Role of BAL and Serum Krebs von den Lungen-6 (KL-6) in Patients with Pulmonary Fibrosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Population
2.2. Pulmonary Function Tests (PFT)
2.3. Six-Minute Walking Test (6MWT)
2.4. Bronchoscopy with Broncho-Alveolar Lavage
2.5. RNA Extraction
2.6. Quantitive Real-Time PCR (qRT-PCR)
2.7. Statistical Analysis
3. Results
3.1. Demographic and Clinical Characteristics of the Population
3.2. KL-6 Gene Expression
3.3. KL-6: BAL vs. SERUM
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Travis, W.D.; Costabel, U.; Hansell, D.M.; King, T.E., Jr.; Lynch, D.A.; Nicholson, A.G.; Ryerson, C.J.; Ryu, J.H.; Selman, M.; Wells, A.U.; et al. An official American Thoracic Society/European Respiratory Society statement: Update of the international multidisciplinary classification of the idiopathic interstitial pneumonias. Am. J. Respir. Crit. Care Med. 2013, 188, 733–748. [Google Scholar] [CrossRef] [PubMed]
- Wijsenbeek, M.; Suzuki, A.; Maher, T.M. Interstitial Lung Diseases. Lancet 2022, 400, 769–786. [Google Scholar] [CrossRef] [PubMed]
- Landini, N.; Orlandi, M.; Bruni, C.; Carlesi, E.; Nardi, C.; Nardi, C.; Calistri, L.; Morana, G.; Tomassetti, S.; Colagrande, S.; et al. Computed Tomography Predictors of Mortality or Disease Progression in Systemic Sclerosis-Interstitial Lung Disease: A Systematic Review. Front Med. 2022, 8, 807982. [Google Scholar] [CrossRef] [PubMed]
- Raghu, G.; Mehta, S. Interstitial Lung Disease (ILD) in India: Insights and Lessons from the Prospective, Landmark ILD-India Registry. Lung India 2016, 33, 589–591. [Google Scholar] [CrossRef] [PubMed]
- Tomos, I.; Roussis, I.; Matthaiou, A.M.; Dimakou, K. Molecular and Genetic Biomarkers in Idiopathic Pulmonary Fibrosis: Where Are We Now? Biomedicines 2023, 11, 2796. [Google Scholar] [CrossRef] [PubMed]
- Salton, F.; Ruaro, B.; Confalonieri, P.; Confalonieri, M. Epithelial-Mesenchymal Transition: A Major Pathogenic Driver in Idiopathic Pulmonary Fibrosis? Medicina 2020, 56, 608. [Google Scholar] [CrossRef] [PubMed]
- Giriyappagoudar, M.; Vastrad, B.; Horakeri, R.; Vastrad, C. Study on Potential Differentially Expressed Genes in Idiopathic Pulmonary Fibrosis by Bioinformatics and Next-Generation Sequencing Data Analysis. Biomedicines 2023, 11, 3109. [Google Scholar] [CrossRef]
- Wu, Z.; Chen, H.; Ke, S.; Mo, L.; Qiu, M.; Zhu, G.; Zhu, W.; Liu, L. Identifying potential biomarkers of idiopathic pulmonary fibrosis through machine learning analysis. Sci. Rep. 2023, 13, 16559. [Google Scholar] [CrossRef]
- Domvri, K.; Organtzis, I.; Apostolopoulos, A.; Fouka, E.; Kontakiotis, T.; Papakosta, D. Prognostic Value of Serum Biomarkers in Patients with Idiopathic Pulmonary Fibrosis in Relation to Disease Progression. J. Pers. Med. 2023, 13, 1307. [Google Scholar] [CrossRef]
- Mendoza, N.; Casas-Recasens, S.; Olvera, N.; Hernandez-Gonzalez, F.; Cruz, T.; Albacar, N.; Alsina-Restoy, X.; Frino-Garcia, A.; López-Saiz, G.; Robres, L.; et al. Blood Immunophenotypes of Idiopathic Pulmonary Fibrosis: Relationship with Disease Severity and Progression. Int. J. Mol. Sci. 2023, 24, 13832. [Google Scholar] [CrossRef]
- Karampitsakos, T.; Juan-Guardela, B.M.; Tzouvelekis, A.; Herazo-Maya, J.D. Precision medicine advances in idiopathic pulmonary fibrosis. EBioMedicine 2023, 95, 104766. [Google Scholar] [CrossRef] [PubMed]
- Wakamatsu, K.; Nagata, N.; Kumazoe, H.; Oda, K.; Ishimoto, H.; Yoshimi, M.; Takata, S.; Hamada, M.; Koreeda, Y.; Takakura, K.; et al. Prognostic value of serial serum KL-6 measurements in patients with idiopathic pulmonary fibrosis. Respir. Investig. 2017, 55, 16–23. [Google Scholar] [CrossRef] [PubMed]
- d’Alessandro, M.; Carleo, A.; Cameli, P.; Bergantini, L.; Perrone, A.; Vietri, L.; Lanzarone, N.; Vagaggini, C.; Sestini, P.; Bargagli, E. BAL biomarkers’ panel for differential diagnosis of interstitial lung diseases. Clin. Exp. Med. 2020, 20, 207–216. [Google Scholar] [CrossRef] [PubMed]
- Hirasawa, Y.; Kohno, N.; Yokoyama, A.; Inoue, Y.; Abe, M.; Hiwada, K. KL-6, a human MUC1 mucin, is chemotactic for human fibroblasts. Am. J. Respir. Cell Mol. Biol. 1997, 17, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Ohshimo, S.; Yokoyama, A.; Hattori, N.; Ishikawa, N.; Hirasawa, Y.; Kohno, N. KL-6, a human MUC1 mucin, promotes proliferation and survival of lung fibroblasts. Biochem. Biophys. Res. Commun. 2005, 338, 1845–1852. [Google Scholar] [CrossRef]
- Jiang, D.; Xiao, H.; Dong, R.; Geng, J.; Xie, B.; Ren, Y.; Dai, H. Krebs von den Lungen-6 levels in untreated idiopathic pulmonary fibrosis. Clin. Respir. J. 2022, 16, 234–243. [Google Scholar] [CrossRef]
- Lederer, C.; Mayer, K.; Somogyi, V.; Kriegsmann, K.; Kriegsmann, M.; Buschulte, K.; Polke, M.; Findeisen, P.; Herth, F.; Kreuter, M. Krebs von den Lungen-6 as a Potential Predictive Biomarker in Fibrosing Interstitial Lung Diseases. Respiration 2023, 102, 591–600. [Google Scholar] [CrossRef]
- Chung, C.; Kim, J.; Cho, H.S.; Kim, H.C. Baseline serum Krebs von den Lungen-6 as a biomarker for the disease progression in idiopathic pulmonary fibrosis. Sci. Rep. 2022, 12, 8564. [Google Scholar] [CrossRef]
- Ikuyama, Y.; Ushiki, A.; Kosaka, M.; Akahane, J.; Mukai, Y.; Araki, T.; Kitaguchi, Y.; Tateishi, K.; Urushihata, K.; Yasuo, M.; et al. Prognosis of patients with acute exacerbation of combined pulmonary fibrosis and emphysema: A retrospective single-centre study. BMC Pulm. Med. 2020, 20, 144. [Google Scholar] [CrossRef]
- Ishikawa, N.; Hattori, N.; Yokoyama, A.; Kohno, N. Utility of KL-6/MUC1 in the clinical management of interstitial lung diseases. Respir. Investig. 2012, 50, 3–13. [Google Scholar] [CrossRef]
- d’Alessandro, M.; Bergantini, L.; Cameli, P.; Pieroni, M.; Refini, R.M.; Sestini, P.; Bargagli, E. Serum Concentrations of KL-6 in Patients with IPF and Lung Cancer and Serial Measurements of KL-6 in IPF Patients Treated with Antifibrotic Therapy. Cancers 2021, 13, 689. [Google Scholar] [CrossRef] [PubMed]
- Raghu, G.; Remy-Jardin, M.; Richeldi, L.; Thomson, C.C.; Inoue, Y.; Johkoh, T.; Kreuter, M.; Lynch, D.A.; Maher, T.M.; Martinez, F.J.; et al. Idiopathic Pulmonary Fibrosis (an Update) and Progressive Pulmonary Fibrosis in Adults: An Official ATS/ERS/JRS/ALAT Clinical Practice Guideline. Am. J. Respir. Crit. Care Med. 2022, 205, e18–e47. [Google Scholar] [CrossRef]
- Hambly, N.; Farooqi, M.M.; Dvorkin-Gheva, A.; Donohoe, K.; Garlick, K.; Scallan, C.; Chong, S.G.; MacIsaac, S.; Assayag, D.; Johannson, K.A.; et al. Prevalence and characteristics of progressive fibrosing interstitial lung disease in a prospective registry. Eur. Respir. J. 2022, 60, 2102571. [Google Scholar] [CrossRef] [PubMed]
- Quanjer, P.H.; Tammeling, G.J.; Cotes, J.E.; Pedersen, O.F.; Peslin, R.; Yernault, J.C. Lung volumes and forced ventilatory flows. Eur. Respir. J. 1993, 6 (Suppl. S16), 5–40. [Google Scholar] [CrossRef] [PubMed]
- Klech, H.; Hutter, C. (Eds.) Clinical guidelines and indications for bronchoalveolar lavage (BAL): Report of the European Society of Pneumology Task Group on BAL. Eur. Respir. J. 1990, 3, 937–976. [Google Scholar] [CrossRef]
- Meyer, K.C.; Raghu, G.; Baughman, R.P.; Brown, K.K.; Costabel, U.; du Bois, R.M.; Drent, M.; Haslam, P.L.; Kim, D.S.; Nagai, S.; et al. An official American Thoracic Society clinical practice guideline: The clinical utility of bronchoalveolar lavage cellular analysis in interstitial lung disease. Am. J. Respir. Crit. Care Med. 2012, 185, 1004–1014. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chapman, J.R.; Waldenström, J. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies. PLoS ONE 2015, 10, e0141853. [Google Scholar] [CrossRef]
- Sgalla, G.; Iovene, B.; Calvello, M.; Ori, M.; Varone, F.; Richeldi, L. Idiopathic pulmonary fibrosis: Pathogenesis and management. Respir. Res. 2018, 19, 32. [Google Scholar] [CrossRef]
- Balci, A.; Düz, M.E.; Vurmaz, A.; Çilekar, Ş.; Kaya, F. Comprehensive biomarker analysis of patients with idiopathic pulmonary fibrosis and interstitial lung disease with healthy individuals. Eur. Rev. Med. Pharmacol. Sci. 2023, 27, 5468–5479. [Google Scholar] [CrossRef]
- Ohnishi, H.; Yokoyama, A.; Kondo, K.; Hamada, H.; Abe, M.; Nishimura, K.; Hiwada, K.; Kohno, N. Comparative study of KL-6, surfactant protein-A, surfactant protein-D, and monocyte chemoattractant protein-1 as serum markers for interstitial lung diseases. Am. J. Respir. Crit. Care Med. 2002, 165, 378–381. [Google Scholar] [CrossRef]
- Kohno, N. Serum marker KL-6/MUC1 for the diagnosis and management of interstitial pneumonitis. J. Med. Investig. 1999, 46, 151–158. [Google Scholar] [PubMed]
- Oguz, E.O.; Kucuksahin, O.; Turgay, M.; Yildizgoren, M.T.; Ates, A.; Demir, N.; Kumbasar, O.O.; Kinikli, G.; Duzgun, N. Association of serum KL-6 levels with interstitial lung disease in patients with connective tissue disease: A cross-sectional study. Clin. Rheumatol. 2016, 35, 663–666. [Google Scholar] [CrossRef] [PubMed]
- Tagami, Y.; Hara, Y.; Murohashi, K.; Nagasawa, R.; Nishikawa, Y.; Tanaka, M.; Aoki, A.; Tanaka, K.; Nakashima, K.; Watanabe, K.; et al. Comparison of Clinical Features between the High and Low Serum KL-6 Patients with Acute Exacerbation of Interstitial Lung Diseases. Can. Respir. J. 2021, 2021, 9099802. [Google Scholar] [CrossRef] [PubMed]
- Fathi, M.; Barbasso Helmers, S.; Lundberg, I.E. KL-6: A serological biomarker for interstitial lung disease in patients with polymyositis and dermatomyositis. J. Intern. Med. 2012, 271, 589–597. [Google Scholar] [CrossRef]
- Zhang, H.; Chen, L.; Wu, L.; Huang, J.; Li, H.; Wang, X.; Weng, H. Diagnostic and prognostic predictive values of circulating KL-6 for interstitial lung disease: A PRISMA-compliant systematic review and meta-analysis. Medicine 2020, 99, e19493. [Google Scholar] [CrossRef]
KL-6 | FORWARD | 5′AGACGTCAGCGTGAGTGATG 3′ |
REVERSE | 5′GACAGCCAAGGCAATGAGAT 3′ | |
β-actin | FORWARD | 5′GACGACATGGAGAAAATCTG 3′ |
REVERSE | 5′ATGATCTGGGTCATCTTCTC 3′ |
ALL n = 97 | PPF n = 39 | nPPF n = 58 | p-Value | |
---|---|---|---|---|
Demographic data | ||||
sex, % male | 58.8 | 66.7 | 53.5 | ns |
age, years | 64.5 | 65.0 | 64.3 | ns |
smoke, % | 16.5 | 24.3 | 11.7 | ns |
Functional respiratory data | ||||
FEV1, % | 76.3 | 69.8 | 81.3 | p = 0.0156 * |
FVC, % | 74.5 | 67.4 | 80.2 | p = 0.0051 ** |
DLCO, % | 58.5 | 48.9 | 66.4 | p = 0.0005 ** |
6MWT, meters | 352.2 | 337.0 | 364.4 | ns |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soccio, P.; Moriondo, G.; d’Alessandro, M.; Scioscia, G.; Bergantini, L.; Gangi, S.; Tondo, P.; Foschino Barbaro, M.P.; Cameli, P.; Bargagli, E.; et al. Role of BAL and Serum Krebs von den Lungen-6 (KL-6) in Patients with Pulmonary Fibrosis. Biomedicines 2024, 12, 269. https://doi.org/10.3390/biomedicines12020269
Soccio P, Moriondo G, d’Alessandro M, Scioscia G, Bergantini L, Gangi S, Tondo P, Foschino Barbaro MP, Cameli P, Bargagli E, et al. Role of BAL and Serum Krebs von den Lungen-6 (KL-6) in Patients with Pulmonary Fibrosis. Biomedicines. 2024; 12(2):269. https://doi.org/10.3390/biomedicines12020269
Chicago/Turabian StyleSoccio, Piera, Giorgia Moriondo, Miriana d’Alessandro, Giulia Scioscia, Laura Bergantini, Sara Gangi, Pasquale Tondo, Maria Pia Foschino Barbaro, Paolo Cameli, Elena Bargagli, and et al. 2024. "Role of BAL and Serum Krebs von den Lungen-6 (KL-6) in Patients with Pulmonary Fibrosis" Biomedicines 12, no. 2: 269. https://doi.org/10.3390/biomedicines12020269
APA StyleSoccio, P., Moriondo, G., d’Alessandro, M., Scioscia, G., Bergantini, L., Gangi, S., Tondo, P., Foschino Barbaro, M. P., Cameli, P., Bargagli, E., & Lacedonia, D. (2024). Role of BAL and Serum Krebs von den Lungen-6 (KL-6) in Patients with Pulmonary Fibrosis. Biomedicines, 12(2), 269. https://doi.org/10.3390/biomedicines12020269