Rapid and Accurate Species-Specific PCR for the Identification of Lethal Chironex Box Jellyfish in Thailand
Abstract
1. Introduction
2. Materials and Methods
2.1. Box Jellyfish Specimens
2.2. DNA Extraction, PCR, and Sequencing
2.3. Sequence Analysis
2.4. Species-Specific Primers Design, Selection, and Validation
3. Results
3.1. Three Chironex Box Jellyfish Found in Various Locations in Thailand
3.2. Amplification and Sequencing Analysis of the 16S rRNA and COI Genes
3.3. Species-Specific Primer Design for Three Thai Chironex Species
3.4. Panel Validation with Unknown Species and Real Clinical Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bentlage, B.; Cartwright, P.; Yanagihara, A.A.; Lewis, C.; Richards, G.S.; Collins, A.G. Evolution of box jellyfish (Cnidaria: Cubozoa), a group of highly toxic invertebrates. Proc. R. Soc. B Biol. Sci. 2010, 277, 493–501. [Google Scholar] [CrossRef] [PubMed]
- WoRMS—World Register of Marine Species—Cubozoa. Available online: https://www.marinespecies.org/aphia.php?p=taxdetails&id=135219 (accessed on 19 March 2018).
- Rowley, O.C.; Courtney, R.L.; Browning, S.A.; Seymour, J.E. Bay watch: Using unmanned aerial vehicles (uav’s) to survey the box jellyfish chironex fleckeri. PLoS ONE 2020, 15, e0241410. [Google Scholar] [CrossRef] [PubMed]
- Acevedo, M.J.; Straehler-Pohl, I.; Morandini, A.C.; Stampar, S.N.; Bentlage, B.; Matsumoto, G.I.; Yanagihara, A.; Toshino, S.; Bordehore, C.; Fuentes, V.L. Revision of the genus carybdea (cnidaria: Cubozoa: Carybdeidae): Clarifying the identity of its type species carybdea marsupialis. Zootaxa 2019, 4543, 515–548. [Google Scholar] [CrossRef] [PubMed]
- Bayha, K.; Dawson, M.N. New family of allomorphic jellyfishes, drymonematidae (scyphozoa, discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton. Biol. Bull. 2010, 219, 249–267. [Google Scholar] [CrossRef]
- Dawson, M.N.; Jacobs, D.K. Molecular evidence for cryptic species of aurelia aurita (cnidaria, scyphozoa). Biol. Bull. 2001, 200, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Lippmann, J.M.; Fenner, P.J.; Winkel, K.; Gershwin, L.A. Fatal and Severe Box Jellyfish Stings, Including Irukandji Stings, in Malaysia, 2000–2010. J. Travel Med. 2011, 18, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Pirkle, C.M.; Yanagihara, A.A. Insights in Public Health: Trapped in a Sea of Uncertainty: Limitations in Unintentional Injury Research in the Philippines and Interdisciplinary Solutions to Reduce Fatal Box Jellyfish Stings. Hawaii J. Med. Public Health 2019, 78, 30–34. [Google Scholar] [PubMed]
- Sonthichai, C.; Tikumrum, S.; Smithsuwan, P.; Bussarawit, S.; Sermgew, T.; O’Reilly, M.; Siriarayaporn, P. Jellyfish envenomation events in selected coastal provinces of Thailand 1998–2008. Outbreak Surveill. Investig. Rep. 2009, 2, 9–12. [Google Scholar]
- Thaikruea, L.; Siriariyaporn, P. The magnitude of severe box jellyfish cases on Koh Samui and Koh Pha-ngan in the Gulf of Thailand. BMC Res. Notes 2016, 9, 108. [Google Scholar] [CrossRef] [PubMed]
- Thaikruea, L.; Siriariyaporn, P.; Wutthanarungsan, R.; Smithsuwan, P. Review of Fatal and Severe Cases of Box Jellyfish Envenomation in Thailand. Asia-Pac. J. Public Health 2015, 27, NP1639–NP1651. [Google Scholar] [CrossRef] [PubMed]
- Thaikruea, L.; Siriariyaporn, P. Situation of injuries and deaths in Thailand. In Injuries and Deaths Caused by Box Jellyfish and Portuguese Man-of-War: Treatment and Prevention; Thaikruea, L., Ed.; Faculty of Medicine of Chiang Mai University: Chiang Mai, Thailand, 2014; pp. 23–42. [Google Scholar]
- Marine and Coastal Resources Research and Development Center of Marine and Coastal Resources. Report on Venomous Jellyfish Situation in Thailand; Marine and Coastal Resources Research and Development Center of Marine and Coastal Resources: Bangkok, Thailand, 2016. [Google Scholar]
- Toshino, S.; Nishikawa, J.; Srinui, K.; Taleb, S.; Miyake, H. New records of two species of Cubozoa from Thailand. Plankton Benthos Res. 2019, 14, 143–149. [Google Scholar] [CrossRef]
- Khonchom, K.; Poonsawat, T.; Ongsara, S.; Pransilpa, M.; Detsri, U.; Sathirapongsasuti, N. Molecular identification of box jellyfish in Thai waters. In Proceedings of the 6th Marine Science Conference, Chonburi, Thailand, 18–20 June 2018; pp. 748–759. [Google Scholar]
- Sucharitakul, P.; Chomdej, S.; Achalawitkun, T.; Arsiranant, I. Description of Chironex indrasaksajiae Sucharitakul sp. nov. (Cnidaria, Cubozoa, Chirodropida): A new species of box jellyfish from the Gulf of Thailand. Phuket Mar. Biol. Cent. Res. Bull. 2017, 74, 33–44. [Google Scholar]
- Geller, J.; Meyer, C.P.; Parker, M.; Hawk, H. Redesign of PCR primers for mitochondrial Cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Mol. Ecol. Resour. 2013, 13. [Google Scholar] [CrossRef]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2017, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
- Kuraku, S.; Zmasek, C.M.; Nishimura, O.; Katoh, K. aLeaves facilitates on-demand exploration of metazoan gene family trees on MAFFT sequence alignment server with enhanced interactivity. Nucleic Acids Res. 2013, 41, W22–W28. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2015, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef] [PubMed]
- Box Jellyfish, Box Jellyfish Pictures, Box Jellyfish Facts. Available online: https://www.nationalgeographic.com/animals/invertebrates/group/box-jellyfish/ (accessed on 27 August 2012).







| Order | Family | Species | Number of Animals |
|---|---|---|---|
| Chirodropida | Chirodropidae | Chironex indrasaksajiae | 22 |
| Chironex Sp.A | 2 | ||
| Chironex Sp.C | 7 | ||
| Chiropsalmidae | Chiropsoides buitendijki | 2 | |
| Chiropsellidae | Meteorona kishinouyei | 6 | |
| Carybdeida | Carukiidae | Morbakka Sp.A | 3 |
| Morbakka Sp.B | 4 | ||
| Morbakka Sp.C | 2 | ||
| Tripedaliidae | Copula sivickisi | 2 | |
| Total | 50 | ||
| Species | Accession No. | |
|---|---|---|
| 16S | COI | |
| Chironex fleckeri | GQ849103 | FJ665181 |
| Chironex yamaguchii | AGC0592 | FJ665180 |
| Chironex indrasaksajiae | KX090147 | KT223648 |
| Physalia physalis | AY935284 | AY937374 |
| Sample | Name | Seq. (5’ → 3’) | Length (bp) | Tm (°C) | Product (bp) |
|---|---|---|---|---|---|
| Universal primer | P16sf | AAGGGCCGCGGTAACTCTG | 19 | 61.7 | 414 |
| S16sr | ACCCTGTTATCCCCGTGGT | 19 | 59.5 | ||
| Chironex Sp.A | P16sf | AAGGGCCGCGGTAACTCTG | 19 | 61.7 | 226 |
| CA16sr | ACCTGCTACTCCCTAAGGTTTAAATTTAGTG | 31 | 58 | ||
| Chironex indrasaksajiae | P16sf | AAGGGCCGCGGTAACTCTG | 19 | 61.7 | 226 |
| CI16sr | ACCTACTGTTCCCTAGAGTTTAAGTTTAAAGG | 32 | 57.6 | ||
| Chironex Sp.C | P16sf | AAGGGCCGCGGTAACTCTG | 19 | 61.7 | 217 |
| CC16sr | CCTCTAAAGTATCTAATCTAAAGTGGAGGGTAG | 33 | 57 |
| Sample | Name | Seq. (5’ → 3’) | Length (bp) | Tm (°C) | Product (bp) |
|---|---|---|---|---|---|
| Universal primer | jgLCO1490 | TNTCNACNAAYCAYAARGAYATTGG | 25 | 56 | 709 |
| jgHCO2198 | TANACYTCNGGRTGNCCRAARAAYCA | 26 | 60 | ||
| Chironex Sp. A | CAcof | CACCGCTTTTTCCATGTTGATTAGATTAGAAT | 32 | 57.7 | 535 |
| Chironex_cor | CATCGTTATAGCRCCTGCTARCACAGGYART | 31 | 62.8 | ||
| Chironex indrasaksajiae | CIcof | CTGTGTACCCTCCCCTATCAGCCATTCAATC | 31 | 62.8 | 245 |
| Chironex_cor | CATCGTTATAGCRCCTGCTARCACAGGYART | 31 | 62.8 | ||
| Chironex Sp.C | CCcof | GGCATTCCCAAGACTAAACAACATATCCTTC | 31 | 59.1 | 349 |
| Chironex_cor | CATCGTTATAGCRCCTGCTARCACAGGYART | 31 | 62.8 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sathirapongsasuti, N.; Khonchom, K.; Poonsawat, T.; Pransilpa, M.; Ongsara, S.; Detsri, U.; Bungbai, S.; Lawanangkoon, S.-a.; Pattanaporkrattana, W.; Trakulsrichai, S. Rapid and Accurate Species-Specific PCR for the Identification of Lethal Chironex Box Jellyfish in Thailand. Int. J. Environ. Res. Public Health 2021, 18, 219. https://doi.org/10.3390/ijerph18010219
Sathirapongsasuti N, Khonchom K, Poonsawat T, Pransilpa M, Ongsara S, Detsri U, Bungbai S, Lawanangkoon S-a, Pattanaporkrattana W, Trakulsrichai S. Rapid and Accurate Species-Specific PCR for the Identification of Lethal Chironex Box Jellyfish in Thailand. International Journal of Environmental Research and Public Health. 2021; 18(1):219. https://doi.org/10.3390/ijerph18010219
Chicago/Turabian StyleSathirapongsasuti, Nuankanya, Kasetsin Khonchom, Thunyaporn Poonsawat, Mitila Pransilpa, Supaporn Ongsara, Usawadee Detsri, Suwimon Bungbai, Sam-ang Lawanangkoon, Worawut Pattanaporkrattana, and Satariya Trakulsrichai. 2021. "Rapid and Accurate Species-Specific PCR for the Identification of Lethal Chironex Box Jellyfish in Thailand" International Journal of Environmental Research and Public Health 18, no. 1: 219. https://doi.org/10.3390/ijerph18010219
APA StyleSathirapongsasuti, N., Khonchom, K., Poonsawat, T., Pransilpa, M., Ongsara, S., Detsri, U., Bungbai, S., Lawanangkoon, S.-a., Pattanaporkrattana, W., & Trakulsrichai, S. (2021). Rapid and Accurate Species-Specific PCR for the Identification of Lethal Chironex Box Jellyfish in Thailand. International Journal of Environmental Research and Public Health, 18(1), 219. https://doi.org/10.3390/ijerph18010219

