Biosafety Evaluation of a Chimeric Adenoviral Vector in Mini-Pigs: Insights into Immune Tolerance and Gene Therapy Potential
Abstract
1. Introduction
2. Material and Methods
2.1. Study Design
2.2. Preparation of Chimeric Adenoviral Vector
2.3. Preparation of the Autologous GFP-Enriched Leucoconcentrate
2.4. Cellular and Molecular Analysis of the GFP-Enriched Leucoconcentrate
2.4.1. Flow Cytometry Analysis
2.4.2. RT-PCR Assay
2.4.3. RNA Sequencing and Bioinformatics Analysis
2.4.4. Multiplex Assay
2.5. Animals and Treatments
2.5.1. Experimental Groups
2.5.2. Clinical and Laboratory Examination
2.6. Histology and Immunofluorescence Analysis
2.6.1. Samples Collection
2.6.2. Light Microscopy
2.6.3. Fluorescent Microscopy
2.7. Statistics
3. Results
3.1. In Vitro Study
3.1.1. Expression of GFP in Gene-Modified Leucocytes
3.1.2. Multiplex Analysis of the Gene-Modified Leucocytes Secretome
3.1.3. Analysis of the Gene-Modified Leucocytes Transcriptome
3.2. In Vivo Study
3.2.1. Behavioral and Instrumental Tests
3.2.2. Blood Tests
3.2.3. Histology Study
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aiuti, A.; Roncarolo, M.G.; Naldini, L. Gene therapy for ADA-SCID, the first marketing approval of an ex vivo gene therapy in Europe: Paving the road for the next generation of advanced therapy medicinal products. EMBO Mol. Med. 2017, 9, 737–740. [Google Scholar] [CrossRef] [PubMed]
- Mendell, J.R.; Al-Zaidy, S.A.; Rodino-Klapac, L.R.; Goodspeed, K.; Gray, S.J.; Kay, C.N.; Boye, S.L.; Boye, S.E.; George, L.A.; Salabarria, S.; et al. Current Clinical Applications of In Vivo Gene Therapy with AAVs. Mol. Ther. 2021, 29, 464–488. [Google Scholar] [CrossRef]
- O’Connor, D.M.; Boulis, N.M. Gene therapy for neurodegenerative diseases. Trends Mol. Med. 2015, 21, 504–512. [Google Scholar] [CrossRef] [PubMed]
- Steffin, D.H.M.; Hsieh, E.M.; Rouce, R.H. Gene Therapy: Current Applications and Future Possibilities. Adv. Pediatr. 2019, 66, 37–54. [Google Scholar] [CrossRef]
- Dunbar, C.E.; High, K.A.; Joung, J.K.; Kohn, D.B.; Ozawa, K.; Sadelain, M. Gene therapy comes of age. Science 2018, 359, eaan4672. [Google Scholar] [CrossRef]
- Wang, C.; Pan, C.; Yong, H.; Wang, F.; Bo, T.; Zhao, Y.; Ma, B.; He, W.; Li, M. Emerging non-viral vectors for gene delivery. J. Nanobiotechnol. 2023, 21, 272. [Google Scholar] [CrossRef]
- Ginn, S.L.; Mandwie, M.; Alexander, I.E.; Edelstein, M.; Abedi, M.R. Gene therapy clinical trials worldwide to 2023—An update. J. Gene Med. 2024, 26, e3721. [Google Scholar] [CrossRef]
- Lundstrom, K. Viral vectors engineered for gene therapy. Int. Rev. Cell Mol. Biol. 2023, 379, 1–41. [Google Scholar] [CrossRef] [PubMed]
- Arjmand, B.; Larijani, B.; Sheikh Hosseini, M.; Payab, M.; Gilany, K.; Goodarzi, P.; Parhizkar Roudsari, P.; Amanollahi Baharvand, M.; Hoseini Mohammadi, N.S. The Horizon of Gene Therapy in Modern Medicine: Advances and Challenges. Adv. Exp. Med. Biol. 2020, 1247, 33–64. [Google Scholar] [CrossRef]
- Gonin, P.; Buchholz, C.J.; Pallardy, M.; Mezzina, M. Gene therapy bio-safety: Scientific and regulatory issues. Gene Ther. 2005, 12 (Suppl. S1), S146–S152. [Google Scholar] [CrossRef][Green Version]
- Blind, J.E.; McLeod, E.N.; Brown, A.; Patel, H.; Ghosh, S. Biosafety Practices for In Vivo Viral-Mediated Gene Therapy in the Health Care Setting. Appl. Biosaf. 2020, 25, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Le, Y.; Zhang, Z.; Nian, X.; Liu, B.; Yang, X. Viral Vector-Based Gene Therapy. Int. J. Mol. Sci. 2023, 24, 7736. [Google Scholar] [CrossRef] [PubMed]
- Zu, H.; Gao, D. Non-viral Vectors in Gene Therapy: Recent Development, Challenges, and Prospects. AAPS J. 2021, 23, 78. [Google Scholar] [CrossRef] [PubMed]
- Athanasopoulos, T.; Munye, M.M.; Yáñez-Muñoz, R.J. Nonintegrating Gene Therapy Vectors. Hematol. Oncol. Clin. N. Am. 2017, 31, 753–770. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Li, X.; Sun, W. Applications of Recombinant Adenovirus-p53 Gene Therapy for Cancers in the Clinic in China. Curr. Gene Ther. 2020, 20, 127–141. [Google Scholar] [CrossRef]
- Waldrop, M.A.; Karingada, C.; Storey, M.A.; Powers, B.; Iammarino, M.A.; Miller, N.F.; Alfano, L.N.; Noritz, G.; Rossman, I.; Ginsberg, M.; et al. Gene Therapy for Spinal Muscular Atrophy: Safety and Early Outcomes. Pediatrics 2020, 146, e20200729. [Google Scholar] [CrossRef]
- Fischer, A.; Hacein-Bey-Abina, S. Gene therapy for severe combined immunodeficiencies and beyond. J. Exp. Med. 2020, 217, e20190607. [Google Scholar] [CrossRef]
- Gupta, A.O.; Raymond, G.; Pierpont, E.I.; Kemp, S.; McIvor, R.S.; Rayannavar, A.; Miller, B.; Lund, T.C.; Orchard, P.J. Treatment of cerebral adrenoleukodystrophy: Allogeneic transplantation and lentiviral gene therapy. Expert Opin. Biol. Ther. 2022, 22, 1151–1162. [Google Scholar] [CrossRef]
- Singh, S.; Kumar, R.; Agrawal, B. Adenoviral Vector-Based Vaccines and Gene Therapies: Current Status and Future Prospects. In Adenoviruses; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef]
- Cotrim, A.P.; Baum, B.J. Gene therapy: Some history, applications, problems, and prospects. Toxicol. Pathol. 2008, 36, 97–103. [Google Scholar] [CrossRef]
- Lee, C.S.; Bishop, E.S.; Zhang, R.; Yu, X.; Farina, E.M.; Yan, S.; Zhao, C.; Zheng, Z.; Shu, Y.; Wu, X.; et al. Adenovirus-Mediated Gene Delivery: Potential Applications for Gene and Cell-Based Therapies in the New Era of Personalized Medicine. Genes Dis. 2017, 4, 43–63. [Google Scholar] [CrossRef]
- Southgate, T.; Kroeger, K.M.; Liu, C.; Lowenstein, P.R.; Castro, M.G. Gene transfer into neural cells in vitro using adenoviral vectors. Curr. Protoc. Neurosci. 2008, 45, 4–23. [Google Scholar] [CrossRef] [PubMed]
- Uchida, K.; Nakajima, H.; Guerrero, A.R.; Johnson, W.E.; Masri, W.; El Baba, H. Gene therapy strategies for the treatment of spinal cord injury. Ther. Deliv. 2014, 5, 591–607. [Google Scholar] [CrossRef] [PubMed]
- Sosnovtseva, A.O.; Stepanova, O.V.; Stepanenko, A.A.; Voronova, A.D.; Chadin, A.V.; Valikhov, M.P.; Chekhonin, V.P. Recombinant Adenoviruses for Delivery of Therapeutics Following Spinal Cord Injury. Front. Pharmacol. 2021, 12, 777628. [Google Scholar] [CrossRef] [PubMed]
- Gall, J.; Kass-Eisler, A.; Leinwand, L.; Falck-Pedersen, E. Adenovirus type 5 and 7 capsid chimera: Fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. J. Virol. 1996, 70, 2116–2123. [Google Scholar] [CrossRef] [PubMed]
- Lewis, T.B.; Glasgow, J.N.; Harms, A.S.; Standaert, D.G.; Curiel, D.T. Fiber-modified adenovirus for central nervous system Parkinson’s disease gene therapy. Viruses 2014, 6, 3293–3310. [Google Scholar] [CrossRef]
- Zhang, Y.; Bergelson, J.M. Adenovirus receptors. J. Virol. 2005, 79, 12125–12131. [Google Scholar] [CrossRef]
- Yang, M.; Yang, C.S.; Guo, W.; Tang, J.; Huang, Q.; Feng, S.; Jiang, A.; Xu, X.; Jiang, G.; Liu, Y.Q. A novel fiber chimeric conditionally replicative adenovirus-Ad5/F35 for tumor therapy. Cancer Biol. Ther. 2017, 18, 833–840. [Google Scholar] [CrossRef]
- Sirena, D.; Lilienfeld, B.; Eisenhut, M.; Kälin, S.; Boucke, K.; Beerli, R.R.; Vogt, L.; Ruedl, C.; Bachmann, M.F.; Greber, U.F.; et al. The human membrane cofactor CD46 is a receptor for species B adenovirus serotype 3. J. Virol. 2004, 78, 4454–4462. [Google Scholar] [CrossRef]
- Shayakhmetov, D.M.; Papayannopoulou, T.; Stamatoyannopoulos, G.; Lieber, A. Efficient gene transfer into human CD34(+) cells by a retargeted adenovirus vector. J. Virol. 2000, 74, 2567–2583. [Google Scholar] [CrossRef]
- Rea, D.; Havenga, M.J.; van Den Assem, M.; Sutmuller, R.P.; Lemckert, A.; Hoeben, R.C.; Bout, A.; Melief, C.J.; Offringa, R. Highly efficient transduction of human monocyte-derived dendritic cells with subgroup B fiber-modified adenovirus vectors enhances transgene-encoded antigen presentation to cytotoxic T cells. J. Immunol. 2001, 166, 5236–5244. [Google Scholar] [CrossRef]
- Adams, W.C.; Gujer, C.; McInerney, G.; Gall, J.G.D.; Petrovas, C.; Karlsson Hedestam, G.B.; Koup, R.A.; Loré, K. Adenovirus type-35 vectors block human CD4+ T-cell activation via CD46 ligation. Proc. Natl. Acad. Sci. USA 2011, 108, 7499–7504. [Google Scholar] [CrossRef] [PubMed]
- Rogozhin, V.N.; Logunov, D.Y.; Shchebliakov, D.V.; Shmarov, M.M.M.; Khodunova, E.E.E.; Galtseva, I.V.; Belousova, R.V.; Naroditsky, B.S.; Gintsburg, A.L. An efficient method for the delivery of the Interleukin-2 gene to human hematopoietic cells using the fiber-modified recombinant adenovirus. Acta Naturae 2011, 3, 100. [Google Scholar] [CrossRef] [PubMed]
- Islamov, R.R.; Bashirov, F.V.; Sokolov, M.E.; Izmailov, A.A.; Fadeev, F.O.; Markosyan, V.A.; Davleeva, M.A.; Zubkova, O.V.; Smarov, M.M.; Logunov, D.Y.; et al. Gene-modified leucoconcentrate for personalized ex vivo gene therapy in a mini pig model of moderate spinal cord injury. Neural Regen. Res. 2021, 16, 357–361. [Google Scholar] [CrossRef] [PubMed]
- Safiullov, Z.Z.; Izmailov, A.A.; Markosyan, V.A.; Khomyakov, A.E.; Boychuk, N.V.; Nigmetzyanova, M.V.; Siraeva, A.R.; Targachev, S.S.; Valiullin, V.V.; Islamov, R.R.; et al. Morphological characteristics of the cerebral cortex of a mini-pig under conditions of gene therapy after experimental stroke. Sechenov Med. J. 2024, 15, 13–27. [Google Scholar] [CrossRef]
- Safiullov, Z.; Izmailov, A.; Sokolov, M.; Markosyan, V.; Kundakchan, G.; Garifulin, R.; Shmarov, M.; Naroditsky, B.; Logunov, D.; Islamov, R. Autologous Genetically Enriched Leucoconcentrate in the Preventive and Acute Phases of Stroke Treatment in a Mini-Pig Model. Pharmaceutics 2022, 14, 2209. [Google Scholar] [CrossRef]
- Islamov, R.; Bashirov, F.; Izmailov, A.; Fadeev, F.; Markosyan, V.; Sokolov, M.; Shmarov, M.; Logunov, D.; Naroditsky, B.; Lavrov, I. New therapy for Spinal Cord Injury: Autologous Genetically-Enriched Leucoconcentrate Integrated with Epidural Electrical Stimulation. Cells 2022, 11, 144. [Google Scholar] [CrossRef]
- Tanaka, M.; Battaglia, S.; Giménez-Llort, L.; Chen, C.; Hepsomali, P.; Avenanti, A.; Vécsei, L. Innovation at the Intersection: Emerging Translational Research in Neurology and Psychiatry. Cells 2024, 13, 790. [Google Scholar] [CrossRef]
- Salafutdinov, I.I.; Gatina, D.Z.; Markelova, M.I.; Garanina, E.E.; Malanin, S.Y.; Gazizov, I.M.; Izmailov, A.A.; Rizvanov, A.A.; Islamov, R.R.; Palotás, A.; et al. A Biosafety Study of Human Umbilical Cord Blood Mononuclear Cells Transduced with Adenoviral Vector Carrying Human Vascular Endothelial Growth Factor cDNA In Vitro. Biomedicines 2023, 11, 2020. [Google Scholar] [CrossRef]
- Tanaka, M.; Szabó, Á.; Vécsei, L.; Giménez-Llort, L. Emerging Translational Research in Neurological and Psychiatric Diseases: From In Vitro to In Vivo Models. Int. J. Mol. Sci. 2023, 24, 15739. [Google Scholar] [CrossRef]
- Brown, A.M.; Blind, J.; Campbell, K.; Ghosh, S. Safeguards for Using Viral Vector Systems in Human Gene Therapy: A Resource for Biosafety Professionals Mitigating Risks in Health Care Settings. Appl. Biosaf. 2020, 25, 184–193. [Google Scholar] [CrossRef]
- Islamov, R.R.; Sokolov, M.E.; Safiullov, Z.Z.; Davleeva, M.A.; Garifulin, R.R.; Bashirov, F.V.; Salafutdinov, I.I.; Rizvanov, A.A.; Zubkova, O.V.; Shmarov, M.M.; et al. A Simple, Safe and E ective Approach for Personalized Precision Ex Vivo Gene Therapy Based on Autoinfusion of Gene-Modified Leucoconcentrate (GML) Prepared from Routine Unit of Patient’s Peripheral Blood. Blood 2020, 136, 31. [Google Scholar] [CrossRef]
- Ng, P.; Cummings, D.T.; Evelegh, C.M.; Graham, F.L. Yeast recombinase FLP functions effectively in human cells for constraction of adenovirus vectors. Biotechniques 2000, 29, 524–528. [Google Scholar] [CrossRef] [PubMed]
- Davleeva, M.A.; Garifulin, R.R.; Bashirov, F.V.; Izmailov, A.A.; Nurullin, L.F.; Salafutdinov, I.I.; Gatina, D.Z.; Shcherbinin, D.N.; Lysenko, A.A.; Tutykhina, I.L.; et al. Molecular and cellular changes in the post-traumatic spinal cord remodeling after autoinfusion of a genetically-enriched leucoconcentrate in a mini-pig model. Neural Regen. Res. 2023, 18, 1505–1511. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.W.; Wang, R.; Schmid, I.; Sakamoto, K.M. Analysis with flow cytometry of green fluorescent protein expression in leukemic cells. Cytometry 1999, 36, 333–339. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef]
- Kukurba, K.R.; Montgomery, S.B. RNA Sequencing and Analysis. Cold Spring Harb. Protoc. 2015, 2015, 951–969. [Google Scholar] [CrossRef]
- Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef]
- Liao, Y.; Wang, J.; Jaehnig, E.J.; Shi, Z.; Zhang, B. WebGestalt 2019: Gene set analysis toolkit with revamped UIs and APIs. Nucleic Acids Res. 2019, 47, W199–W205. [Google Scholar] [CrossRef]
- Kolberg, L.; Raudvere, U.; Kuzmin, I.; Adler, P.; Vilo, J.; Peterson, H. g:Profiler-interoperable web service for functional enrichment analysis and gene identifier mapping (2023 update). Nucleic Acids Res. 2023, 51, W207–W212. [Google Scholar] [CrossRef]
- Valekova, I.; Skalnikova, H.K.; Jarkovska, K.; Motlik, J.; Kovarova, H. Multiplex immunoassays for quantification of cytokines, growth factors, and other proteins in stem cell communication. Methods Mol. Biol. 2015, 1212, 39–63. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Yu, B.; Liu, Q.; Zhang, Y.; Zhu, M.; Shi, L.; Chen, H. Assessment of Hematologic and Biochemical Parameters for Healthy Commercial Pigs in China. Anim. Open Access J. 2022, 12, 2464. [Google Scholar] [CrossRef] [PubMed]
- Ginn, S.L.; Amaya, A.K.; Alexander, I.E.; Edelstein, M.; Abedi, M.R. Gene therapy clinical trials worldwide to 2017: An update. J. Gene Med. 2018, 20, e3015. [Google Scholar] [CrossRef] [PubMed]
- Crystal, R.G. Adenovirus: The first effective in vivo gene delivery vector. Hum. Gene Ther. 2014, 25, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Dahle, J.; Liess, B. A review on classical swine fever infections in pigs: Epizootiology, clinical disease and pathology. Comp. Immunol. Microbiol. Infect. Dis. 1992, 15, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Hammond, J.M.; Johnson, M.A. Porcine adenovirus as a delivery system for swine vaccines and immunotherapeutics. Vet. J. 2005, 169, 17–27. [Google Scholar] [CrossRef]
- Ivashkiv, L.B.; Donlin, L.T. Regulation of type I interferon responses. Nat. Rev. Immunol. 2014, 14, 36–49. [Google Scholar] [CrossRef]
- Atasheva, S.; Shayakhmetov, D.M. Cytokine Responses to Adenovirus and Adenovirus Vectors. Viruses 2022, 14, 888. [Google Scholar] [CrossRef]
- Fasbender, A.; Zabner, J.; Chillón, M.; Moninger, T.O.; Puga, A.P.; Davidson, B.L.; Welsh, M.J. Complexes of adenovirus with polycationic polymers and cationic lipids increase the efficiency of gene transfer in vitro and in vivo. J. Biol. Chem. 1997, 272, 6479–6489. [Google Scholar] [CrossRef]
- Dumitrescu, M.; Vacaru, A.M.; Trusca, V.G.; Fenyo, I.M.; Ionita, R.; Gafencu, A.V. K2 Transfection System Boosts the Adenoviral Transduction of Murine Mesenchymal Stromal Cells. Int. J. Mol. Sci. 2021, 22, 598. [Google Scholar] [CrossRef]
Primer | Nucleotide Sequence |
---|---|
GFP-TM-Forward | AGCAAAGACCCCAACGAGAA |
GFP-TM-Reverse | GGCGGCGGTCACGAA |
GFP-TM-Probe | [FAM]CGCGATCACATGGTCCTGCTGG[BH1] |
18S-TM-Forward | GGGAGGTAGTGACGAAAAATAACAAT |
18S-TM-Reverse | TTGCCCTCCAATGGATCCT |
18S-TM-Probe | [HEX]CGAGGCCCTGTAATTGGAATGAGTCCACT[BH2] |
Experimental Groups | In Vivo | Ex Vivo | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Day of Study | 0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 |
Mean number of lines crossed (n) 1 | **** | ** | ** | * | * | ** | * | ** | * | *** | ** | *** | *** | ** | ** | *** |
Mean time of interaction with the ball (s) 2 | + | +++ | + | +++ | ++ | + | ++ | + | + | + | +++ | + | ++++ | + | ++++ | ++++ |
Defecation | no | no | no | yes | yes | no | yes | yes | no | no | yes | no | yes | yes | no | yes |
Urination | yes | no | no | no | yes | yes | no | yes | no | yes | no | no | no | no | no | yes |
Experimental Groups | In Vivo | Ex Vivo | ||
---|---|---|---|---|
Day of Study | Day 0 | Day 7 | Day 0 | Day 7 |
Leucocytes (109/L) | 15.20 ± 2.41 | 13.14 ± 0.80 | 16.76 ± 3.62 | 11.93 ± 1.37 * |
Lymphocytes (109/L) | 7.20 ± 1.50 | 8.53 ± 1.56 | 6.95 ± 3.24 | 6.68 ± 1.48 |
Monocytes (109/L) | 0.49 ± 0.36 | 0.42 ± 0.50 | 0.25 ± 0.08 | 0.07 ± 0.02 |
Neutrophils (109/L) | 7.51 ± 0.95 | 4.20 ± 1.09 | 9.57 ± 4.86 | 5.18 ± 2.56 * |
Total protein (g/L) | 59.00 ± 6.08 | 59.00 ± 5.29 | 52.33 ± 4.04 | 52.33 ± 4.93 |
Albumin (g/L) | 43.33 ± 1.15 | 42.00 ± 3.61 | 38.33 ± 2.52 | 36.67 ± 4.62 |
Globulin (g/L) | 15.33 ± 4.73 | 17.00 ± 2.00 | 13.67 ± 1.53 | 15.33 ± 0.58 |
Calcium (mmol /L) | 2.74 ± 0.26 | 2.50 ± 0.08 | 2.80 ± 0.22 | 2.50 ± 0.12 |
Sodium (mmol /L) | 138.00 ± 1.73 | 140.00 ± 1.00 | 137.67 ± 0.58 | 138.00 ± 1.00 |
Potassium (mmol/L) | 5.40 ± 0.20 | 5.40 ± 0.20 | 5.50 ± 0.17 | 5.37 ± 0.29 |
Chlorine (mmol/L) | 94.67 ± 5.13 | 99.00 ± 1.00 * | 93.67 ± 4.04 | 100.00 ± 1.73 * |
Urea (mmol/L) | 4.00 ± 0.17 | 2.53 ± 0.38 * | 4.60 ± 0.75 | 2.90 ± 0.17 * |
Creatinine (µmol/L) | 53.33 ± 16.65 | 44.33 ± 25.01 | 61.00 ± 6.93 | 38.00 ± 9.17 |
Alanine Aminotransferase (U/L) | 27.67 ± 8.96 | 35.00 ± 4.00 | 29.67 ± 9.45 | 30.00 ± 7.55 |
Total bilirubin (mmol/L) | 4.00 ± 0.00 | 4.67 ± 1.15 | 4.00 ± 0.00 | 4.00 ± 0.00 |
Glucose (mmol/L) | 5.07 ± 2.35 | 4.67 ± 0.58 | 4.43 ± 0.72 | 5.07 ± 0.25 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Izmailov, A.; Minyazeva, I.; Markosyan, V.; Safiullov, Z.; Gazizov, I.; Salafutdinov, I.; Markelova, M.; Garifulin, R.; Shmarov, M.; Logunov, D.; et al. Biosafety Evaluation of a Chimeric Adenoviral Vector in Mini-Pigs: Insights into Immune Tolerance and Gene Therapy Potential. Biomedicines 2024, 12, 2568. https://doi.org/10.3390/biomedicines12112568
Izmailov A, Minyazeva I, Markosyan V, Safiullov Z, Gazizov I, Salafutdinov I, Markelova M, Garifulin R, Shmarov M, Logunov D, et al. Biosafety Evaluation of a Chimeric Adenoviral Vector in Mini-Pigs: Insights into Immune Tolerance and Gene Therapy Potential. Biomedicines. 2024; 12(11):2568. https://doi.org/10.3390/biomedicines12112568
Chicago/Turabian StyleIzmailov, Andrei, Irina Minyazeva, Vage Markosyan, Zufar Safiullov, Ilnaz Gazizov, Ilnur Salafutdinov, Maria Markelova, Ravil Garifulin, Maksim Shmarov, Denis Logunov, and et al. 2024. "Biosafety Evaluation of a Chimeric Adenoviral Vector in Mini-Pigs: Insights into Immune Tolerance and Gene Therapy Potential" Biomedicines 12, no. 11: 2568. https://doi.org/10.3390/biomedicines12112568
APA StyleIzmailov, A., Minyazeva, I., Markosyan, V., Safiullov, Z., Gazizov, I., Salafutdinov, I., Markelova, M., Garifulin, R., Shmarov, M., Logunov, D., Islamov, R., & Pospelov, V. (2024). Biosafety Evaluation of a Chimeric Adenoviral Vector in Mini-Pigs: Insights into Immune Tolerance and Gene Therapy Potential. Biomedicines, 12(11), 2568. https://doi.org/10.3390/biomedicines12112568