Rapid and Sensitive Detection of SARS-CoV-2 Using Clustered Regularly Interspaced Short Palindromic Repeats
Abstract
1. Introduction
2. Materials and Methods
2.1. SARS-CoV-2 Samples
2.2. Detection of SARS-CoV-2 by Using CRISPR-Cas12a
2.3. Visual Detection of CRISPR-Cas12a Activity Using a UV Light Illuminator
2.4. Visual Detection of CRISPR-Cas12a Activity Using Lateral Flow Readout
2.5. RT-Polymerase Chain Reaction (RT-PCR)
2.6. Clinical Specimens
2.7. Statistical Analysis
3. Results
3.1. CRISPR-Cas12a Can Sensitively Detect SARS-CoV-2
3.2. CRISPR-Cas12a Can Specifically Detect SARS-CoV-2
3.3. CRISPR-Cas12a Can Directly Target Raw Specimens without RNA Isolation and the Results Can Be Immediately Read
3.4. CRISPR-Cas12a Can Directly Target Clinical Specimens for Detection of SARS-CoV-2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, B.; Guo, H.; Zhou, P.; Shi, Z.L. Characteristics of SARS-CoV-2 and COVID-19. Nat. Rev. Microbiol. 2021, 19, 141–154. [Google Scholar] [CrossRef]
- Chams, N.; Chams, S.; Hussein, I.H.; Badran, R.; Shams, A.; Araji, A.; Raad, M.; Mukhopadhyay, S.; Stroberg, E.; Duval, E.J.; et al. COVID-19: A Multidisciplinary Review. Front. Public Health 2020, 8, 383. [Google Scholar] [CrossRef]
- Rong, Y.; Wang, F.; Liu, J.; Zhou, Y.; Li, X.; Liang, X.; Zhang, D.; Zeng, H.; Wang, J.; Shi, Y.; et al. Clinical characteristics and risk factors of mild-to-moderate COVID-19 patients with false-negative SARS-CoV-2 nucleic acid. J. Med. Virol. 2021, 93, 448–455. [Google Scholar] [CrossRef]
- Barrangou, R. The roles of CRISPR—Cas systems in adaptive immunity and beyond. Curr. Opin. Immunol. 2015, 32, 36–41. [Google Scholar] [CrossRef]
- Myhrvold, C.; Freije, C.A.; Garcia, K.F.; Barnes, K.G.; Chak, B.; Mondini, A.; Nogueira, M.L.; Isern, S.; Michael, S.F.; Lorenzana, I.; et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science 2018, 360, 444–448. [Google Scholar] [CrossRef]
- Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 2018, 360, 439–444. [Google Scholar] [CrossRef]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [PubMed]
- Abudayyeh, O.O.; Gootenberg, J.S.; Essletzbichler, P.; Han, S.; Joung, J.; Belanto, J.J.; Verdine, V.; Cox, D.B.T.; Kellner, M.J.; Regev, A.; et al. RNA targeting with CRISPR-Cas13. Nature 2017, 550, 280–284. [Google Scholar] [CrossRef]
- Chertow, D.S. Next-generation diagnostics with CRISPR. Science 2018, 360, 381–382. [Google Scholar] [CrossRef] [PubMed]
- Tsou, J.-H.; Leng, Q.; Jiang, F. A CRISPR Test for Detection of Circulating Nuclei Acids. Transl. Oncol. 2019, 12, 1566–1573. [Google Scholar] [CrossRef] [PubMed]
- Tsou, J.-H.; Leng, Q.; Jiang, F. A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations. Diagnostics 2020, 10, 114. [Google Scholar] [CrossRef]
- Zhou, H.; Tsou, J.-H.; Leng, Q.; Jiang, F. Sensitive Detection of KRAS Mutations by Clustered Regularly Interspaced Short Palindromic Repeats. Diagnostics 2021, 11, 125. [Google Scholar] [CrossRef]
- Broughton, J.P.; Deng, X.; Yu, G.; Fasching, C.L.; Servellita, V.; Singh, J.; Miao, X.; Streithorst, J.A.; Granados, A.; Sotomayor-Gonzalez, A.; et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat. Biotechnol. 2020, 38, 870–874. [Google Scholar] [CrossRef]
- Ding, X.; Yin, K.; Li, Z.; Lalla, R.V.; Ballesteros, E.; Sfeir, M.M.; Liu, C. Ultrasensitive and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay. Nat. Commun. 2020, 11, 4711. [Google Scholar] [CrossRef]
- Joung, J.; Ladha, A.; Saito, M.; Kim, N.-G.; Woolley, A.E.; Segel, M.; Barretto, R.P.J.; Ranu, A.; Macrae, R.K.; Faure, G.; et al. Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing. N. Engl. J. Med. 2020, 383, 1492–1494. [Google Scholar] [CrossRef]
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef]
- Gootenberg, J.S.; Abudayyeh, O.O.; Lee, J.W.; Essletzbichler, P.; Dy, A.J.; Joung, J.; Verdine, V.; Donghia, N.; Daringer, N.M.; Freije, C.A.; et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 2017, 356, 438–442. [Google Scholar] [CrossRef] [PubMed]
- East-Seletsky, A.; O’Connell, M.R.; Knight, S.C.; Burstein, D.; Cate, J.H.D.; Tjian, R.; Doudna, J.A. Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection. Nature 2016, 538, 270–273. [Google Scholar] [CrossRef] [PubMed]
- Teng, F.; Cui, T.; Feng, G.; Guo, L.; Xu, K.; Gao, Q.; Li, T.; Li, J.; Zhou, Q.; Li, W. Repurposing CRISPR-Cas12b for mammalian genome engineering. Cell Discov. 2018, 4, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Strecker, J.; Jones, S.; Koopal, B.; Schmid-Burgk, J.; Zetsche, B.; Gao, L.; Makarova, K.S.; Koonin, E.V.; Zhang, F. Engineering of CRISPR-Cas12b for human genome editing. Nat. Commun. 2019, 10, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Korber, B.; Fischer, W.M.; Gnanakaran, S.; Yoon, H.; Theiler, J.; Abfalterer, W.; Hengartner, N.; Giorgi, E.E.; Bhattacharya, T.; Foley, B.; et al. Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus. Cell 2020, 182, 812–827.e19. [Google Scholar] [CrossRef] [PubMed]
- Weissman, D.; Alameh, M.-G.; De Silva, T.; Collini, P.; Hornsby, H.; Brown, R.; Labranche, C.C.; Edwards, R.J.; Sutherland, L.; Santra, S.; et al. D614G Spike Mutation Increases SARS CoV-2 Susceptibility to Neutralization. Cell Host Microbe 2021, 29, 23–31.e4. [Google Scholar] [CrossRef] [PubMed]







| Primers/Probe for PCR | |
| 2019-nCoV_N2-F | TTACAAACATTGGCCGCAAA |
| 2019-nCoV_N2-R | GCGCGACATTCCGAAGAA |
| 2019-nCoV_N2-P | FAM-ACAATTTGC/ZEN/CCCCAGCGCTTCAG-3IABkFQ |
| Primers for RT-RPA | |
| COVID19 M-RPAF | CTTGATGTGGCTCAGCTACTTCATTGCTTC |
| COVID19 M-RPAR | TGGAGTGGCACGTTGAGAAGAATGTTAGTTTC |
| COVID19 N2-RPAF | TGATTACAAACATTGGCCGCAAATTGCACA |
| COVID19 N2-RPAR | AGGTCAACCACGTTCCCGAAGGTGTGACTT |
| COVID19 S2-RPAF | TATTCTACAGGTTCTAATGTTTTTCAAACAC |
| COVID19 S2-RPAR | AGCGCATATACCTGCACCAATGGGTATGTCAC |
| crRNAs | |
| COVID19 M gRNA | UAAUUUCUACUAAGUGUAGAUCGCGUACGCGUUCCAUGUGG |
| COVID19 N2 gRNA | UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC |
| COVID19 S2 gRNA | UAAUUUCUACUAAGUGUAGAUAUAGGGGCUGAACAUGUCAA |
| Reporter Substrates | |
| ssDNA-FQ reporter | /56-FAM/TTATTATT/3BHQ_1/ |
| ssDNA-FB reporter | /56-FAM/TTATTATT/3Bio/ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsou, J.-H.; Liu, H.; Stass, S.A.; Jiang, F. Rapid and Sensitive Detection of SARS-CoV-2 Using Clustered Regularly Interspaced Short Palindromic Repeats. Biomedicines 2021, 9, 239. https://doi.org/10.3390/biomedicines9030239
Tsou J-H, Liu H, Stass SA, Jiang F. Rapid and Sensitive Detection of SARS-CoV-2 Using Clustered Regularly Interspaced Short Palindromic Repeats. Biomedicines. 2021; 9(3):239. https://doi.org/10.3390/biomedicines9030239
Chicago/Turabian StyleTsou, Jen-Hui, Hongjie Liu, Sanford A. Stass, and Feng Jiang. 2021. "Rapid and Sensitive Detection of SARS-CoV-2 Using Clustered Regularly Interspaced Short Palindromic Repeats" Biomedicines 9, no. 3: 239. https://doi.org/10.3390/biomedicines9030239
APA StyleTsou, J.-H., Liu, H., Stass, S. A., & Jiang, F. (2021). Rapid and Sensitive Detection of SARS-CoV-2 Using Clustered Regularly Interspaced Short Palindromic Repeats. Biomedicines, 9(3), 239. https://doi.org/10.3390/biomedicines9030239

