Transgenic iPSC Lines with Genetically Encoded MitoTimer to Study Mitochondrial Biogenesis in Dopaminergic Neurons with Tauopathy
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Cultivation of iPSCs
2.3. Derivation of Transgenic iPSCs
2.4. Karyotyping
2.5. Spontaneous Differentiation of iPSCs in Embryoid Bodies
2.6. Immunofluorescence Analysis
2.7. Directed Differentiation into Midbrain Neuron Derivatives
2.8. DNA and RNA Isolation
2.9. Qualitative and Quantitative PCR
2.10. Sanger Sequencing
2.11. Calculation of Red/Green Fluorescence Ratio of the MitoTimer Biosensor
3. Results
3.1. Detection of 3R and 4R Forms of MAPT in iPSC-Derived Dopaminergic Neurons
3.2. Generation and Characterisation of Transgenic iPSC Lines Carrying the MitoTimer Biosensor
3.3. Derivation of Dopaminergic Neurons from iPSCs
3.4. The Investigation of MitoTimer Biosensor Readout in Transgenic iPSC-Derived Neurons
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Creekmore, B.C.; Watanabe, R.; Lee, E.B. Neurodegenerative Disease Tauopathies. Annu. Rev. Pathol. Mech. Dis. 2024, 19, 345–370. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.; Hirst, W.D.; Federoff, H.J.; Harms, A.S.; Stoessl, A.J.; Kordower, J.H. Nigrostriatal tau pathology in parkinsonism and Parkinson’s disease. Brain 2024, 147, 444–457. [Google Scholar] [CrossRef] [PubMed]
- Espay, A.J.; Lees, A.J. Are we entering the ‘Tau-lemaic’ era of Parkinson’s disease? Brain 2024, 147, 330–332. [Google Scholar] [CrossRef] [PubMed]
- Strang, K.H.; Golde, T.E.; Giasson, B.I. MAPT mutations, tauopathy, and mechanisms of neurodegeneration. Lab. Investig. 2019, 99, 912–928. [Google Scholar] [CrossRef]
- Hasegawa, M.; Smith, M.J.; Iijima, M.; Tabira, T.; Goedert, M. FTDP-17 mutations N279K and S305N in tau produce increased splicing of exon 10. FEBS Lett. 1999, 443, 93–96. [Google Scholar] [CrossRef] [PubMed]
- Hong, M.; Zhukareva, V.; Vogelsberg-Ragaglia, V.; Wszolek, Z.; Reed, L.; Miller, B.I.; Geschwind, D.H.; Bird, T.D.; McKeel, D.; Goate, A.; et al. Mutation-Specific Functional Impairments in Distinct Tau Isoforms of Hereditary FTDP-17. Science 1998, 282, 1914–1917. [Google Scholar] [CrossRef]
- Wren, M.C.; Zhao, J.; Liu, C.-C.; Murray, M.E.; Atagi, Y.; Davis, M.D.; Fu, Y.; Okano, H.J.; Ogaki, K.; Strongosky, A.J.; et al. Frontotemporal dementia-associated N279K tau mutant disrupts subcellular vesicle trafficking and induces cellular stress in iPSC-derived neural stem cells. Mol. Neurodegener. 2015, 10, 46. [Google Scholar] [CrossRef] [PubMed]
- Ritter, M.L.; Avila, J.; García-Escudero, V.; Hernández, F.; Pérez, M. Frontotemporal Dementia-Associated N279K Tau Mutation Localizes at the Nuclear Compartment. Front. Cell. Neurosci. 2018, 12, 202. [Google Scholar] [CrossRef] [PubMed]
- Korn, L.; Speicher, A.M.; Schroeter, C.B.; Gola, L.; Kaehne, T.; Engler, A.; Disse, P.; Fernández-Orth, J.; Csatári, J.; Naumann, M.; et al. MAPT genotype-dependent mitochondrial aberration and ROS production trigger dysfunction and death in cortical neurons of patients with hereditary FTLD. Redox Biol. 2023, 59, 102597. [Google Scholar] [CrossRef] [PubMed]
- Szabo, L.; Grimm, A.; García-León, J.A.; Verfaillie, C.M.; Eckert, A. Genetically Engineered Triple MAPT-Mutant Human-Induced Pluripotent Stem Cells (N279K, P301L, and E10+16 Mutations) Exhibit Impairments in Mitochondrial Bioenergetics and Dynamics. Cells 2023, 12, 1385. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Martin, T.; Anthony, K.; Garcia-Blanco, M.A.; Mansfield, S.G.; Anderton, B.H.; Gallo, J.-M. Correction of tau mis-splicing caused by FTDP-17 MAPT mutations by spliceosome-mediated RNA trans-splicing. Hum. Mol. Genet. 2009, 18, 3266–3273. [Google Scholar] [CrossRef]
- Iovino, M.; Agathou, S.; González-Rueda, A.; Del Castillo Velasco-Herrera, M.; Borroni, B.; Alberici, A.; Lynch, T.; O’Dowd, S.; Geti, I.; Gaffney, D.; et al. Early maturation and distinct tau pathology in induced pluripotent stem cell-derived neurons from patients with MAPT mutations. Brain 2015, 138, 3345–3359. [Google Scholar] [CrossRef]
- Valetdinova, K.R.; Malankhanova, T.B.; Zakian, S.M.; Medvedev, S.P. The Cutting Edge of Disease Modeling: Synergy of Induced Pluripotent Stem Cell Technology and Genetically Encoded Biosensors. Biomedicines 2021, 9, 960. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, G.; Thornton, C.; Stotland, A.; Lui, D.; Sin, J.; Ramil, J.; Magee, N.; Andres, A.; Quarato, G.; Carreira, R.S.; et al. MitoTimer: A novel tool for monitoring mitochondrial turnover. Autophagy 2013, 9, 1852–1861. [Google Scholar] [CrossRef] [PubMed]
- Ferree, A.W.; Trudeau, K.; Zik, E.; Benador, I.Y.; Twig, G.; Gottlieb, R.A.; Shirihai, O.S. MitoTimer probe reveals the impact of autophagy, fusion, and motility on subcellular distribution of young and old mitochondrial protein and on relative mitochondrial protein age. Autophagy 2013, 9, 1887–1896. [Google Scholar] [CrossRef] [PubMed]
- Trudeau, K.M.; Gottlieb, R.A.; Shirihai, O.S. Measurement of mitochondrial turnover and life cycle using MitoTimer. In Methods in Enzymology; Academic Press Inc.: Cambridge, MA, USA, 2014; Volume 547, pp. 21–38. [Google Scholar] [CrossRef]
- Laker, R.C.; Xu, P.; Ryall, K.A.; Sujkowski, A.; Kenwood, B.M.; Chain, K.H.; Zhang, M.; Royal, M.A.; Hoehn, K.L.; Driscoll, M.; et al. A Novel MitoTimer Reporter Gene for Mitochondrial Content, Structure, Stress, and Damage in Vivo. J. Biol. Chem. 2014, 289, 12005–12015. [Google Scholar] [CrossRef]
- Stotland, A.; Gottlieb, R.A. α-MHC MitoTimer mouse: In vivo mitochondrial turnover model reveals remarkable mitochondrial heterogeneity in the heart. J. Mol. Cell. Cardiol. 2016, 90, 53–58. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.J.; Drake, J.C.; Cui, D.; Zhang, M.; Perry, H.M.; Kashatus, J.A.; Kusminski, C.M.; Scherer, P.E.; Kashatus, D.F.; Okusa, M.D.; et al. Conditional MitoTimer reporter mice for assessment of mitochondrial structure, oxidative stress, and mitophagy. Mitochondrion 2019, 44, 20–26. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Ding, W.-X. Methods for Monitoring Mitochondrial Biogenesis and Turnover in Cultured Hepatocytes and Mouse Liver Using MitoTimer Reporter Assay. In Metabolic Reprogramming: Methods and Protocols; Papa, S., Bubici, C., Eds.; Springer: New York, NY, USA, 2023; pp. 97–107. [Google Scholar] [CrossRef]
- Gottlieb, R.A.; Stotland, A. MitoTimer: A novel protein for monitoring mitochondrial turnover in the heart. J. Mol. Med. 2015, 93, 271–278. [Google Scholar] [CrossRef]
- Cerqueira, F.; Kozer, N.; Petcherski, A.; Baranovski, B. MitoTimer-based high-content screen identifies two chemically-related benzothiophene derivatives that enhance basal mitophagy. Biochem. J. 2020, 477, 461–475. [Google Scholar] [CrossRef] [PubMed]
- Epremyan, K.K.; Goleva, T.N.; Zvyagilskaya, R.A. Effect of Tau Protein on Mitochondrial Functions. Biochem. Mosc. 2022, 87, 689–701. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Bai, F. The Association of Tau With Mitochondrial Dysfunction in Alzheimer’s Disease. Front. Neurosci. 2018, 12, 163. [Google Scholar] [CrossRef]
- Grigor’eva, E.V.; Malakhova, A.A.; Yarkova, E.S.; Minina, J.M.; Vyatkin, Y.V.; Nadtochy, J.A.; Khabarova, E.A.; Rzaev, J.A.; Medvedev, S.P.; Zakian, S.M. Generation and characterization of two induced pluripotent stem cell lines (ICGi052-A and ICGi052-B) from a patient with frontotemporal dementia with parkinsonism-17 associated with the pathological variant c.2013T>G in the MAPT gene. Vavilovskii Zhurnal Genet. I Sel. 2024, 28, 679–687. [Google Scholar] [CrossRef] [PubMed]
- Malakhova, A.A.; Grigor’eva, E.V.; Pavlova, S.V.; Malankhanova, T.B.; Valetdinova, K.R.; Vyatkin, Y.V.; Khabarova, E.; Rzaev, J.; Zakian, S.; Medvedev, S. Generation of induced pluripotent stem cell lines ICGi021-A and ICGi022-A from peripheral blood mononuclear cells of two healthy individuals from Siberian population. Stem Cell Res. 2020, 48, 101952. [Google Scholar] [CrossRef]
- Ustyantseva, E.; Pavlova, S.V.; Malakhova, A.A.; Ustyantsev, K.; Zakian, S.M.; Medvedev, S.P. Oxidative stress monitoring in iPSC-derived motor neurons using genetically encoded biosensors of H2O2. Sci. Rep. 2022, 12, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef]
- DeKelver, R.C.; Choi, V.M.; Moehle, E.A.; Paschon, D.E.; Hockemeyer, D.; Meijsing, S.H.; Sancak, Y.; Cui, X.; Steine, E.J.; Miller, J.C.; et al. Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Res. 2010, 20, 1133–1142. [Google Scholar] [CrossRef] [PubMed]
- Yarkova, E.S.; Grigor’eva, E.V.; Medvedev, S.P.; Tarasevich, D.A.; Pavlova, S.V.; Valetdinova, K.R.; Minina, J.M.; Zakian, S.M.; Malakhova, A.A. Detection of ER stress in iPSC-derived neurons carrying the p.N370S mutation in the GBA1 gene. Biomedicines 2024, 12, 744. [Google Scholar] [CrossRef]
- Grigor’eva, E.V.; Kopytova, A.E.; Yarkova, E.S.; Pavlova, S.V.; Sorogina, D.A.; Malakhova, A.A.; Malankhanova, T.B.; Baydakova, G.V.; Zakharova, E.Y.; Medvedev, S.P.; et al. Biochemical Characteristics of iPSC-Derived Dopaminergic Neurons from N370S GBA Variant Carriers with and without Parkinson’s Disease. Int. J. Mol. Sci. 2023, 24, 4437. [Google Scholar] [CrossRef] [PubMed]
- Oosterveen, T.; Garção, P.; Moles-Garcia, E.; Soleilhavoup, C.; Travaglio, M.; Sheraz, S.; Peltrini, R.; Patrick, K.; Labas, V.; Combes-Soia, L.; et al. Pluripotent stem cell derived dopaminergic subpopulations model the selective neuron degeneration in Parkinson’s disease. Stem Cell Rep. 2021, 16, 2718–2735. [Google Scholar] [CrossRef] [PubMed]
- Cowan, C.A.; Klimanskaya, I.; McMahon, J.; Atienza, J.; Witmyer, J.; Zucker, J.P.; Wang, S.; Morton, C.C.; McMahon, A.P.; Powers, D.; et al. Derivation of embryonic stem-cell lines from human blastocysts. N. Engl. J. Med. 2004, 350, 1353–1356. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- McGowan-Jordan, J.; Hastings, R.J.; Moore, S. ISCN 2020: An International System for Human Cytogenomic Nomenclature. Cytogenetic and Genome Research; S.Karger AG: Basel, Switzerland, 2020; Volume 160. [Google Scholar] [CrossRef]
- Gossen, M.; Freundlieb, S.; Bender, G.; Müller, G.; Hillen, W.; Bujard, H. Transcriptional Activation by Tetracyclines in Mammalian Cells. Science 1995, 268, 1766–1769. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.P.; Hartley, R.C. Mitochondria as a therapeutic target for common pathologies. Nat. Rev. Drug Discov. 2018, 17, 865–886. [Google Scholar] [CrossRef]
- Picard, M.; Shirihai, O.S. Mitochondrial signal transduction. Cell Metab. 2022, 34, 1620–1653. [Google Scholar] [CrossRef] [PubMed]
- Ardail, D.; Privat, J.P.; Egret-Charlier, M.; Levrat, C.; Lerme, F.; Louisot, P. Mitochondrial contact sites. Lipid composition and dynamics. J. Biol. Chem. 1990, 265, 18797–18802. [Google Scholar] [CrossRef]
- Paradies, G.; Paradies, V.; De Benedictis, V.; Ruggiero, F.M.; Petrosillo, G. Functional role of cardiolipin in mitochondrial bioenergetics. Biochim. Biophys. Acta Bioenerg. 2014, 1837, 408–417. [Google Scholar] [CrossRef] [PubMed]
- Esteras, N.; Rohrer, J.D.; Hardy, J.; Wray, S.; Abramov, A.Y. Mitochondrial hyperpolarization in iPSC-derived neurons from patients of FTDP-17 with 10+16 MAPT mutation leads to oxidative stress and neurodegeneration. Redox Biol. 2017, 12, 410–422. [Google Scholar] [CrossRef] [PubMed]
- Verheyen, A.; Diels, A.; Reumers, J.; Van Hoorde, K.; Van den Wyngaert, I.; van Outryve d’Ydewalle, C.; De Bondt, A.; Kuijlaars, J.; De Muynck, L.; De Hoogt, R.; et al. Genetically Engineered iPSC-Derived FTDP-17 MAPT Neurons Display Mutation-Specific Neurodegenerative and Neurodevelopmental Phenotypes. Stem Cell Rep. 2018, 11, 363–379. [Google Scholar] [CrossRef]
- Minaya, M.A.; Mahali, S.; Iyer, A.K.; Eteleeb, A.M.; Martinez, R.; Huang, G.; Budde, J.; Temple, S.; Nana, A.L.; Seeley, W.W.; et al. Conserved gene signatures shared among MAPT mutations reveal defects in calcium signaling. Front. Mol. Biosci. 2023, 10, 1051494. [Google Scholar] [CrossRef]
- Mahali, S.; Martinez, R.; King, M.; Verbeck, A.; Harari, O.; Benitez, B.A.; Horie, K.; Sato, C.; Temple, S.; Karch, C.M. Defective proteostasis in induced pluripotent stem cell models of frontotemporal lobar degeneration. Transl. Psychiatry 2022, 12, 1–11. [Google Scholar] [CrossRef]
- Elitt, M.S.; Barbar, L.; Tesar, P.J. Drug screening for human genetic diseases using iPSC models. Hum. Mol. Genet. 2018, 27, R89–R98. [Google Scholar] [CrossRef] [PubMed]
- Rowe, R.G.; Daley, G.Q. Induced pluripotent stem cells in disease modelling and drug discovery. Nat. Rev. Genet. 2019, 20, 377–388. [Google Scholar] [CrossRef]
- Merling, R.K.; Sweeney, C.L.; Chu, J.; Bodansky, A.; Choi, U.; Priel, D.L.; Kuhns, D.B.; Wang, H.; Vasilevsky, S.; De Ravin, S.S.; et al. An AAVS1-Targeted Minigene Platform for Correction of iPSCs From All Five Types of Chronic Granulomatous Disease. Mol. Ther. 2015, 23, 147–157. [Google Scholar] [CrossRef]
- Bharucha, N.; Ataam, J.A.; Gavidia, A.A.; Karakikes, I. Generation of AAVS1 integrated doxycycline-inducible CRISPR-Prime Editor human induced pluripotent stem cell line. Stem Cell Res. 2021, 57, 102610. [Google Scholar] [CrossRef]
- Oceguera-Yanez, F.; Kim, S.-I.; Matsumoto, T.; Tan, G.W.; Xiang, L.; Hatani, T.; Kondo, T.; Ikeya, M.; Yoshida, Y.; Inoue, H.; et al. Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods 2016, 101, 43–55. [Google Scholar] [CrossRef] [PubMed]
- Tiyaboonchai, A.; Mac, H.; Shamsedeen, R.; Mills, J.A.; Kishore, S.; French, D.L.; Gadue, P. Utilization of the AAVS1 safe harbor locus for hematopoietic specific transgene expression and gene knockdown in human ES cells. Stem Cell Res. 2014, 12, 630–637. [Google Scholar] [CrossRef]
- Sadelain, M.; Papapetrou, E.P.; Bushman, F.D. Safe harbours for the integration of new DNA in the human genome. Nat. Rev. Cancer 2011, 12, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, H.; Kubo, Y.; Izumida, M.; Matsuyama, T. Efficient viral delivery of Cas9 into human safe harbor. Sci. Rep. 2020, 10, 21474. [Google Scholar] [CrossRef] [PubMed]





| Target | Size of Band | Forward/Reverse Primer (5′–3′) | |
|---|---|---|---|
| Housekeeping gene (RT-qPCR) | B2M | 90 bp | TAGCTGTGCTCGCGCTACT/ TCTCTGCTGGATGACGTGAG |
| Pluripotency marker (RT-qPCR) | NANOG | 116 bp | TTTGTGGGCCTGAAGAAAACT/ AGGGCTGTCCTGAATAAGCAG |
| OCT4 | 94 bp | CTTCTGCTTCAGGAGCTTGG/ GAAGGAGAAGCTGGAGCAAA | |
| SOX2 | 100 bp | GCTTAGCCTCGTCGATGAAC/ AACCCCAAGATGCACAACTC | |
| Mycoplasma detection | 16S ribosomal RNA gen | 280 bp | GGGAGCAAACAGGATTAGATACCCT/ TGCACCATCTGTCACTCTGTTAACCTC |
| MAPT mutation analysis | MAPT:c.2013T > G | 427 bp | TCGTAAAGCCCGCTGGAAAT/ GTGTACGCACTCACACCACT |
| Expression of 3R and 4R transcript form MAPT | 3R and 4R MAPT | 305 bp (3R) 398 bp (4R) | GTCAAGTCCAAGATCGGCTC/ TGGTCTGTCTTGGCTTTGGC |
| Detection of the wild-type AAVS1 allele | AAVS1 | 555 bp | CTCTGGCTCCATCGTAAGCAA/ CCCAAAGTACCCCGTCTCCC |
| Integration of the M2rtTA transgene into the AAVS1 locus | Neo-M2rtTA | 1024 bp | CCGGACCACTTTGAGCTCTAC/ GCCCAGTCATAGCCGAATAG |
| Integration of the MitoTimer transgene into the AAVS1 locus | Puro-TRE-mCMV-MitoTimer | 1022 bp | CCGGACCACTTTGAGCTCTAC/ AGGCGCACCGTGGGCTTGTAC |
| Off-target integration of the AAVS1-Neo- M2rtTAplasmid into the genome | AAVS1-Neo-M2rtTA | 1063 bp | CAGGAAACAGCTATGAC/ GCCCAGTCATAGCCGAATAG |
| Off-target integration of the pAAVS1-TRE-mCMV-MitoTimer plasmid into the genome | pAAVS1-TRE-mCMV-MitoTimer | 1007 bp | CAGGAAACAGCTATGAC/ GCCCAGTCATAGCCGAATAG |
| Cell Line | % of Polyploid Metaphases | % of Metaphases with Different Number of Chromosomes | Number of Analysed Metaphases | Karyotypes in Diploid Cells | ||||
|---|---|---|---|---|---|---|---|---|
| 42–44 | 45 | 46 | 47 | 48 | ||||
| K7-4Lf MT16 | 5.4 | 11 | 12.7 | 60 | 5.4 | 5.4 | 55 | 46,XX |
| K7-4Lf MT21 | 8 | 4 | 4 | 80 | 4 | 0 | 50 | 46,XX |
| PD57-7 MT6 | 5.3 | 12.5 | 12.5 | 66.1 | 1.8 | 1.8 | 56 | 46,XX |
| PD57-7 MT8 | 6.4 | 6.4 | 12.9 | 67.8 | 6.4 | 0 | 62 | 46,XX |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nadtochy, J.A.; Medvedev, S.P.; Grigor’eva, E.V.; Pavlova, S.V.; Minina, J.M.; Chechushkov, A.V.; Malakhova, A.A.; Kovalenko, L.V.; Zakian, S.M. Transgenic iPSC Lines with Genetically Encoded MitoTimer to Study Mitochondrial Biogenesis in Dopaminergic Neurons with Tauopathy. Biomedicines 2025, 13, 550. https://doi.org/10.3390/biomedicines13030550
Nadtochy JA, Medvedev SP, Grigor’eva EV, Pavlova SV, Minina JM, Chechushkov AV, Malakhova AA, Kovalenko LV, Zakian SM. Transgenic iPSC Lines with Genetically Encoded MitoTimer to Study Mitochondrial Biogenesis in Dopaminergic Neurons with Tauopathy. Biomedicines. 2025; 13(3):550. https://doi.org/10.3390/biomedicines13030550
Chicago/Turabian StyleNadtochy, Julia A., Sergey P. Medvedev, Elena V. Grigor’eva, Sophia V. Pavlova, Julia M. Minina, Anton V. Chechushkov, Anastasia A. Malakhova, Liudmila V. Kovalenko, and Suren M. Zakian. 2025. "Transgenic iPSC Lines with Genetically Encoded MitoTimer to Study Mitochondrial Biogenesis in Dopaminergic Neurons with Tauopathy" Biomedicines 13, no. 3: 550. https://doi.org/10.3390/biomedicines13030550
APA StyleNadtochy, J. A., Medvedev, S. P., Grigor’eva, E. V., Pavlova, S. V., Minina, J. M., Chechushkov, A. V., Malakhova, A. A., Kovalenko, L. V., & Zakian, S. M. (2025). Transgenic iPSC Lines with Genetically Encoded MitoTimer to Study Mitochondrial Biogenesis in Dopaminergic Neurons with Tauopathy. Biomedicines, 13(3), 550. https://doi.org/10.3390/biomedicines13030550

