Next Article in Journal
Nitrogen Addition Alleviates Microbial Nitrogen Limitations and Promotes Soil Respiration in a Subalpine Coniferous Forest
Previous Article in Journal
Genetic Parameter Estimates and Genotype × Environment Interactions of Growth and Quality Traits for Betula alnoides Buch.-Ham. ex D. Don in Four Provenance-Family Trials in Southern China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Genetic Markers for Species Conservation and Timber Tracking: Development of Microsatellite Primers for the Tropical African Tree Species Prioria balsamifera and Prioria oxyphylla

by
Samuel Vanden Abeele
1,2,*,
Olivier J. Hardy
2,
Hans Beeckman
3,
Bhély Angoboy Ilondea
3,4 and
Steven B. Janssens
1,5
1
Meise Botanic Garden, Nieuwelaan 38, 1860 Meise, Belgium
2
Evolutionary Biology and Ecology, Faculté des Sciences, Université Libre de Bruxelles, Av. F.D. Roosevelt 50, 1050 Brussels, Belgium
3
Service of Wood Biology, Royal Museum for Central Africa, 3080 Tervuren, Belgium
4
Institut National pour l’Etude et la Recherche Agronomiques, Kinshasa BP 2037, Congo
5
Plant Conservation and Population Biology, KU Leuven, 3000 Leuven, Belgium
*
Author to whom correspondence should be addressed.
Forests 2019, 10(11), 1037; https://doi.org/10.3390/f10111037
Submission received: 30 September 2019 / Revised: 8 November 2019 / Accepted: 13 November 2019 / Published: 15 November 2019

Abstract

Research Highlights: Two novel sets of polymorphic microsatellite markers were developed for Prioria balsamifera and Prioria oxyphylla through high-throughput sequencing. Validation in two populations of each species proved the utility of the developed primers to estimate genetic diversity at population level. Background and Objectives: Prioria balsamifera and Prioria oxyphylla are tropical tree species from Central Africa. They produce a high-quality, multi-purpose timber that is of great interest to the international market. Prioria balsamifera has been included as ‘endangered’ on the IUCN Red List of Threatened Species. In order to set up adequate management plans and facilitate timber tracking, knowledge on the genetic diversity at population level is needed. Therefore, we aim to develop microsatellite markers that can be used for species conservation, forensics, plant breeding and population genetics studies. Materials and Methods: Genomic DNA of P. balsamifera and P. oxyphylla was sequenced on an Illumina NextSeq platform (Illumina Inc., San Diego, CA, USA), generating 829,421 and 772,018 paired-end reads that contained 7148 and 7004 microsatellite sequences, respectively. The QDD-pipeline was used to design primers, which were tested for amplification in two populations of each species. Cross-species amplification was tested in all seven African Prioria species. Results: For P. balsamifera, 16 polymorphic microsatellite markers were developed and combined in three multiplexes. Inbreeding appeared to be absent but genetic diversity was low in both populations. For P. oxyphylla, 15 polymorphic microsatellite markers were developed and combined in three multiplexes. Genetic diversity was low in both populations and estimated null allele frequencies were high for multiple loci. Cross-species amplification tests demonstrated the occurrence of conserved loci that amplified for most of the African Prioria species. Conclusions: The microsatellite markers prove to be useful for estimating genetic diversity at population level. These novel markers can be used to study gene flow and spatial genetic structure in Prioria species, which is needed to set up proper conservation guidelines and to prevent genetic erosion.

1. Introduction

The genus Prioria Griseb. (Fabaceae, subfamily Detarioideae [1]) comprises 14 tree species that occupy various habitats in tropical regions [2]. Multiple species of the genus are of national economic importance and four are listed as ‘vulnerable’ or ‘endangered’ on the IUCN Red List of Threatened Species [3]. Until the taxonomic revision by Breteler in 1999 [2], the name Prioria was only used for the American species (Prioria copaifera). However, based on morphological evidence, the genera Kingiodendron from Asia and the Pacific region (six species) and Gossweilerodendron and Oxystigma from Africa (7 species) were lumped into the genus Prioria [2].
In Central Africa, Prioria balsamifera (Verm.) Breteler (syn. Gossweilerodendron balsamiferum) and Prioria oxyphylla (Harms) Breteler (syn. Pterygopodium oxyphyllum and Oxystigma oxyphyllum) are of great interest for the national and international market, since both tree species produce a high-quality multi-purpose timber. The wood of Prioria balsamifera, traded as ‘tola’ or ‘agba’, is used for construction, flooring, joinery, ship building, interior trim, furniture, veneer and plywood [4]. In riverine areas, the boles are traditionally used to make canoes [5]. Furthermore, the sapwood resin can be applied to protect furniture from wood parasites [5] or is used as illuminant [4]. Since the wood of P. balsamifera resembles that of African mahogany (Entandrophragma and Khaya spp.), it has been traded as a substitute. Also, P. balsamifera logs are sometimes mixed with those of P. joveri, which is classified as ‘vulnerable’ on the IUCN Red List of Threatened Species [4]. Prioria balsamifera can be found in lowland semi-deciduous and evergreen forests from southeast Nigeria to Cabinda (Angola) and the Democratic Republic of Congo (DR Congo) [4]. Although P. balsamifera is shade tolerant and natural generation can be abundant, it has a scattered forest distribution—often occurring in small groups of a few trees—caused by openings in the canopy that needed to reach maturity [4]. Prioria oxyphylla occurs scattered in lowland rainforests from southeast Nigeria and Central African Republic to Cabinda and DR Congo [6]. Although Prioria oxyphylla produces timber similar in quality to that of P. balsamifera, only small amounts are traded on the international market [6]. The wood is known as ‘tchitola’ and is used for light construction works, flooring, joinery, furniture, plywood, and veneer. The latter wood product is used as a substitute for veneer of walnut (Juglans regia) and jatoba or guapinol (Hymenaea courbaril) in Europe and the United States [6].
Both P. balsamifera and P. oxyphylla populations have suffered from heavy exploitation and habitat loss or degradation [4,6]. Therefore, P. balsamifera has been listed as ‘endangered’ on the IUCN Red List. Furthermore, the Food and Agriculture Organization of the United Nations (FAO) recommends protection of the genetic material in order to set up planting programmes in the future [3]. Prioria oxyphylla is not listed on the IUCN Red List but despite its large distribution area, its occurrence is scattered and is uncommon in many regions of its distribution range [6]. Consequently, the species may be susceptible to genetic erosion, so characterization of its genetic variation and monitoring of its populations is highly recommended. Additionally, knowledge on natural regeneration, gene flow and genetic diversity is needed to design adequate management plans which ensure a sustainable production and harvest, especially since the volume of timber available for the international market appears to be limited [6]. Similar issues occur for P. balsamifera. Despite the commercial importance of Prioria timber for the international market, there has been no attention for genetic research and silviculture for future planting programmes [4].
In order to obtain more insights into the genetic diversity at population level, microsatellite markers have proven to be a valuable tool. Microsatellites, also referred to as simple sequence repeats (SSRs) or short tandem repeats (STRs), are short repetitive regions (1 to 6 bp) in the genome that mainly occur in non-coding DNA [7]. Because of their high levels of polymorphism, co-dominance and reproducibility, microsatellites have proven their utility in many research areas such as plant breeding, forensics, species conservation, population genetics, phylogeography and species delimitation [8,9,10,11,12,13].
Given this broad range of applications, the development of microsatellites can be considered as very beneficial for P. balsamifera and P. oxyphylla. For example, by applying them in population genetics studies, information can be gained on the genetic composition of both species, as well as on the amount of gene flow between populations. This knowledge is essential to prevent genetic erosion and to make proper assessments for conservation management. Moreover, P. balsamifera and P. oxyphylla may be suitable for commercial plantations. For this, information about the intraspecific diversity is of great importance, as it optimises breeding programmes by enabling the selection of superior parent trees. Properly managed plantations or production forests can reduce the pressure on wild stands and increase the timber availability for the international market. Additionally, microsatellites provide a useful tool for timber tracking based on DNA fingerprinting [10,14,15]. Since illegal logging causes degradation and loss of forests worldwide, and trade in illegal timber and wood products distorts global markets, unfalsifiable methods to identify the origin of timber, such as DNA fingerprinting, are extremely valuable. Moreover, since microsatellite loci are usually short fragments (<500 bp), amplification from degraded DNA, often found in logs or processed wood, is possible.
To address the listed issues, we aim to develop a novel set of microsatellite markers for Prioria balsamifera and Prioria oxyphylla using high-throughput sequencing data. These markers will be validated in two populations of each species in order to assess their applicability. Additionally, cross-species amplification will be tested in all seven African Prioria species.

2. Materials and Methods

2.1. Microsatellite Primer Development

DNA was isolated from silica-dried leaves of Prioria balsamifera (corresponding voucher: BR0000013003845 [16]) and Prioria oxyphylla (corresponding voucher: BR0000013007126 [17]), using a cetyltrimethylammonium bromide (CTAB) protocol [18] with an additional sorbitol washing step. Subsequently, the extracted DNA was used to develop a non-enriched genomic library for each species using a modified version of the protocol in [19], described in full by Tosso et al. [20]. Genomic libraries were sent for sequencing on an Illumina NextSeq platform at GIGA (Liège, Belgium). The sequencing run generated 829,421 paired-end 150 bp reads for P. balsamifera and 772,018 paired-end 150 bp reads for P. oxyphylla.
Reads were merged with FLASH v1.2.11 (Center for Computational Biology, Baltimore, MD, USA) [21] and the QDD pipeline [22] was used to identify microsatellite loci, for which suitable primers were developed with the implemented Primer3 algorithm [23] using the parameters described in [24]. For P. balsamifera, 7148 microsatellite sequences with primers were generated, from which the 24 best primer pairs, forward and reverse, were selected following the criteria described in [22]. All chosen microsatellite loci contained 8 to 15 di- or trinucleotide repeats. For P. oxyphylla, 7004 microsatellite sequences with primers were generated and as for P. balsamifera, the 24 best primer pairs were selected. Here, all chosen microsatellite loci contained 8 to 23 di- or trinucleotide repeats.
First, the two sets of the 24 selected primer pairs were tested individually on three individuals of the corresponding species. The products used for the amplification reaction and the PCR conditions were the same as in [25]. PCR products were visualized with a QIAxcel Advanced system (QIAGEN, Venlo, Netherlands) to check whether amplification was successful.
Second, the primers that showed amplification in at least one of the three samples were reamplified and genotyped to assess their level of polymorphism and to check the readability of the peak pattern. The amplification protocol with low-cost M13-like fluorescent labelling and the PCR conditions are described in [25]. In this study, four universal sequences (Q1–Q4, Table 1) and fluorescent dyes (6-FAM, NED, VIC and PET respectively) (Applied Biosystems, Foster City, CA, USA) were used; the annealing temperature during the first 25 repeated cycles was set to 55 °C. Genotyping was done on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA), with 0.8 µL PCR product (3 to 4 samples were pooled), 10 µL Hi-Di Formamide (Applied Biosystems) and 0.3 µL MapMarker 500 labelled with DY-632 (Eurogentec, Liège, Belgium). The resulting electropherograms were analysed using the Microsatellite Plugin 1.4.6 in Geneious 9.1.8 (Biomatters Ltd., Auckland, New Zealand).
Third, unreadable and monomorphic loci were excluded, while the remaining loci were combined in various multiplexes per species using Multiplex Manager 1.2 [26] to reduce costs and hands-on time in the lab. Amplification of the different primer combinations was tested in seven samples per species with the Type-it Microsatellite PCR kit (QIAGEN) using the amplification volumes and PCR conditions described in [25], except that the annealing temperature during the first 25 repeated cycles was at 56 °C instead of 57 °C.
Cross-species amplification was tested with the final P. balsamifera and P. oxyphylla multiplexes on the other five African Prioria species: P. buchholzii, P. msoo, P. gilbertii, P. mannii and P. joveri.
The microsatellite containing sequences obtained through high-throughput sequencing and used for the primer development were deposited on GenBank (Table 1).

2.2. Microsatellite Characterization and Preliminary Population Genetics Analyses

The newly developed primer sets were validated for population genetics with 65 individuals of P. balsamifera and 53 individuals of P. oxyphylla, collected at two locations in the DR Congo, the Luki Biosphere Reserve (5°41′42.4″S, 13°11′05.5″E) and the Yangambi Biosphere Reserve (0°48′01.2″N, 24°28′59.5″E) (Figure S1). For both species and populations, a reference voucher was deposited at the herbarium of Meise Botanic Garden, Belgium (barcodes Prioria balsamifera: BR0000013572778 (Luki) and BR0000013277444 (Yangambi); barcodes Prioria oxyphylla: BR0000015225634V (Luki) and BR0000013007126 (Yangambi)).
Extractions were made from leaves (silica-dried or herbarium) and cambium using a cetyltrimethylammonium bromide (CTAB) protocol [18] with an additional sorbitol washing step. The PCR and genotyping conditions were the same as those in the third step of the primer development (see Section 2.1). The resulting electropherograms were analysed using the Microsatellite Plugin 1.4.6 in Geneious 9.1.8 (Biomatters Ltd.).
The number of alleles per locus (NA), observed (Ho) and expected (He) heterozygosity, Weir and Cockerham’s fixation index (FIS) and the deviation from Hardy-Weinberg Equilibrium (HWE) were calculated with SPAGeDi 1.5d [27]. The Jackknife method in INEST v2.2 [28] was used to estimate the expected frequency of null alleles. Polymorphism Information Content (PIC) was calculated using CERVUS 3.0.7 (Field Genetics Ltd., London, UK) [29].

3. Results and Discussion

3.1. Microsatellite Primer Development

For Prioria balsamifera, 23 out of the 24 primer pairs selected for testing in the laboratory could be amplified in at least one of three samples. These 23 pairs were then reamplified and genotyped, resulting in 16 useful polymorphic primer pairs, which were combined in three multiplexes (Table 1) and used for all subsequent analyses. Two out of the seven removed primer pairs (Table S1) appeared monomorphic in the seven samples used for testing, while another four pairs failed to amplify, probably due to problems with the incorporation of the fluorescently labelled Q-tails. A last primer pair showed polymorphism and successfully amplified in simplex, but amplification was unsuccessful in all multiplex combinations that were tested.
For Prioria oxyphylla, 16 out of 24 primer pairs amplified in at least one of three samples. Reamplification and genotyping of these 16 pairs yielded 15 readable polymorphic primer pairs, which were combined in three multiplexes (Table 1). The pair that was removed showed multiple peaks and stutters, which made it impossible to infer allele sizes and to define bins.

3.2. Population Genetics in Prioria balsamifera

The final three microsatellite multiplexes containing 16 primers for P. balsamifera were tested for population genetic analyses in 65 individuals originating from Luki (n = 34) and Yangambi (n = 31). Microsatellite loci showed one to nine alleles per locus in both populations combined, with an average of 4.310 alleles per locus (Table 2). Although loci PriB4 and PriB14 appeared to be monomorphic in individuals from Luki and Yangambi, multiple alleles were detected when testing for polymorphism during primer development. Consequently, both primers could be informative in genetic studies that consider a larger part of the species’ distribution area.
The observed and expected heterozygosity ranged from 0 to 0.735 (average Ho = 0.412) and 0 to 0.741 (average He = 0.399) in Luki, respectively. In Yangambi, Ho ranged from 0 to 0.655 (average = 0.273) and He from 0 to 0.749 (average = 0.302) (Table 2). Deviation from HWE occurred at one locus (PriB12) in the Luki population and two loci (PriB02 and PriB18) in the Yangambi population. These loci were associated with higher null allele frequencies (0.141, 0.125 and 0.209, respectively). Although inbreeding appeared to be absent, genetic diversity was low in both P. balsamifera populations. Hence, genetic erosion appears to be a real risk and efforts should be made to protect P. balsamifera genetic resources. PIC values ranged from 0 to 0.737, with an average of 0.364. Thus, most of the developed microsatellite markers could be useful for parentage analyses and setting up breeding programmes for the endangered P. balsamifera.

3.3. Population Genetics in Prioria oxyphylla

For P. oxyphylla, the final three microsatellite multiplexes containing 15 primers were validated in 53 individuals collected in Luki (n = 21) and Yangambi (n = 32). Microsatellite loci showed 2 to 10 alleles per locus in both populations combined, with an average of 5.467 alleles per locus (Table 2). Interestingly, locus PriO4 showed only two alleles, with each allele being specific to either Luki or Yangambi. So, based on the allele observed for this locus only, the origin of an individual could be determined when considering trees from Luki and Yangambi.
Ho ranged from 0 to 0.762 (average = 0.261) and He from 0 to 0.788 (average = 0.429) in Luki, and similarly in Yangambi, Ho ranged from 0 to 0.750 (average = 0.289) and He from 0 to 0.810 (average = 0.488) (Table 2). Multiple loci deviated from HWE in both Luki and Yangambi (4 and 7 respectively). All these loci showed null alleles. Surprisingly, various loci were characterized by high levels of missing genotypes. Only the sample used for the primer development showed successful amplification for all 15 loci. PIC values ranged from 0.136 to 0.782 with an average of 0.564. Hence, the developed markers could be a useful tool for parentage studies and for setting up breeding programmes.

3.4. Microsatellite Cross-Species Amplification in African Prioria

The cross-species amplification tests showed that multiple loci from both microsatellite sets are conserved across species (Table 3), as various loci were successfully amplified in the different African Prioria species. Therefore, the primers developed in this study could be of great value for genetic studies focused on other Prioria species as well. Since P. oxyphylla and P. buchholzii are closely related sister-taxa [30], cross-species amplification appeared to be highly successful. The low amplification success in P. joveri (both primer sets) and P. balsamifera (P. oxyphylla primer set) could result from higher species divergence.

4. Conclusions

The developed sets of microsatellite primers for Prioria balsamifera and Prioria oxyphylla, containing 16 and 15 polymorphic loci respectively, appear to be useful for estimating genetic diversity at population level. The novel markers can be used to study gene flow and spatial genetic structure in Prioria species, which is needed to prevent genetic erosion and to set up proper conservation guidelines. Additionally, the microsatellite markers can be valuable for timber tracking through DNA fingerprinting.

Supplementary Materials

The following are available online at https://www.mdpi.com/1999-4907/10/11/1037/s1, Figure S1: Map indicating the sampling locations in the Democratic Republic of Congo: Luki Biosphere Reserve and Yangambi Biosphere Reserve.

Author Contributions

S.V.A., O.J.H. and S.B.J. conceived and designed the experiments, S.V.A. performed the experiments, analysed the data and wrote the manuscript. O.J.H., H.B., B.A.I. and S.B.J. revised the manuscript.

Acknowledgments

We are grateful to Jérémy Migliore, Esra Kaymak (ULB-EBE), Pieter Asselman and Wim Baert (MeiseBG) for their assistance in the laboratory. This study is part of the HERBAXYLAREDD and AFRIFORD projects (BR/143/A3/HERBAXYLAREDD, BR/132/A1/AFRIFORD), funded by the Belgian Belspo-BRAIN program axis 4. This study has also received funding from the European Union’s Horizon 2020 research and innovation program under the Marie Sklodowska-Curie grant agreement N° 765000, and the Fund for Scientific Research F.R.S.-FNRS (grant J.0292.17F).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. The Legume Phylogeny Working Group (LPWG). A new subfamily classification of the Leguminosae based on a taxonomically comprehensive phylogeny. Taxon 2017, 66, 44–77. [Google Scholar] [CrossRef] [Scilit]
  2. Breteler, F.J. A revision of Prioria, including Gossweilerodendron, Kingiodendron, Oxystigma, and Pterygopodium (Leguminosae-Caesalpinioideae-Detarieae) with emphasis on Africa; Blackhuys Publishers: Leiden, The Netherlands, 1999; Volume 99, ISBN 9057820455. [Google Scholar]
  3. IUCN The IUCN Red List of Threatened Species. Available online: https://www.iucnredlist.org/ (accessed on 8 July 2019).
  4. Cobbinah, J.R.; Oben, E.A. Prioria balsamifera (Vermoesen) Breteler; PROTA (Plant Resources of Tropical Africa/Ressources végétales de l’Afrique tropicale): Wageningen, The Netherlands, 2011; Available online: https://uses.plantnet-project.org/en/Prioria_balsamifera_(PROTA) (accessed on 8 July 2019).
  5. Malele Mbala, S. Situation des ressources génétiques forestières de la République démocratique du Congo; Forest Genetic Resources Working Paper 56; FAO: Rome, Italy, 2003. [Google Scholar]
  6. Lemmens, R.H.M.J. Prioria oxyphylla (Harms) Breteler; PROTA (Plant Resources of Tropical Africa/Ressources végétales de l’Afrique tropicale): Wageningen, The Netherlands, 2011; Available online: https://uses.plantnet-project.org/en/Prioria_oxyphylla_(PROTA) (accessed on 8 July 2019).
  7. Ellegren, H. Microsatellites: simple sequences with complex evolution. Nat. Rev. Genet. 2004, 5, 435–445. [Google Scholar] [CrossRef] [Scilit]
  8. Ma, S.; Dong, W.; Lyu, T.; Lyu, Y. An RNA Sequencing Transcriptome Analysis and Development of EST-SSR Markers in Chinese Hawthorn through Illumina Sequencing. Forests 2019, 10, 82. [Google Scholar] [CrossRef] [Scilit]
  9. Lissambou, B.-J.; Couvreur, T.L.P.; Atteke, C.; Stévart, T.; Piñeiro, R.; Dauby, G.; Monthe, F.K.; Ikabanga, D.U.; Sonké, B.; M’batchi, B.; et al. Species delimitation in the genus Greenwayodendron based on morphological and genetic markers reveals new species. Taxon 2019, 13. [Google Scholar] [CrossRef] [Scilit]
  10. Degen, B.; Ward, S.E.; Lemes, M.R.; Navarro, C.; Cavers, S.; Sebbenn, A.M. Verifying the geographic origin of mahogany (Swietenia macrophylla King) with DNA-fingerprints. Forensic Sci. Int. Genet. 2013, 7, 55–62. [Google Scholar] [CrossRef] [Scilit]
  11. Blanc-Jolivet, C.; Degen, B. Use of DNA fingerprints to control the origin of sapelli timber (Entandrophragma cylindricum) at the forest concession level in Cameroon. Forensic Sci. Int. Genet. 2012, 6, 487–493. [Google Scholar] [CrossRef] [Scilit]
  12. Degen, B.; Blanc, L.; Caron, H.; Maggia, L.; Kremer, A.; Gourlet-Fleury, S. Impact of selective logging on genetic composition and demographic structure of four tropical tree species. Biol. Conserv. 2006, 131, 386–401. [Google Scholar] [CrossRef] [Scilit]
  13. Hardy, O.J.; Born, C.; Budde, K.; Daïnou, K.; Dauby, G.; Duminil, J.; Ewédjé, E.E.B.K.; Gomez, C.; Heuertz, M.; Koffi, G.K.; et al. Comparative phylogeography of African rain forest trees: A review of genetic signatures of vegetation history in the Guineo-Congolian region. Comptes Rendus Geosci. 2013, 345, 284–296. [Google Scholar] [CrossRef] [Scilit]
  14. Lowe, A.J.; Cross, H.B. The application of DNA methods to timber tracking and origin verification. IAWA 2011, 32, 251–262. [Google Scholar] [CrossRef] [Scilit]
  15. Finkeldey, R.; Leinemann, L.; Gailing, O. Molecular genetic tools to infer the origin of forest plants and wood. Appl. Microbiol. Biotechnol. 2010, 85, 1251–1258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Meise Botanic Garden BR0000013003845—Prioria balsamifera (Vermoesen) Breteler. Available online: http://www.botanicalcollections.be/specimen/BR0000013003845 (accessed on 18 July 2019).
  17. Meise Botanic Garden BR0000013007126—Prioria oxyphylla (Harms) Breteler. Available online: http://www.botanicalcollections.be/specimen/BR0000013007126 (accessed on 18 July 2019).
  18. Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh plant tissue. Focus (Madison) 1990, 12, 13–15. [Google Scholar]
  19. Rohland, N.; Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 2012, 939–946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Tosso, F.; Hardy, O.J.; Doucet, J.-L.; Daïnou, K.; Kaymak, E.; Migliore, J. Evolution in the Amphi-Atlantic tropical genus Guibourtia (Fabaceae, Detarioideae), combining NGS phylogeny and morphology. Mol. Phylogenet. Evol. 2018, 120, 83–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Magoc, T.; Salzberg, S. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [Scilit]
  22. Meglécz, E.; Pech, N.; Gilles, A.; Dubut, V.; Hingamp, P.; Trilles, A.; Grenier, R.; Martin, J.-F. QDD version 3.1: A user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate. Mol. Ecol. Resour. 2014, 14, 1302–1313. [Google Scholar] [CrossRef] [Scilit]
  23. Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. Bioinforma. Methods Protoc. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar]
  24. Malausa, T.; Gilles, A.; Meglécz, E.; Blanquart, H.; Duthoy, S.; Costedoat, C.; Dubut, V.; Pech, N.; Castagnone-Sereno, P.; Délye, C.; et al. High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Mol. Ecol. Resour. 2011, 11, 638–644. [Google Scholar] [CrossRef] [Scilit]
  25. Vanden Abeele, S.; Hardy, O.J.; Janssens, S.B. Isolation of microsatellite loci in the African tree species Staudtia kamerunensis (Myristicaceae) using high-throughput sequencing. Mol. Biol. Rep. 2018, 45, 1539–1544 . [Google Scholar] [CrossRef] [Scilit]
  26. Holleley, C.E.; Geerts, P.G. Multiplex Manager 1.0: A cross-platform computer program that plans and optimizes multiplex PCR. Biotechniques 2009, 46, 511–517. [Google Scholar] [CrossRef] [Scilit]
  27. Hardy, O.J.; Vekemans, X. SPAGeDi: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes 2002, 2, 618–620. [Google Scholar] [CrossRef] [Scilit]
  28. Chybicki, I.J.; Burczyk, J. Simultaneous estimation of null alleles and inbreeding coefficients. J. Hered. 2009, 100, 106–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. De La Estrella, M.; Forest, F.; Klitgård, B.; Lewis, G.P.; Mackinder, B.A.; De Queiroz, L.P.; Wieringa, J.J.; Bruneau, A. A new phylogeny-based tribal classification of subfamily Detarioideae, an early branching clade of florally diverse tropical arborescent legumes. Sci. Rep. 2018, 8, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Table 1. Characterization of polymorphic microsatellite markers isolated from Prioria balsamifera (16 loci) and Prioria oxyphylla (15 loci).
Table 1. Characterization of polymorphic microsatellite markers isolated from Prioria balsamifera (16 loci) and Prioria oxyphylla (15 loci).
LocusPrimer Sequences (5′-3′) 1Labelled PrimerRepeat Motif 2Allele Size Range (bp)GenBank Accession No.
Prioria balsamifera
Multiplex 1
PriB07F: CACTGCTTAGAGCGATGCTCAGGGCAAGATGAATAATGQ3-VIC(TC)8144–147MN648900
R: AAAGGAACCACCGATGAATA
PriB19F: CACTGCTTAGAGCGATGCTCTGAATTATTATCAGCCACTTCQ3-VIC(TC)8198–207MN648909
R: GGCGTTTCTTAATTTGGTTT
PriB23F: CACTGCTTAGAGCGATGCTAATATGGAGTCATCGCTTCCQ3-VIC(GA)9243–254MN648912
R: GCATTCGGACAGAGGGAG
PriB10F: TAGGAGTGCAGCAAGCATTTTGCATCTAAAGTTTGAGGGQ2-NED(AG)9146–149MN648902
R: TAATGGAGCTTATGCTTTGG
PriB22F: TAGGAGTGCAGCAAGCATAACGGACCGGTACTTACAGAQ2-NED(TG)9203–211MN648911
R: GCTTAGACAAATGTTAGAATCACC
PriB04F: CTAGTTATTGCTCAGCGGTAATATGCTTGGAATGGATGGQ4-PET(GA)8113–142MN648899
R: ATTACTCCTTGGCGCAGTC
Multiplex 2
PriB13F: TGTAAAACGACGGCCAGTTGTTTACTAACTTGCAGAATCCAQ1-6-FAM(CT)12139–159MN648905
R: CAGTAAGGATGGCTCTCCC
PriB15F: CACTGCTTAGAGCGATGCCAAGTCTACGCCAAATGGTCQ3-VIC(TC)12147–167MN648907
R: GCGTTTAAACATCAATTGGAC
PriB02F: TAGGAGTGCAGCAAGCATTGCGTGTACATGTGTATCTCCQ2-NED(GA)1095–116MN648897
R: AGACACCCAACTTTCAATGAT
PriB14F: TAGGAGTGCAGCAAGCATGGGAAGACAAACAAGAGTCAGQ2-NED(CT)9153–157MN648906
R: TGACCTAAAGAATAAGACATCCC
PriB12F: CTAGTTATTGCTCAGCGGTAAATTTGCCCTCCCTTACATQ4-PET(GT)12136–159MN648904
R: TGACTACAAAGCATATGAATAGAAA
Multiplex 3
PriB03F: CACTGCTTAGAGCGATGCATCGGTGAGTACATCGAACCQ3-VIC(AC)8106–112MN648898
R: GCAGTTCAAGTTAGTTTGTGC
PriB11F: CACTGCTTAGAGCGATGCCAATAGAATGATGGTCAAGAGCQ3-VIC(CT)8144–160MN648903
R: CTTCCAGAGAAACCCACCT
PriB18F: TAGGAGTGCAGCAAGCATAGAGTCGTTGTGAGCTGTGAQ2-NED(AG)14168–202MN648908
R: AGTGACACGCGTTCAAATAC
PriB08F: CTAGTTATTGCTCAGCGGTATATTGCAGCAGAGACACCAQ4-PET(AG)8147–167MN648901
R: AGTTTCGCTCTTCTTACCGA
PriB20F: CTAGTTATTGCTCAGCGGTTGTGTTGCAAGAACGATAGTCQ4-PET(GA)10196–223MN648910
R: ACAAGACTCTAAATTCCAAGACA
Prioria oxyphylla
Multiplex 1
PriO03F: CACTGCTTAGAGCGATGCGAGAAGTGGTCTCCAACCATQ3-VIC(TC)8103–117MN648914
R: CCTGAAGTCGAGAGGAGTGT
PriO23F: CACTGCTTAGAGCGATGCTTACGCTATTTACTTTGCCGTQ3-VIC(AG)9196–213MN648926
R: GCGTTTATGTGAAGCATTTG
PriO18F: TAGGAGTGCAGCAAGCATAGGAGGTCCCGGATAATCTAQ2-NED(TTG)8168–185MN648922
R: TAGGGACATGAGCAGTAGCA
PriO04F: CTAGTTATTGCTCAGCGGTTACATGCACCGTTTGAGTGTQ4-PET(CT)11115–120MN648915
R: CTGCGTTTGAAGTGGAAAT
Multiplex 2
PriO13F: TGTAAAACGACGGCCAGTTGGAAATCATTCAATCTCCCQ1-6-FAM(GCA)8151–162MN648919
R: ATCCATCCCTCCTCGTTG
PriO19F: CACTGCTTAGAGCGATGCGAAATTCTGTGGTAGTGGTGGQ3-VIC(TTC)8182–227MN648923
R: GAGCTATCAATATCACCAAACG
PriO10F: TAGGAGTGCAGCAAGCATAACCCTCTCACTTCCATCTTTQ2-NED(TC)12128–151MN648918
R: GAAGGCCTAAGTAATTATCAACC
PriO22F: TAGGAGTGCAGCAAGCATGTGAGCTGGAACGCAAGTQ2-NED(TC)11165–203MN648925
R: TACGTCCAATCCTTCTAGTCA
PriO16F: CTAGTTATTGCTCAGCGGTTGTCGGAGCCAATCTATTCTQ4-PET(AG)11169–189MN648921
R: CAGCAAATTTCACCACTTCA
PriO24F: CTAGTTATTGCTCAGCGGTGTTGCACGGAGGAAATACATQ4-PET(AG)10250–259MN648927
R: TGTAGAATAAGATAAGGTTGCCA
Multiplex 3
PriO01F: TGTAAAACGACGGCCAGTTGCATAGTGCTACTCCTCACAQ1-6-FAM(AG)894–115MN648913
R: GGGATGGTCACTACCATAGTT
PriO07F: CACTGCTTAGAGCGATGCTCATCTATCAAGTAAGAGGTGGAQ3-VIC(AC)11128–144MN648917
R: TCTCCACTTGAATGTAAATGCT
PriO15F: CACTGCTTAGAGCGATGCTTTGATAGAGATCAATGGCGQ3-VIC(TTG)9155–182MN648920
R: CAAACTGATACCAAATTAAGTGAA
PriO06F: TAGGAGTGCAGCAAGCATGCACAAGAGGCTATGGAGTTQ2-NED(AG)9111–135MN648916
R: AACCGTTGGAATTCTCGTTA
PriO20F: CTAGTTATTGCTCAGCGGTTCACCAGGATGTATAACATTGCQ4-PET(TC)10193–213MN648924
R: GTATATTGCGTGAACATACCCA
1 The universal linkers (Q1–Q4) attached to the sequence of the forward primers are underlined. 2 The number of repeats found in the sample used for the primer development. Corresponds to the GenBank accession number.
Table 2. Genetic diversity indices for two populations of Prioria balsamifera and Prioria oxyphylla using the 16 and 15 newly developed microsatellite markers.
Table 2. Genetic diversity indices for two populations of Prioria balsamifera and Prioria oxyphylla using the 16 and 15 newly developed microsatellite markers.
PICNaNaHoHeFISNullNaHoHeFISNull
Prioria balsamifera Luki (n = 34) Yangambi (n = 31)
PriB070.292220.4120.5000.1790.05510.0000.000nana
PriB190.044220.0880.086−0.0310.00010.0000.000nana
PriB230.372420.5590.507−0.1040.00040.2580.237−0.0880.000
PriB100.336220.3820.314−0.2220.00020.4830.5030.0420.013
PriB220.197330.3820.372−0.0290.00010.0000.000nana
PriB040.000110.0000.000nana10.0000.000nana
PriB130.705760.7060.684−0.0320.00050.5480.535−0.0250.000
PriB150.584650.7350.613−0.2040.00030.6130.524−0.1730.000
PriB020.651950.4410.4460.0100.00260.5160.7490.314 *0.125
PriB140.000110.0000.000nana10.0000.000nana
PriB120.737740.5000.7410.328 *0.14140.6550.649−0.0090.018
PriB030.404330.5290.5510.0400.04520.4190.4550.0800.021
PriB110.529650.6470.544−0.1940.00030.5160.5390.0440.007
PriB180.316730.1470.140−0.0510.00070.2260.5070.558 *0.209
PriB080.146330.3240.280−0.1600.00010.0000.000nana
PriB200.518650.7350.608−0.2130.00040.1380.134−0.0320.000
Multilocus average0.3644.3133.2500.4120.399−0.0320.0172.8800.2730.3020.0970.037
Prioria oxyphylla Luki (n = 21) Yangambi (n = 32)
PriO030.504650.7140.688−0.0400.00040.2500.3080.1910.048
PriO230.597410.0000.000nana30.0710.5050.863 *0.748
PriO180.309330.1540.4650.678 *0.48610.0000.000nana
PriO040.367210.0000.000nana10.0000.000nana
PriO130.593440.5240.515−0.0190.00030.6250.6590.0520.010
PriO190.7201040.4290.4840.1180.01580.5630.6400.1230.058
PriO100.679630.1580.4570.660*0.34850.1300.6210.794 *0.550
PriO220.606530.1110.3070.6520.45130.4380.5380.1890.092
PriO160.136210.0000.000nana20.0000.2391.000 *0.000
PriO240.416440.4210.4670.1000.06530.0000.4201.000 *0.000
PriO010.706650.4760.6210.2380.09140.6250.6460.0330.000
PriO070.754840.1670.5570.707 *0.41580.6150.8100.244 *0.133
Prio150.589540.0000.7881.000 *0.00020.0000.5151.000 *0.000
PriO060.7821060.7620.731−0.0440.01380.7500.7500.0000.000
PriO200.706720.0000.3561.0000.00060.2610.6670.614 *0.424
Multilocus
average
0.5645.4673.3300.2610.4290.4070.1574.0700.2890.4880.4160.159
PIC polymorphism information content, n number of individuals analysed, Na number of alleles, Ho observed heterozygosity, He expected heterozygosity, FIS fixation index following Weir and Cockerham, Null null allele frequency estimated in INEST v2.2 [28], na not available, * indicates significant departures from HWE (p < 0.05).
Table 3. Results of the cross-species amplification tests in the African Prioria species. x indicates successful amplification.
Table 3. Results of the cross-species amplification tests in the African Prioria species. x indicates successful amplification.
SpeciesPriB07PriB19PriB23PriB10PriB22PriB04PriB13PriB15PriB02PriB14PriB12PriB03PriB11PriB18PriB08PriB2016 SSRs
Prioria balsamiferaXXXXXXXXXXXXXXXX16
Prioria oxyphylla X X XX XX6
Prioria buchholzii X XXXX X XX8
Prioria msoo X X X 3
Prioria gilbertii X X XX4
Prioria mannii X X 2
Prioria joveri 0
Overall1111151422234164
PriO03PriO23PriO18PriO04PriO13PriO19PriO10PriO22PriO16PriO24PriO01PriO07PriO15PriO06PriO20 15 SSRs
Prioria balsamifera X 1
Prioria oxyphyllaXXXXXXXXXXXXXXX 15
Prioria buchholziiXXX XXXXXXXXXX 13
Prioria msoo X XX X X X 6
Prioria gilbertiiXX XX X 5
Prioria mannii X XX 3
Prioria joveri X X 2
Overall342156223242351

Share and Cite

MDPI and ACS Style

Vanden Abeele, S.; Hardy, O.J.; Beeckman, H.; Ilondea, B.A.; Janssens, S.B. Genetic Markers for Species Conservation and Timber Tracking: Development of Microsatellite Primers for the Tropical African Tree Species Prioria balsamifera and Prioria oxyphylla. Forests 2019, 10, 1037. https://doi.org/10.3390/f10111037

AMA Style

Vanden Abeele S, Hardy OJ, Beeckman H, Ilondea BA, Janssens SB. Genetic Markers for Species Conservation and Timber Tracking: Development of Microsatellite Primers for the Tropical African Tree Species Prioria balsamifera and Prioria oxyphylla. Forests. 2019; 10(11):1037. https://doi.org/10.3390/f10111037

Chicago/Turabian Style

Vanden Abeele, Samuel, Olivier J. Hardy, Hans Beeckman, Bhély Angoboy Ilondea, and Steven B. Janssens. 2019. "Genetic Markers for Species Conservation and Timber Tracking: Development of Microsatellite Primers for the Tropical African Tree Species Prioria balsamifera and Prioria oxyphylla" Forests 10, no. 11: 1037. https://doi.org/10.3390/f10111037

APA Style

Vanden Abeele, S., Hardy, O. J., Beeckman, H., Ilondea, B. A., & Janssens, S. B. (2019). Genetic Markers for Species Conservation and Timber Tracking: Development of Microsatellite Primers for the Tropical African Tree Species Prioria balsamifera and Prioria oxyphylla. Forests, 10(11), 1037. https://doi.org/10.3390/f10111037

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop