qGDH_FForwardGGTCATTCTCCTGCAGTTGTTAC
qGDH_RReverseATGTTCAGCTAACAAGGCTTCTG
qNiR_FForwardGAAGACGGGAGACATAGAGGACT
qNiR_RReverseTAGATATAATCCGGGTCCACCTT
qGOGAT_FForwardCAAATTCACTGTTGTGCAGAGAG
qGOGAT_RReverseAACAGCAACAGCAGCTACTTCTC
Table 2. Effect of elevated CO2 on free amino acids.
Table 2. Effect of elevated CO2 on free amino acids.
0 h6 h12 h24 h
Aspartate0.030 ± 0.002a0.031 ± 0.052a0.010 ± 0.052a0.007 ± 0.001a
Serine0.357 ± 0.124a0.368 ± 0.156a0.199 ± 0.074b0.422 ± 0.084a
Threonine0.366 ± 0.075b0.490 ± 0.217b0.563 ± 0.200b1.111 ± 0.419a
Glutamate4.086 ± 0.657a3.387 ± 0.474ab3.396 ± 0.860ab2.555 ± 0.647b
Glycine0.027 ± 0.006a0.026 ± 0.005a0.031 ± 0.010a0.029 ± 0.005a
Alanine0.116 ± 0.022b0.267 ± 0.083a0.232 ± 0.073a0.275 ± 0.062a
Cysteine0.010 ± 0.006a0.008 ± 0.002a0.010 ± 0.007a0.011 ± 0.006a
Valine0.592 ± 0.284a0.34 ± 0.128b0.215 ± 0.129b0.243 ± 0.097b
Methionine0.048 ± 0.021a0.020 ± 0.007b0.013 ± 0.001b0.013 ± 0.004b
Isoleucine0.002 ± 0.001a0.001 ± 0.001b0.002 ± 0.001ab0.001 ± 0.001b
Phenylalanine0.299 ± 0.061a0.288 ± 0.055a0.285 ± 0.167a0.359 ± 0.162a
Lysine0.500 ± 0.920a0.556 ± 0.958a0.492 ± 0.209a0.517 ± 0.384a
Histidine0.300 ± 0.084b0.713 ± 0.528ab0.622 ± 0.726ab1.271 ± 0.994a
Arginine1.748 ± 1.687b4.616 ± 3.912ab3.892 ± 5.721ab7.702 ± 4.922a
Glutamine 5.793 ± 3.521a3.734 ± 2.220ab3.125 ± 1.090ab1.895 ± 1.039b
Leucine0.873 ± 0.186b0.516 ± 0.144c0.72 ± 0.173bc1.327 ± 0.298a
Tyrosine0.276 ± 0.071a0.206 ± 0.096a0.236 ± 0.090a0.289 ± 0.113a
Tryptophan1.414 ± 0.815b1.794 ± 0.332ab2.362 ± 0.909a2.650 ± 0.537a
Proline0.648 ± 0.202a0.493 ± 0.151ab0.483 ± 0.208ab0.310 ± 0.071b
Asparagine0.114 ± 0.056b0.214 ± 0.091b0.426 ± 0.336b0.933 ± 0.733a
Total17.572 ± 1.490b18.068 ± 1.370b17.314 ± 1.239b21.230 ± 2.944a
Significant differences (p < 0.05) are indicated by lowercase letters.

Share and Cite

MDPI and ACS Style

Wu, F.; Sun, X.; Hu, X.; Zou, B.; Lin, N.; Lin, J.; Ji, K. Response of Nitrogen Metabolism in Masson Pine Needles to Elevated CO2. Forests 2020, 11, 390. https://doi.org/10.3390/f11040390

AMA Style

Wu F, Sun X, Hu X, Zou B, Lin N, Lin J, Ji K. Response of Nitrogen Metabolism in Masson Pine Needles to Elevated CO2. Forests. 2020; 11(4):390. https://doi.org/10.3390/f11040390

Chicago/Turabian Style

Wu, Fan, Xiaobo Sun, Xingfeng Hu, Bingzhang Zou, Nengqing Lin, Jingquan Lin, and Kongshu Ji. 2020. "Response of Nitrogen Metabolism in Masson Pine Needles to Elevated CO2" Forests 11, no. 4: 390. https://doi.org/10.3390/f11040390

APA Style

Wu, F., Sun, X., Hu, X., Zou, B., Lin, N., Lin, J., & Ji, K. (2020). Response of Nitrogen Metabolism in Masson Pine Needles to Elevated CO2. Forests, 11(4), 390. https://doi.org/10.3390/f11040390

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop