Impaired Development of Collagen Antibody-Induced Arthritis in Rab44-Deficient Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Antibodies and Reagents
2.2. Animals
2.3. Induction of Collagen Antibody-Induced Arthritis (CAIA)
2.4. Histopathology
2.5. Immunohistochemistry
2.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis
Gene | Forward Primer | Reverse Primer |
Gapdh | AAATGGTGAAGGTCGGTGTG | TGAAGGGGTCGTTGATGG |
Tnfa | ACGCTGATTTGGTGACCAGG | GACCCGTAGGGCGATCAG |
Il1b | ACCTAGCTGTCAACGTGTGG | TCAAAGCAATGTGCTGGTGC |
Cd80 | CAAGTTTCCATGTCCAAGGC | GGCAAGGCAGCAATACCTTA |
Mmp13 | GATGGCACTGCTGACATCAT | TTGGTCCAGGAGGAAAAGC |
Il6 | CCCCAATTTCCAATGCTCTCC | CGCACTAGGTTTGCCGAGTA |
Col1a1 | TGTTCAGCTTTGTGGACCTC | TCAAGCATACCTCGGGTTTC |
Col2a1 | GGTCCCCCTGGCCTTAGT | CCTTGCATGACTCCCATCTG |
Sox9 | AAGACTCTGGGCAAGCTCTG | GGGCTGGTACTTGTAATCGGG |
Acan | CAATTACCAGCTGCCCTTCA | CAGGGAGCTGATCTCGTAGC |
Sp7 | GCCCCCTGGTGTTCTTCATT | CCCATTGGACTTCCCCCTTC |
Runx2 | GTGGCCACTTACCACAGAGC | TGAGGCGATCAGAGAACAAA |
Acp5 | GGTATGTGCTGGCTGGAAAC | ATTTTGAAGCGCAAACGGTA |
Ctsk | GTCGTGGAGGCGGCTATATG | AGAGTCAATGCCTCCGTTCTG |
2.7. Micro-Computed Tomography (μ-CT)
2.8. Statistical Analysis
3. Results
3.1. Rab44 Deficiency Attenuates Macroscopic Inflammation Induced by Collagen Antibody-Induced Arthritis (CAIA)
3.2. Rab44-KO CAIA Mice Exhibit Reduced Cell Filtration in the Radiocarpal Joints
3.3. Rab44-KO CAIA Mice Show Decreased Expression Levels of Arthritis-Related Marker Genes
3.4. Rab44-KO CAIA Mice Exhibit Predominant Filtration of M2-Type Macrophages at the Inflammatory Sites
3.5. Rab44-KO CAIA Mice Display Impaired Bone Loss Compared with WT CAIA Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Scherer, H.U.; Häupl, T.; Burmester, G.R. The etiology of rheumatoid arthritis. J. Autoimmun. 2020, 110, 102400. [Google Scholar] [CrossRef] [PubMed]
- Andreev, D.; Kachler, K.; Schett, G.; Bozec, A. Rheumatoid arthritis and osteoimmunology: The adverse impact of a deregulated immune system on bone metabolism. Bone 2022, 162, 116468. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, N.; Takayanagi, H. Mechanisms of joint destruction in rheumatoid arthritis—Immune cell-fibroblast-bone interactions. Nat. Rev. Rheumatol. 2022, 18, 415–429. [Google Scholar] [CrossRef]
- Yap, H.Y.; Tee, S.Z.; Wong, M.M.; Chow, S.K.; Peh, S.C.; Teow, S.Y. Pathogenic Role of Immune Cells in Rheumatoid Arthritis: Implications in Clinical Treatment and Biomarker Development. Cells 2018, 7, 161. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Zhu, L. Osteoimmunology: The Crosstalk between T Cells, B Cells, and Osteoclasts in Rheumatoid Arthritis. Int. J. Mol. Sci. 2024, 25, 2688. [Google Scholar] [CrossRef] [PubMed]
- Hashida, R.; Shimozuru, Y.; Chang, J.; Agosto-Marlin, I.; Waritani, T.; Terato, K. New Studies of Pathogenesis of Rheumatoid Arthritis with Collagen-Induced and Collagen Antibody-Induced Arthritis Models: New Insight Involving Bacteria Flora. Autoimmune Dis. 2021, 2021, 7385106. [Google Scholar] [CrossRef]
- Maleitzke, T.; Weber, J.; Hildebrandt, A.; Dietrich, T.; Zhou, S.; Tsitsilonis, S.; Keller, J. Standardized protocol and outcome measurements for the collagen antibody-induced arthritis mouse model. STAR Protoc. 2022, 3, 101718. [Google Scholar] [CrossRef]
- Kong, J.S.; Jeong, G.H.; Yoo, S.A. The use of animal models in rheumatoid arthritis research. J. Yeungnam Med. Sci. 2023, 40, 23–29. [Google Scholar] [CrossRef]
- Hutagalung, A.H.; Novick, P.J. Role of Rab GTPases in membrane traffic and cell physiology. Physiol. Rev. 2011, 91, 119–149. [Google Scholar] [CrossRef]
- Zhen, Y.; Stenmark, H. Cellular functions of Rab GTPases at a glance. J. Cell Sci. 2015, 128, 3171–3176. [Google Scholar] [CrossRef]
- Homma, Y.; Hiragi, S.; Fukuda, M. Rab family of small GTPases: An updated view on their regulation and functions. FEBS J. 2021, 288, 36–55. [Google Scholar] [CrossRef] [PubMed]
- Tsukuba, T.; Yamaguchi, Y.; Kadowaki, T. Large Rab GTPases: Novel Membrane Trafficking Regulators with a Calcium Sensor and Functional Domains. Int. J. Mol. Sci. 2021, 22, 7691. [Google Scholar] [CrossRef] [PubMed]
- Maruta, Y.; Fukuda, M. Large Rab GTPase Rab44 regulates microtubule-dependent retrograde melanosome transport in melanocytes. J. Biol. Chem. 2022, 298, 102508. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, Y.; Sakai, E.; Okamoto, K.; Kajiya, H.; Okabe, K.; Naito, M.; Kadowaki, T.; Tsukuba, T. Rab44, a novel large Rab GTPase, negatively regulates osteoclast differentiation by modulating intracellular calcium levels followed by NFATc1 activation. Cell Mol. Life Sci. 2018, 75, 33–48. [Google Scholar] [CrossRef] [PubMed]
- Tokuhisa, M.; Kadowaki, T.; Ogawa, K.; Yamaguchi, Y.; Kido, M.A.; Gao, W.; Umeda, M.; Tsukuba, T. Expression and localisation of Rab44 in immune-related cells change during cell differentiation and stimulation. Sci. Rep. 2020, 10, 10728. [Google Scholar] [CrossRef]
- Kadowaki, T.; Yamaguchi, Y.; Kido, M.A.; Abe, T.; Ogawa, K.; Tokuhisa, M.; Gao, W.; Okamoto, K.; Kiyonari, H.; Tsukuba, T. The large GTPase Rab44 regulates granule exocytosis in mast cells and IgE-mediated anaphylaxis. Cell Mol. Immunol. 2020, 17, 1287–1289. [Google Scholar] [CrossRef]
- Noguromi, M.; Yamaguchi, Y.; Sato, K.; Oyakawa, S.; Okamoto, K.; Murata, H.; Tsukuba, T.; Kadowaki, T. Rab44 Deficiency Induces Impaired Immune Responses to Nickel Allergy. Int. J. Mol. Sci. 2023, 24, 994. [Google Scholar] [CrossRef]
- Longé, C.; Bratti, M.; Kurowska, M.; Vibhushan, S.; David, P.; Desmeure, V.; Huang, J.D.; Fischer, A.; de Saint Basile, G.; Sepulveda, F.E.; et al. Rab44 regulates murine mast cell-driven anaphylaxis through kinesin-1-dependent secretory granule translocation. J. Allergy Clin. Immunol. 2022, 150, 676–689. [Google Scholar] [CrossRef]
- Maleitzke, T.; Hildebrandt, A.; Dietrich, T.; Appelt, J.; Jahn, D.; Otto, E.; Zocholl, D.; Baranowsky, A.; Duda, G.N.; Tsitsilonis, S.; et al. The calcitonin receptor protects against bone loss and excessive inflammation in collagen antibody-induced arthritis. iScience 2022, 25, 103689. [Google Scholar] [CrossRef]
- Svendsen, P.; Etzerodt, A.; Deleuran, B.W.; Moestrup, S.K. Mouse CD163 deficiency strongly enhances experimental collagen-induced arthritis. Sci. Rep. 2020, 10, 12447. [Google Scholar] [CrossRef]
- Maleitzke, T.; Hildebrandt, A.; Weber, J.; Dietrich, T.; Appelt, J.; Jahn, D.; Zocholl, D.; Baranowsky, A.; Duda, G.N.; Tsitsilonis, S.; et al. Proinflammatory and bone protective role of calcitonin gene-related peptide alpha in collagen antibody-induced arthritis. Rheumatology 2021, 60, 1996–2009. [Google Scholar] [CrossRef] [PubMed]
- Martinez, F.O.; Gordon, S. The M1 and M2 paradigm of macrophage activation: Time for reassessment. F1000prime Rep. 2014, 6, 13. [Google Scholar] [CrossRef] [PubMed]
- Yunna, C.; Mengru, H.; Lei, W.; Weidong, C. Macrophage M1/M2 polarization. Eur. J. Pharmacol. 2020, 877, 173090. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.J.; Dai, L.; Zheng, D.H.; Mo, Y.Q.; Ou-Yang, X.; Wei, X.N.; Shen, J.; Zhang, B.Y. Upregulation of tumor necrosis factor receptor-associated factor 6 correlated with synovitis severity in rheumatoid arthritis. Arthritis Res. Ther. 2012, 14, R133. [Google Scholar] [CrossRef] [PubMed]
- Aota, K.; Yamanoi, T.; Kani, K.; Nakashiro, K.I.; Ishimaru, N.; Azuma, M. Inverse correlation between the number of CXCR3+ macrophages and the severity of inflammatory lesions in Sjögren’s syndrome salivary glands: A pilot study. J. Oral. Pathol. Med. 2018, 47, 710–718. [Google Scholar] [CrossRef]
- Bailey, K.N.; Furman, B.D.; Zeitlin, J.; Kimmerling, K.A.; Wu, C.L.; Guilak, F.; Olson, S.A. Intra-articular depletion of macrophages increases acute synovitis and alters macrophage polarity in the injured mouse knee. Osteoarthr. Cartil. 2020, 28, 626–638. [Google Scholar] [CrossRef]
- Jiang, Y.; Gruzieva, O.; Wang, T.; Forno, E.; Boutaoui, N.; Sun, T.; Merid, S.K.; Acosta-Pérez, E.; Kull, I.; Canino, G.; et al. Transcriptomics of atopy and atopic asthma in white blood cells from children and adolescents. Eur. Respir. J. 2019, 53, 1900102. [Google Scholar] [CrossRef]
- Comrie, W.A.; Faruqi, A.J.; Price, S.; Zhang, Y.; Rao, V.K.; Su, H.C.; Lenardo, M.J. RELA haploinsufficiency in CD4 lymphoproliferative disease with autoimmune cytopenias. J. Allergy Clin. Immunol. 2018, 141, 1507–1510. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yamaguchi, Y.; Kadowaki, T.; Sakai, E.; Noguromi, M.; Oyakawa, S.; Tsukuba, T. Impaired Development of Collagen Antibody-Induced Arthritis in Rab44-Deficient Mice. Biomedicines 2024, 12, 2504. https://doi.org/10.3390/biomedicines12112504
Yamaguchi Y, Kadowaki T, Sakai E, Noguromi M, Oyakawa S, Tsukuba T. Impaired Development of Collagen Antibody-Induced Arthritis in Rab44-Deficient Mice. Biomedicines. 2024; 12(11):2504. https://doi.org/10.3390/biomedicines12112504
Chicago/Turabian StyleYamaguchi, Yu, Tomoko Kadowaki, Eiko Sakai, Mayuko Noguromi, Shun Oyakawa, and Takayuki Tsukuba. 2024. "Impaired Development of Collagen Antibody-Induced Arthritis in Rab44-Deficient Mice" Biomedicines 12, no. 11: 2504. https://doi.org/10.3390/biomedicines12112504
APA StyleYamaguchi, Y., Kadowaki, T., Sakai, E., Noguromi, M., Oyakawa, S., & Tsukuba, T. (2024). Impaired Development of Collagen Antibody-Induced Arthritis in Rab44-Deficient Mice. Biomedicines, 12(11), 2504. https://doi.org/10.3390/biomedicines12112504