Mambalgin-2 Inhibits Growth, Migration, and Invasion of Metastatic Melanoma Cells by Targeting the Channels Containing an ASIC1a Subunit Whose Up-Regulation Correlates with Poor Survival Prognosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Real-Time PCR
2.3. Cell Cultivation and Proliferation Assay
2.4. Cell Cycle Analysis
2.5. Flow Cytometry and Protein Expression/Phosphorylation
2.6. Wound Healing (Scratch) and Invasion Assays
2.7. Confocal Microscopy
2.8. Affinity Purification and Western Blotting
2.9. Analysis of Phosphatidylserine Externalization
2.10. TCGA Database Analysis
2.11. Statistical Analysis
3. Results
3.1. Acidification of Cell Environment Enhances Proliferation, Migration, and Invasion of Metastatic Melanoma Cells
3.2. Acidification of Cell Environment Up-Regulates Expression of the ASIC1a, α-ENaC, and γ-ENaC Subunits in Metastatic Melanoma Cells
3.3. ASIC1a Inhibitor Mambalgin-2 Reduces Growth, Migration, and Invasion of Metastatic Melanoma Cells
3.4. Mambalgin-2 Induces Apoptosis in Mel P Cells
3.5. Mambalgin-2 Inhibits Expression and Activation of Melanoma Progression Markers in Mel P Cells
3.6. Mambalgin-2 Interacts with ASIC1, α-ENaC, and γ-ENaC on the Cell-Surface Membrane of Mel P Cells
3.7. Up-Regulation of the ACCN2 Expression in Patients with Metastatic Melanoma Correlates with Poor Survival Prognosis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Miller, A.J.; Mihm, M.C. Melanoma. N. Engl. J. Med. 2006, 355, 51–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dratkiewicz, E.; Simiczyjew, A.; Mazurkiewicz, J.; Ziętek, M.; Matkowski, R.; Nowak, D. Hypoxia and Extracellular Acidification as Drivers of Melanoma Progression and Drug Resistance. Cells 2021, 10, 862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- The Role of Tumor Microenvironment in Development and Progression of Malignant Melanomas—A Systematic Review. Available online: https://rjme.ro/RJME/resources/files/590118023028.pdf (accessed on 25 September 2021).
- Böhme, I.; Bosserhoff, A.K. Acidic tumor microenvironment in human melanoma. Pigment. Cell Melanoma Res. 2016, 29, 508–523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Gao, B.; Xiong, Q.-J.; Wang, Y.-C.; Huang, D.-K.; Wu, W.-N. Acid-sensing ion channels contribute to the effect of extracellular acidosis on proliferation and migration of A549 cells. Tumor Biol. 2017, 39, 1010428317705750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moellering, R.; Black, K.C.; Krishnamurty, C.; Baggett, B.K.; Stafford, P.; Rain, M.; Gatenby, R.A.; Gillies, R.J. Acid treatment of melanoma cells selects for invasive phenotypes. Clin. Exp. Metastasis 2008, 25, 411–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peppicelli, S.; Bianchini, F.; Torre, E.; Calorini, L. Contribution of acidic melanoma cells undergoing epithelial-to-mesenchymal transition to aggressiveness of non-acidic melanoma cells. Clin. Exp. Metastasis 2014, 31, 423–433. [Google Scholar] [CrossRef] [Scilit]
- Andreucci, E.; Peppicelli, S.; Ruzzolini, J.; Bianchini, F.; Biagioni, A.; Papucci, L.; Magnelli, L.; Mazzanti, B.; Stecca, B.; Calorini, L. The acidic tumor microenvironment drives a stem-like phenotype in melanoma cells. J. Mol. Med. 2020, 98, 1431–1446. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Jiang, N.; Li, J.; Ji, Y.-H.; Xiong, Z.-G.; Zha, X.-M. Two aspects of ASIC function: Synaptic plasticity and neuronal injury. Neuropharmacology 2015, 94, 42–48. [Google Scholar] [CrossRef] [Scilit]
- Bychkov, M.L.; Shulepko, M.A.; Vasileva, V.Y.; Sudarikova, A.V.; Kirpichnikov, M.P.; Lyukmanova, E.N. ASIC1a Inhibitor Mambalgin-2 Suppresses the Growth of Leukemia Cells by Cell Cycle Arrest. Acta Nat. 2020, 12, 101–116. [Google Scholar] [CrossRef] [Scilit]
- Berdiev, B.K.; Xia, J.; McLean, L.A.; Markert, J.M.; Gillespie, G.Y.; Mapstone, T.B.; Naren, A.P.; Jovov, B.; Bubien, J.K.; Ji, H.-L.; et al. Acid-sensing Ion Channels in Malignant Gliomas. J. Biol. Chem. 2003, 278, 15023–15034. [Google Scholar] [CrossRef] [Scilit]
- Gupta, S.C.; Singh, R.; Asters, M.; Liu, J.; Zhang, X.; Pabbidi, M.R.; Watabe, K.; Mo, Y.-Y. Regulation of breast tumorigenesis through acid sensors. Oncogene 2016, 35, 4102–4111. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhang, T.; Wu, C.; Xia, Q.; Xu, D. ASIC1a mediates the drug resistance of human hepatocellular carcinoma via the Ca2+/PI3-kinase/AKT signaling pathway. Lab. Investig. 2017, 97, 53–69. [Google Scholar] [CrossRef] [Scilit]
- Jin, C.; Ye, Q.-H.; Yuan, F.-L.; Gu, Y.-L.; Li, J.-P.; Shi, Y.-H.; Shen, X.-M.; Liu, B.-; Lin, Z.-H. Involvement of acid-sensing ion channel 1α in hepatic carcinoma cell migration and invasion. Tumor Biol. 2015, 36, 4309–4317. [Google Scholar] [CrossRef] [Scilit]
- Zhu, S.; Zhou, H.-Y.; Deng, S.-C.; He, C.; Li, X.; Chen, J.-Y.; Jin, Y.; Hu, Z.-L.; Wang, F.; Wang, C.-Y.; et al. ASIC1 and ASIC3 contribute to acidity-induced EMT of pancreatic cancer through activating Ca2+/RhoA pathway. Cell Death Dis. 2017, 8, e2806. [Google Scholar] [CrossRef] [Scilit]
- Ackermann, K.; Wallner, S.; Brochhausen, C.; Schreml, S. Expression Profiles of ASIC1/2 and TRPV1/4 in Common Skin Tumors. Int. J. Mol. Sci. 2021, 22, 6024. [Google Scholar] [CrossRef] [Scilit]
- Hegde, M.; Roscoe, J.; Cala, P.; Gorin, F. Amiloride Kills Malignant Glioma Cells Independent of Its Inhibition of the Sodium-Hydrogen Exchanger. J. Pharmacol. Exp. Ther. 2004, 310, 67–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Escoubas, P.; De Weille, J.R.; Lecoq, A.; Diochot, S.; Waldmann, R.; Champigny, G.; Moinier, D.; Ménez, A.; Lazdunski, M. Isolation of a Tarantula Toxin Specific for a Class of Proton-gated Na+ Channels. J. Biol. Chem. 2000, 275, 25116–25121. [Google Scholar] [CrossRef] [Scilit]
- Matthews, H.; Ranson, M.; Kelso, M.J. Anti-tumour/metastasis effects of the potassium-sparing diuretic amiloride: An orally active anti-cancer drug waiting for its call-of-duty? Int. J. Cancer 2011, 129, 2051–2061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bubien, J.K.; Ji, H.-L.; Gillespie, G.Y.; Fuller, C.M.; Markert, J.M.; Mapstone, T.B.; Benos, D.J. Cation selectivity and inhibition of malignant glioma Na+ channels by Psalmotoxin 1. Am. J. Physiol. Physiol. 2004, 287, C1282–C1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diochot, S.; Baron, A.; Salinas, M.; Douguet, D.; Scarzello, S.; Dabert-Gay, A.-S.; Debayle, D.; Friend, V.; Alloui, A.; Lazdunski, M.; et al. Black mamba venom peptides target acid-sensing ion channels to abolish pain. Nat. Cell Biol. 2012, 490, 552–555. [Google Scholar] [CrossRef] [Scilit]
- Baron, A.; Diochot, S.; Salinas, M.; Deval, E.; Noël, J.; Lingueglia, E. Venom toxins in the exploration of molecular, physiological and pathophysiological functions of acid-sensing ion channels. Toxicon 2013, 75, 187–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bychkov, M.; Shulepko, M.; Osmakov, D.; Andreev, Y.; Sudarikova, A.; Vasileva, V.; Pavlyukov, M.S.; Latyshev, Y.A.; Potapov, A.A.; Kirpichnikov, M.; et al. Mambalgin-2 Induces Cell Cycle Arrest and Apoptosis in Glioma Cells via Interaction with ASIC1a. Cancers 2020, 12, 1837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shulepko, M.; Lyukmanova, E.; Shenkarev, Z.; Dubovskii, P.; Astapova, M.; Feofanov, A.; Arseniev, A.; Utkin, Y.; Kirpichnikov, M.; Dolgikh, D. Towards universal approach for bacterial production of three-finger Ly6/uPAR proteins: Case study of cytotoxin I from cobra N. oxiana. Protein Expr. Purif. 2017, 130, 13–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Melanoma Cell Lines as the Basis for Antitumor Vaccine Preparation. Available online: https://www.elibrary.ru/item.asp?id=9134634 (accessed on 25 September 2021).
- Mikhaylova, I.N.; Kovalevsky, D.A.; Morozova, L.F.; Golubeva, V.A.; Cheremushkin, E.A.; Lukashina, M.I.; Voronina, E.S.; Burova, O.S.; Utyashev, I.A.; Kiselev, S.L.; et al. Cancer/testis genes expression in human melanoma cell lines. Melanoma Res. 2008, 18, 303–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyukmanova, E.N.; Bychkov, M.L.; Sharonov, G.V.; Efremenko, A.V.; A Shulepko, M.; Kulbatskii, D.S.; O Shenkarev, Z.; Feofanov, A.V.; A Dolgikh, D.; Kirpichnikov, M. Human secreted proteins SLURP-1 and SLURP-2 control the growth of epithelial cancer cellsviainteractions with nicotinic acetylcholine receptors. Br. J. Pharmacol. 2018, 175, 1973–1986. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varankar, S.S.; Bapat, S.A. Migratory Metrics of Wound Healing: A Quantification Approach for in vitro Scratch Assays. Front. Oncol. 2018, 8, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goldman, M.J.; Craft, B.; Hastie, M.; Repečka, K.; McDade, F.; Kamath, A.; Banerjee, A.; Luo, Y.; Rogers, D.; Brooks, A.N.; et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat. Biotechnol. 2020, 38, 675–678. [Google Scholar] [CrossRef] [Scilit]
- Arredondo, J.; Chernyavsky, A.I.; Grando, S.A. Nicotinic receptors mediate tumorigenic action of tobacco-derived nitrosamines on immortalized oral epithelial cells. Cancer Biol. Ther. 2006, 5, 511–517. [Google Scholar] [CrossRef] [Scilit]
- Kapoor, N.; Lee, W.; Clark, E.; Bartoszewski, R.; McNicholas, C.M.; Latham, C.B.; Bebok, Z.; Parpura, V.; Fuller, C.M.; Palmer, C.A.; et al. Interaction of ASIC1 and ENaC subunits in human glioma cells and rat astrocytes. Am. J. Physiol. Physiol. 2011, 300, C1246–C1259. [Google Scholar] [CrossRef] [Scilit]
- Kajstura, M.; Halicka, H.D.; Pryjma, J.; Darzynkiewicz, Z. Discontinuous fragmentation of nuclear DNA during apoptosis revealed by discrete “sub-G1” peaks on DNA content histograms. Cytom. Part A 2007, 71A, 125–131. [Google Scholar] [CrossRef] [Scilit]
- Dietrich, A.; Tanczos, E.; Vanscheidt, W.; Schöpf, E.; Simon, J. High CD44 surface expression on primary tumours of malignant melanoma correlates with increased metastatic risk and reduced survival. Eur. J. Cancer 1997, 33, 926–930. [Google Scholar] [CrossRef] [Scilit]
- El Jamal, S.M.; Alamodi, A.; Wahl, R.U.; Grada, Z.; Shareef, M.A.; Hassan, S.-Y.; Murad, F.; Hassan, S.-L.; Santourlidis, S.; Gomez, C.R.; et al. Melanoma stem cell maintenance and chemo-resistance are mediated by CD133 signal to PI3K-dependent pathways. Oncogene 2020, 39, 5468–5478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gajos-Michniewicz, A.; Czyz, M. WNT Signaling in Melanoma. Int. J. Mol. Sci. 2020, 21, 4852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, J.; An, X.; Yang, Y.; Xu, H.; Fan, L.; Deng, L.; Linyuan, F.; Weng, X.; Zhang, J.; Zhao, R.C. MiR-1292 Targets FZD4 to Regulate Senescence and Osteogenic Differentiation of Stem Cells in TE/SJ/Mesenchymal Tissue System via the Wnt/β-catenin Pathway. Aging Dis. 2018, 9, 1103–1121. [Google Scholar] [CrossRef] [Scilit]
- Dovmark, T.H.; Saccomano, M.; Hulikova, A.; Alves, F.; Swietach, P. Connexin-43 channels are a pathway for discharging lactate from glycolytic pancreatic ductal adenocarcinoma cells. Oncogene 2017, 36, 4538–4550. [Google Scholar] [CrossRef] [Scilit]
- Kuphal, S.; Palm, H.G.; Poser, I.; Bosserhoff, A. Snail-regulated genes in malignant melanoma. Melanoma Res. 2005, 15, 305–313. [Google Scholar] [CrossRef] [Scilit]
- Madonna, G.; Ullman, C.D.; Gentilcore, G.; Palmieri, G.; Ascierto, P.A. NF-κB as potential target in the treatment of melanoma. J. Transl. Med. 2012, 10, 53. [Google Scholar] [CrossRef] [Scilit]
- Lesinski, G.B. The potential for targeting the STAT3 pathway as a novel therapy for melanoma. Futur. Oncol. 2013, 9, 925–927. [Google Scholar] [CrossRef] [Scilit]
- Sun, D.; Yu, Y.; Xue, X.; Pan, M.; Wen, M.; Li, S.; Qu, Q.; Li, X.; Zhang, L.; Li, X.; et al. Cryo-EM structure of the ASIC1a–mambalgin-1 complex reveals that the peptide toxin mambalgin-1 inhibits acid-sensing ion channels through an unusual allosteric effect. Cell Discov. 2018, 4, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mourier, G.; Salinas, M.; Kessler, P.; Stura, E.A.; Leblanc, M.; Tepshi, L.; Besson, T.; Diochot, S.; Baron, A.; Douguet, D.; et al. Mambalgin-1 Pain-relieving Peptide, Stepwise Solid-phase Synthesis, Crystal Structure, and Functional Domain for Acid-sensing Ion Channel 1a Inhibition. J. Biol. Chem. 2016, 291, 2616–2629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, Y.; Ozawa, S.; Miyamoto, C.; Maehata, Y.; Suzuki, A.; Maeda, T.; Baba, Y. Acidic extracellular microenvironment and cancer. Cancer Cell Int. 2013, 13, 89. [Google Scholar] [CrossRef] [Scilit]
- Corbet, C.; Feron, O. Tumour acidosis: From the passenger to the driver’s seat. Nat. Rev. Cancer 2017, 17, 577–593. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Zaguilan, R.; Seftor, E.A.; Seftor, R.E.B.; Chu, Y.-W.; Gillies, R.J.; Hendrix, M.J.C. Acidic pH enhances the invasive behavior of human melanoma cells. Clin. Exp. Metastasis 1996, 14, 176–186. [Google Scholar] [CrossRef] [Scilit]
- Yang, O.C.Y.; Loh, S.-H. Acidic Stress Triggers Sodium-Coupled Bicarbonate Transport and Promotes Survival in A375 Human Melanoma Cells. Sci. Rep. 2019, 9, 6858. [Google Scholar] [CrossRef] [Scilit]
- Nakanishi, M.; Korechika, A.; Yamakawa, H.; Kawabe, N.; Nakai, K.; Muragaki, Y. Acidic microenvironment induction of interleukin-8 expression and matrix metalloproteinase-2/-9 activation via acid-sensing ion channel 1 promotes breast cancer cell progression. Oncol. Rep. 2020, 45, 1284–1294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Z.-H.; Song, J.-W.; Li, W.; Liu, X.; Cao, L.; Wan, L.-M.; Tan, Y.-X.; Ji, S.-P.; Liang, Y.-M.; Gong, F. The acid-sensing ion channel, ASIC2, promotes invasion and metastasis of colorectal cancer under acidosis by activating the calcineurin/NFAT1 axis. J. Exp. Clin. Cancer Res. 2017, 36, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Zöller, M. CD44: Can a cancer-initiating cell profit from an abundantly expressed molecule? Nat. Rev. Cancer 2011, 11, 254–267. [Google Scholar] [CrossRef] [Scilit]
- Bourguignon, L.Y.W.; Singleton, P.A.; Diedrich, F.; Stern, R.; Gilad, E. CD44 Interaction with Na+-H+ Exchanger (NHE1) Creates Acidic Microenvironments Leading to Hyaluronidase-2 and Cathepsin B Activation and Breast Tumor Cell Invasion. J. Biol. Chem. 2004, 279, 26991–27007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, C.-M.; Chen, Z.; Fu, L. Frizzled Receptors as Potential Therapeutic Targets in Human Cancers. Int. J. Mol. Sci. 2018, 19, 1543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ueno, K.; Hirata, H.; Majid, S.; Yamamura, S.; Shahryari, V.; Tabatabai, Z.L.; Hinoda, Y.; Dahiya, R. Tumor Suppressor MicroRNA-493 Decreases Cell Motility and Migration Ability in Human Bladder Cancer Cells by Downregulating RhoC and FZD4. Mol. Cancer Ther. 2012, 11, 244–253. [Google Scholar] [CrossRef] [Scilit]
- Jin, C.; Yuan, F.-L.; Gu, Y.-L.; Li, X.; Liu, M.-F.; Shen, X.-M.; Liu, B.; Zhu, M.-Q. Over-expression of ASIC1a promotes proliferation via activation of the β-catenin/LEF-TCF axis and is associated with disease outcome in liver cancer. Oncotarget 2016, 8, 25977–25988. [Google Scholar] [CrossRef] [Scilit]
- Peinado, H.; Olmeda, D.; Cano, A. Snail, Zeb and bHLH factors in tumour progression: An alliance against the epithelial phenotype? Nat. Rev. Cancer 2007, 7, 415–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hemavathy, K.; Ashraf, S.I.; Ip, Y. Snail/Slug family of repressors: Slowly going into the fast lane of development and cancer. Gene 2000, 257, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Becker, K.-F.; Rosivatz, E.; Blechschmidt, K.; Kremmer, E.; Sarbia, M.; Höfler, H. Analysis of the E-Cadherin Repressor Snail in Primary Human Cancers. Cells Tissues Organs 2007, 185, 204–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, B.; Liu, J.; Ho, T.-T.; Ding, X.; Mo, Y.-Y. ERK-mediated NF-κB activation through ASIC1 in response to acidosis. Oncog. 2016, 5, e279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rooj, A.K.; McNicholas-Bevensee, C.; Bartoszewski, R.; Bebok, Z.; Benos, D.J.; Fuller, C.M. Glioma-specific Cation Conductance Regulates Migration and Cell Cycle Progression. J. Biol. Chem. 2012, 287, 4053–4065. [Google Scholar] [CrossRef] [Scilit]
- Tagliaferri, L.; Ciardo, F.G.; Fionda, B.; Casà, C.; DI Stefani, A.; Lancellotta, V.; Placidi, E.; Macchia, G.; Capocchiano, N.D.; Morganti, A.G.; et al. Non-melanoma Skin Cancer Treated by Contact High-dose-rate Radiotherapy (Brachytherapy): A Mono-institutional Series and Literature Review. In Vivo 2021, 35, 2313–2319. [Google Scholar] [CrossRef] [Scilit]
- Barker, H.E.; Paget, J.T.E.; Khan, A.; Harrington, K. The tumour microenvironment after radiotherapy: Mechanisms of resistance and recurrence. Nat. Rev. Cancer 2015, 15, 409–425. [Google Scholar] [CrossRef] [Scilit]
- Colton, M.; Cheadle, E.J.; Honeychurch, J.; Illidge, T.M. Reprogramming the tumour microenvironment by radiotherapy: Implications for radiotherapy and immunotherapy combinations. Radiat. Oncol. 2020, 15, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Deng, W.; Li, N.; Neri, S.; Sharma, A.; Jiang, W.; Lin, S.H. Combining Immunotherapy and Radiotherapy for Cancer Treatment: Current Challenges and Future Directions. Front. Pharmacol. 2018, 9, 185. [Google Scholar] [CrossRef] [Scilit]











| Gene | Primer | Amplicon Size, bp | |
|---|---|---|---|
| Forward | Reverse | ||
| β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT | 88 |
| GPDH | ACAACTTTGGTATCGTGGAAGG | GCCATCACGCCACAGTTTC | 73 |
| RPL13a | TCAAAGCCTTCGCTAGTCTCC | GGCTCTTTTTGCCCGTATGC | 104 |
| ASIC1a | CGAAGCAGGCATCAAAGTGC | TTTGGATGATAGGGAGCCACG | 642 |
| ASIC2 | CACCAAGACTTCACCACAGTGTTT | TGTAGCGGGTCTCACAGTCA | 409 |
| ASIC3 | TACAGAACTGTGCCCACCC | GGTCTTCGGAACAGAGCAGA | 502 |
| ASIC4 | GAGGAGAGAGACAAGCGGCA | GTCCAGCATGATCTCCAGGC | 930 |
| α-ENaC | CCAGGCCGCTGCACCT | GCCGATCTTCCAGTCCTTCC | 750 |
| γ-ENaC | GAGTGACGTGCCAATCAGGA | TCTCCGAAACCACAGATGGC | 305 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bychkov, M.L.; Kirichenko, A.V.; Shulepko, M.A.; Mikhaylova, I.N.; Kirpichnikov, M.P.; Lyukmanova, E.N. Mambalgin-2 Inhibits Growth, Migration, and Invasion of Metastatic Melanoma Cells by Targeting the Channels Containing an ASIC1a Subunit Whose Up-Regulation Correlates with Poor Survival Prognosis. Biomedicines 2021, 9, 1324. https://doi.org/10.3390/biomedicines9101324
Bychkov ML, Kirichenko AV, Shulepko MA, Mikhaylova IN, Kirpichnikov MP, Lyukmanova EN. Mambalgin-2 Inhibits Growth, Migration, and Invasion of Metastatic Melanoma Cells by Targeting the Channels Containing an ASIC1a Subunit Whose Up-Regulation Correlates with Poor Survival Prognosis. Biomedicines. 2021; 9(10):1324. https://doi.org/10.3390/biomedicines9101324
Chicago/Turabian StyleBychkov, Maxim L., Artem V. Kirichenko, Mikhail A. Shulepko, Irina N. Mikhaylova, Mikhail P. Kirpichnikov, and Ekaterina N. Lyukmanova. 2021. "Mambalgin-2 Inhibits Growth, Migration, and Invasion of Metastatic Melanoma Cells by Targeting the Channels Containing an ASIC1a Subunit Whose Up-Regulation Correlates with Poor Survival Prognosis" Biomedicines 9, no. 10: 1324. https://doi.org/10.3390/biomedicines9101324
APA StyleBychkov, M. L., Kirichenko, A. V., Shulepko, M. A., Mikhaylova, I. N., Kirpichnikov, M. P., & Lyukmanova, E. N. (2021). Mambalgin-2 Inhibits Growth, Migration, and Invasion of Metastatic Melanoma Cells by Targeting the Channels Containing an ASIC1a Subunit Whose Up-Regulation Correlates with Poor Survival Prognosis. Biomedicines, 9(10), 1324. https://doi.org/10.3390/biomedicines9101324
