Molecular Surveillance of Methicillin-Susceptible Staphylococcus aureus (MSSA) Isolated over a One-Year Period from a Malaysian Teaching Hospital
Abstract
Introduction
Methods
Study setting and bacterial strains
Antimicrobial resistance testing
Chromosomal DNA isolation for virulence gene and agr typing
Virulence gene typing
Characterization of agr
Pulsed-field gel electrophoresis (PFGE) typing
Association between molecular typing
Results
Discussion
Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of interest
References
- Choo, E.J.; Chambers, H.F. Treatment of methicillin-resistant Staphylococcus aureus bacteremia. Infect Chemother 2016, 48, 267–273. [Google Scholar] [CrossRef]
- Tong, S.Y.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev 2015, 28, 603–661. [Google Scholar] [CrossRef]
- Liu, C.; Chen, Z.J.; Sun, Z.; et al. Molecular characteristics and virulence factors in methicillin-susceptible, resistant, and heterogeneous vancomycin-intermediate Staphylococcus aureus from central-southern China. J Microbiol Immunol Infect 2015, 48, 490–6. [Google Scholar] [CrossRef]
- Ghasemzadeh-Moghaddam, H.; Ghaznavi-Rad, E.; Sekawi, Z.; et al. Methicillin-susceptible Staphylococcus aureus from clinical and community sources are genetically diverse. Int J Med Microbiol 2011, 301, 347–353. [Google Scholar] [CrossRef] [PubMed]
- Lim, K.T.; Hanifah, Y.A.; Yusof, M.Y.M.; Thong, K.L. Characterisation of the virulence factors and genetic types of methicillin susceptible Staphylococcus aureus from patients and healthy individuals. Indian J Microbiol 2012, 52, 593–600. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ghasemzadeh-Moghaddam, H.; Neela, V.; Goering, R.; Mariana, N.S. Methicillin sensitive Staphylococcus aureus (MSSA) isolates as a potential source for the emergence of USA 300 methicillin resistant Staphylococcus aureus (MRSA) in Malaysia. Trop Biomed 2012, 29, 429–433. [Google Scholar] [PubMed]
- Noordin, A.; Sapri, H.F.; Mohamad Sani, N.A.; et al. Antimicrobial resistance profiling and molecular typing of methicillin-resistant Staphylococcus aureus isolated from a Malaysian teaching hospital. J Med Microbiol 2016, 65, 1476–1481. [Google Scholar] [CrossRef]
- Clinical Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: informational (supp 2009:M100-S19); CLSI: Wayne, PA, USA, 2009. [Google Scholar]
- Hassriana Fazilla, S.; Nurul Azirah, M.S.; Ainihayati, N.; Hui- min, N.; Salasawati, H. Virulence gene typing of methicillin-susceptible Staphylococcus aureus (MSSA) isolates in Universiti Kebangsaan Malaysia Medical Centre (UKMMC). Asia-Pacific J Mol Med. 2011, 1, 1–4. [Google Scholar]
- Gilot, P.; Lina, G.; Cochard, T.; Poutrel, B. Analysis of the genetic variability of genes encoding the RNA III- activating components agr and TRAP in a population of Staphylococcus aureus strains isolated from cows with mastitis. J Clin Microbiol 2002, 40, 4060–4067. [Google Scholar] [CrossRef]
- Jamaluddin, T.Z.; Kuwahara-Arai, K.; Hisata, K.; et al. Extreme genetic diversity of methicillin-resistant Staphylococcus epidermidis strains disseminated among healthy Japanese children. J Clin Microbiol 2008, 46, 3778–3783. [Google Scholar] [CrossRef]
- Tenover, F.C.; Arbeit, R.D.; Goering, R.V.; et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995, 33, 2233–2239. [Google Scholar] [CrossRef]
- Sanchini, A.; Andrés, M.; Fiebig, L.; Albrecht, S.; Hauer, B.; Haas, W. Assessment of the use and need for an integrated molecular surveillance of tuberculosis: an online survey in Germany. BMC Public Health 2019, 19, 321. [Google Scholar] [CrossRef] [PubMed]
- Ragonnet-Cronin, M.; Hu, Y.W.; Morris, S.R.; Sheng, Z.; Poortinga, K.; Wertheim, J.O. HIV transmission networks among transgender women in Los Angeles County: network analysis of surveillance data. Lancet HIV 2019, 6, e164–e172. [Google Scholar] [CrossRef] [PubMed]
- Wendel, A.F.; Malecki, M.; Otchwemah, R.; Tellez-Castillo, C.J.; Sakka, S.G.; Mattner, F. One-year molecular surveillance of carbapenem-susceptible A. baumannii on a German intensive care unit: diversity or clonality. Antimicrob Resist Infect Control 2018, 7, 145. [Google Scholar] [CrossRef] [PubMed]
- Crago, B.; Ferrato, C.; Drews, S.J.; et al. Surveillance and molecular characterization of non-tuberculous mycobacteria in a hospital water distribution system over a three-year period. J Hosp Infect 2014, 87, 59–62. [Google Scholar] [CrossRef]
- Lakhundi, S.; Zhang, K. Methicillin-resistant Staphylococcus aureus: molecular characterization, evolution, and epidemiology. Clin Microbiol Rev 2018, 31, e00020–18. [Google Scholar] [CrossRef]
- Xu, Y.; Rivas, J.M.; Brown, E.L.; Liang, X.; Höök, M. Virulence potential of the staphylococcal adhesin CNA in experimental arthritis is determined by its affinity for collagen. J Infect Dis 2004, 189, 2323–2333. [Google Scholar] [CrossRef]
- Neoh, H.M.; Tan, X.E.; Sapri, H.F.; Tan, T.L. Pulsed-field gel electrophoresis (PFGE): A review of the "gold standard" for bacteria typing and current alternatives. Infect Genet Evol 2019, 74, 103935. [Google Scholar] [CrossRef]
- Aires de Sousa, M.; Conceição, T.; Simas, C.; de Lencastre, H. Comparison of genetic backgrounds of methicillin-resistant and -susceptible Staphylococcus aureus isolates from Portuguese hospitals and the community. J Clin Microbiol 2005, 43, 5150–5157. [Google Scholar] [CrossRef]
- Aires de Sousa, M.; Crisóstomo, M.I.; Sanches, I.S.; et al. Frequent recovery of a single clonal type of multidrug- resistant Staphylococcus aureus from patients in two hospitals in Taiwan and China. J Clin Microbiol 2003, 41, 159–163. [Google Scholar] [CrossRef]
- Ghaznavi-Rad, E.; Nor Shamsudin, M.; Sekawi, Z.; et al. Predominance and emergence of clones of hospital-acquired methicillin-resistant Staphylococcus aureus in Malaysia. J Clin Microbiol 2010, 48, 867–872. [Google Scholar] [CrossRef]
- Norazah, A.; Lim, V.K.; Rohani, M.Y.; Alfizah, H.; Koh, Y.T.; Kamel, A.G. A major methicillin-resistant Staphylococcus aureus clone predominates in Malaysian hospitals. Epidemiol Infect 2003, 130, 407–411. [Google Scholar] [CrossRef]
- Van Dijk, Y.; Wielders, C.L.; Fluit, A.C.; Paauw, A.; Diepersloot, R.J.; Mascini, E.M. Genotyping of clinical methicillin-susceptible Staphylococcus aureus isolates in a Dutch teaching hospital. J Clin Microbiol 2002, 40, 663–665. [Google Scholar] [CrossRef]
- Tan, X.E.; Neoh, H.M.; Hussin, S.; Zin, N.M. Clonal distribution and possible microevolution of methicillin-resistant Staphylococcus aureus strains in a teaching hospital in Malaysia. Asian Pac J Trop Biomed 2013, 3, 224–228. [Google Scholar] [CrossRef]


| Name | Primer sequence | Product size (bp) | Reference |
|---|---|---|---|
| cna-F | 5’ ACACCAGACGGTGCAACAATTA 3’ | 815 | [9] |
| cna-R | 5’ AGCAATACCGTTTGCATCTGTTA 3’ | ||
| seh-F | 5’ ATTCACATCATATGCGAAAGCAG 3’ | 555 | [9] |
| seh-R | 5’ ATGTCGAATGAGTAATCTCTAG 3’ | ||
| pvl-F | 5’ ATGTCTGGACATGATCCAA 3’ | 970 | [9] |
| pvl-R | 5’ AACTATCTCTGCCATATGGT 3’ | ||
| tsst1-F | 5’ TGATATGTGGATCCGTCAT 3’ | 387 | [9] |
| tsst1-R | 5’ AAACACAGATGGCAGCAT 3’ | ||
| agr1-F | 5’ ATGCACATGGTGCACATGC 3’ | 441 | [10] |
| agr1-R | 5’ GTCACAAGTACTATAAGCTGCGAT 3’ | ||
| agr2-F | 5’ ATGCACATGGTGCACATGC 3’ | 575 | [10] |
| agr2-R | 5’ TATTACTAATTGAAAAGTGGCCATAGC 3’ | ||
| agr3-F | 5’ ATGCACATGGTGCACATGC 3’ | 323 | [10] |
| agr3-R | 5’ GTAATGTAATAGCTTGTATAATAATACCCA G 3’ | ||
| agr4-F | 5’ ATGCACATGGTGCACATGC 3’ | 659 | [10] |
| agr4-R | 5’ CGATAATGCCGTAATACCCG 3’ |
| Virulence gene profile | Number of strains (n) | Percentage (%) |
|---|---|---|
| cna | 202 | 23.0 |
| cna + seh | 167 | 19.0 |
| cna + PVL | 38 | 4.3 |
| cna + PVL + TSST-1 | 1 | 0.1 |
| cna + seh + PVL | 23 | 2.6 |
| cna + seh + TSST-1 | 2 | 0.2 |
| cna + TSST-1 | 21 | 2.4 |
| PVL | 28 | 3.2 |
| TSST-1 | 36 | 4.1 |
| No virulence gene | 362 | 41.1 |
| Total | 880 | 100.0 |
© GERMS 2025.
Share and Cite
Sapri, H.F.; Ismail, M.A.H.; Sani, N.A.M.; Noordin, A.; Tan, T.L.; Hussin, S.; Neoh, H.-M. Molecular Surveillance of Methicillin-Susceptible Staphylococcus aureus (MSSA) Isolated over a One-Year Period from a Malaysian Teaching Hospital. Germs 2020, 10, 104-111. https://doi.org/10.18683/germs.2020.1191
Sapri HF, Ismail MAH, Sani NAM, Noordin A, Tan TL, Hussin S, Neoh H-M. Molecular Surveillance of Methicillin-Susceptible Staphylococcus aureus (MSSA) Isolated over a One-Year Period from a Malaysian Teaching Hospital. Germs. 2020; 10(2):104-111. https://doi.org/10.18683/germs.2020.1191
Chicago/Turabian StyleSapri, Hassriana Fazilla, Mohd Azrul Hisham Ismail, Nurul Azirah Mohamad Sani, Ainihayati Noordin, Toh Leong Tan, Salasawati Hussin, and Hui-Min Neoh. 2020. "Molecular Surveillance of Methicillin-Susceptible Staphylococcus aureus (MSSA) Isolated over a One-Year Period from a Malaysian Teaching Hospital" Germs 10, no. 2: 104-111. https://doi.org/10.18683/germs.2020.1191
APA StyleSapri, H. F., Ismail, M. A. H., Sani, N. A. M., Noordin, A., Tan, T. L., Hussin, S., & Neoh, H.-M. (2020). Molecular Surveillance of Methicillin-Susceptible Staphylococcus aureus (MSSA) Isolated over a One-Year Period from a Malaysian Teaching Hospital. Germs, 10(2), 104-111. https://doi.org/10.18683/germs.2020.1191
