Stable Gastric Pentadecapeptide BPC 157 May Counteract Myocardial Infarction Induced by Isoprenaline in Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Drugs and Materials
2.3. Noxious Procedure, Medication and Assessment
2.4. Gross Lesion Presentation
2.5. Assessment of the Change in the Brain and Veins’ Volume Proportional to the Change in the Brain and Veins’ Surface Area
2.6. Thrombus Assessment
2.7. Superior Sagittal Sinus, Portal Vein, Vena Caval and Abdominal Aortal Pressure Recording
2.8. Microscopy
2.8.1. Tissue Preparation
2.8.2. Brain Histology
2.8.3. Lung Histology
2.8.4. Renal, Liver and Heart Histology
2.8.5. Gastrointestinal Histology
2.9. ECG Recording
2.10. Biochemical Analysis
2.11. RNA Extraction and RT-PCR
2.12. Gross Clinical Assessment
2.13. Echocardiography
2.14. Oxidative Stress
2.15. Statistical Analysis
3. Results
3.1. Early Occlusion-Like Syndrome and BPC 157 Therapy
3.2. BPC 157 Therapy, Myocardial Infarction, and Reinfarction
3.3. NO-Agents and BPC 157 Therapy
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wong, Z.W.; Thanikachalam, P.V.; Ramamurthy, S. Molecular understanding of the protective role of natural products on isoproterenol-induced myocardial infarction: A review. Biomed. Pharmacother. 2017, 94, 1145–1166. [Google Scholar] [CrossRef] [PubMed]
- Sikiric, P.; Hahm, K.-B.; Blagaic, A.B.; Tvrdeic, A.; Pavlov, K.H.; Petrovic, A.; Kokot, A.; Gojkovic, S.; Krezic, I.; Drmic, D.; et al. Stable Gastric Pentadecapeptide BPC 157, Robert’s Stomach Cytoprotection/Adaptive Cytoprotection/Organoprotection, and Selye’s Stress Coping Response: Progress, Achievements, and the Future. Gut Liver 2020, 14, 153–167. [Google Scholar] [CrossRef] [PubMed]
- Sikiric, P.; Rucman, R.; Turkovic, B.; Sever, M.; Klicek, R.; Radic, B.; Drmic, D.; Stupnisek, M.; Misic, M.; Vuletic, L.B.; et al. Novel Cytoprotective Mediator, Stable Gastric Pentadecapeptide BPC Vascular Recruitment and Gastrointestinal Tract Healing. Curr. Pharm. Des. 2018, 24, 1990–2001. [Google Scholar] [CrossRef]
- Seiwerth, S.; Milavic, M.; Vukojevic, J.; Gojkovic, S.; Krezic, I.; Vuletic, L.B.; Pavlov, K.H.; Petrovic, A.; Sikiric, S.; Vranes, H.; et al. Stable Gastric Pentadecapeptide BPC 157 and Wound Healing. Front. Pharmacol. 2021, 12, 627533. [Google Scholar] [CrossRef]
- Lovric-Bencic, M.; Sikiric, P.; Hanzevacki, J.S.; Seiwerth, S.; Rogic, D.; Kusec, V.; Aralica, G.; Konjevoda, P.; Batelja, L.; Blagaic, A.B. Doxorubicine-congestive heart failure-increased big endothelin-1 plasma concentration: Reversal by amlodipine, losartan, and gastric pentadecapeptide BPC157 in rat and mouse. J. Pharmacol. Sci. 2004, 95, 19–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barisic, I.; Balenovic, D.; Klicek, R.; Radic, B.; Nikitovic, B.; Drmic, D.; Udovicic, M.; Strinic, D.; Bardak, D.; Berkopic, L.; et al. Mortal hyperkalemia disturbances in rats are NO-system related. The life saving effect of pentadecapeptide BPC. Regul. Pept. 2013, 181, 50–66. [Google Scholar] [CrossRef]
- Stambolija, V.; Stambolija, T.P.; Holjevac, J.K.; Murselovic, T.; Radonic, J.; Duzel, V.; Duplancic, B.; Uzun, S.; Zivanovic-Posilovic, G.; Kolenc, D.; et al. BPC 157: The counteraction of succinylcholine, hyperkalemia, and arrhythmias. Eur. J. Pharmacol. 2016, 781, 83–91. [Google Scholar] [CrossRef]
- Balenovic, D.; Bencic, M.L.; Udovicic, M.; Simonji, K.; Hanzevacki, J.S.; Barisic, I.; Kranjcevic, S.; Prkacin, I.; Coric, V.; Brcic, L.; et al. Inhibition of methyldigoxin-induced arrhythmias by pentadecapeptide BPC 157: A relation with NO-system. Regul. Pept. 2009, 156, 83–89. [Google Scholar] [CrossRef]
- Strinic, D.; Halle, Z.B.; Luetic, K.; Nedic, A.; Petrovic, I.; Sucic, M.; Posilovic, G.Z.; Balenovic, D.; Strbe, S.; Udovicic, M.; et al. BPC 157 counteracts QTc prolongation induced by haloperidol, fluphenazine, clozapine, olanzapine, quetiapine, sulpiride, and metoclopramide in rats. Life Sci. 2017, 186, 66–79. [Google Scholar] [CrossRef]
- Zivanovic-Posilovic, G.; Balenovic, D.; Barisic, I.; Strinic, D.; Stambolija, V.; Udovicic, M.; Uzun, S.; Drmic, D.; Vlainic, J.; Bencic, M.L.; et al. Stable gastric pentadecapeptide BPC 157 and bupivacaine. Eur. J. Pharmacol. 2016, 793, 56–65. [Google Scholar] [CrossRef]
- Lozic, M.; Stambolija, V.; Krezic, I.; Dugandzic, A.; Zivanovic-Posilovic, G.; Gojkovic, S.; Kovacevic, J.; Vrdoljak, L.; Mirkovic, I.; Kokot, A.; et al. In relation to NO-System, Stable Pentadecapeptide BPC 157 Counteracts Lidocaine-Induced Adverse Effects in Rats and Depolarisation In Vitro. Emerg. Med. Int. 2020, 2020, 6805354. [Google Scholar] [CrossRef]
- Udovicic, M.; Sever, M.; Kavur, L.; Loncaric, K.; Barisic, I.; Balenovic, D.; Posilovic, G.Z.; Strinic, D.; Uzun, S.; Vuletic, L.B.; et al. Stable Gastric Pentadecapeptide BPC 157 Therapy for Monocrotaline-Induced Pulmonary Hypertension in Rats Leads to Prevention and Reversal. Biomedicines 2021, 9, 822. [Google Scholar] [CrossRef] [PubMed]
- Grabarevic, Z.; Tisljar, M.; Artukovic, B.; Bratulic, M.; Dzaja, P.; Seiwerth, S.; Sikiric, P.; Peric, J.; Geres, D.; Kos, J. The influence of BPC 157 on nitric oxide agonist and antagonist induced lesions in broiler chicken. J. Physiol. Paris 1997, 91, 139–149. [Google Scholar] [CrossRef]
- Vukojević, J.; Siroglavić, M.; Kašnik, K.; Kralj, T.; Stanćić, D.; Kokot, A.; Kolarić, D.; Drmić, D.; Sever, A.Z.; Barišić, I.; et al. Rat inferior caval vein (ICV) ligature and particular new insights with the stable gastric pentadecapeptide BPC. Vasc. Pharmacol. 2018, 106, 54–66. [Google Scholar] [CrossRef] [PubMed]
- Kolovrat, M.; Gojkovic, S.; Krezic, I.; Malekinusic, D.; Vrdoljak, B.; Kovac, K.K.; Kralj, T.; Drmic, D.; Barisic, I.; Pavlov, K.H.; et al. Pentadecapeptide BPC 157 resolves Pringle maneuver in rats, both ischemia and reperfusion. World J. Hepatol. 2020, 12, 12–196. [Google Scholar] [CrossRef] [PubMed]
- Gojkovic, S.; Krezic, I.; Vrdoljak, B.; Malekinusic, D.; Barisic, I.; Petrovic, A.; Pavlov, K.H.; Kolovrat, M.; Duzel, A.; Knezevic, M.; et al. Pentadecapeptide BPC 157 resolves suprahepatic occlusion of the inferior caval vein, Budd-Chiari syndrome model in rats. World J. Gastrointest. Pathophysiol. 2020, 11, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Knezevic, M.; Gojkovic, S.; Krezic, I.; Zizek, H.; Malekinusic, D.; Vrdoljak, B.; Vranes, H.; Knezevic, T.; Barisic, I.; Horvat Pavlov, K.; et al. Occlusion of the superior mesenteric artery in rats reversed by collateral pathways activation: Gastric pen-tadecapeptide BPC 157 therapy counteracts multiple organ dysfunction syndrome; intracranial, portal and caval hypertension; and aortal hypotension. Biomedicines 2021, 9, 609. [Google Scholar] [CrossRef] [PubMed]
- Knezevic, M.; Gojkovic, S.; Krezic, I.; Zizek, H.; Vranes, H.; Malekinusic, D.; Vrdoljak, B.; Knezevic, T.; Pavlov, K.H.; Drmic, D.; et al. Complex Syndrome of the Complete Occlusion of the End of the Superior Mesenteric Vein, Opposed with the Stable Gastric Pentadecapeptide BPC 157 in Rats. Biomedicines 2021, 9, 1029. [Google Scholar] [CrossRef]
- Knezevic, M.; Gojkovic, S.; Krezic, I.; Zizek, H.; Malekinusic, D.; Vrdoljak, B.; Knezevic, T.; Vranes, H.; Drmic, D.; Staroveski, M.; et al. Occluded Superior Mesenteric Artery and Vein. Therapy with the Stable Gastric Pentadecapeptide BPC 157. Biomedicines 2021, 9, 792. [Google Scholar] [CrossRef]
- Gojkovic, S.; Krezic, I.; Vranes, H.; Zizek, H.; Drmic, D.; Pavlov, K.H.; Petrovic, A.; Vuletic, L.B.; Milavic, M.; Sikiric, S.; et al. BPC 157 Therapy and the Permanent Occlusion of the Superior Sagittal Sinus in Rat: Vascular Recruitment. Biomedicines 2021, 9, 744. [Google Scholar] [CrossRef]
- Gojkovic, S.; Krezic, I.; Vranes, H.; Zizek, H.; Drmic, D.; Vuletic, L.B.; Milavic, M.; Sikiric, S.; Stilinovic, I.; Simeon, P.; et al. Robert’s Intragastric Alcohol-Induced Gastric Lesion Model as an Escalated General Peripheral and Central Syndrome, Counteracted by the Stable Gastric Pentadecapeptide BPC 157. Biomedicines 2021, 9, 1300. [Google Scholar] [CrossRef]
- Strbe, S.; Gojkovic, S.; Krezic, I.; Zizek, H.; Vranes, H.; Barisic, I.; Strinic, D.; Orct, T.; Vukojevic, J.; Ilic, S.; et al. Over-Dose Lithium Toxicity as an Occlusive-like Syndrome in Rats and Gastric Pentadecapeptide BPC 157. Biomedicines 2021, 9, 1506. [Google Scholar] [CrossRef]
- Tepes, M.; Gojkovic, S.; Krezic, I.; Zizek, H.; Vranes, H.; Madzar, Z.; Santak, G.; Batelja, L.; Milavic, M.; Sikiric, S.; et al. Stable Gastric Pentadecapeptide BPC 157 Therapy for Primary Abdominal Compartment Syndrome in Rats. Front. Pharmacol. 2021, 12, 718147. [Google Scholar] [CrossRef]
- Rona, G. Catecholamine cardiotoxicity. J. Mol. Cell. Cardiol. 1985, 17, 291–306. [Google Scholar] [CrossRef]
- Konosic, S.; Petricevic, M.; Ivancan, V.; Konosic, L.; Goluza, E.; Krtalic, B.; Drmic, D.; Stupnisek, M.; Seiwerth, S.; Sikiric, P. Intragastric Application of Aspirin, Clopidogrel, Cilostazol, and BPC 157 in Rats: Platelet Aggregation and Blood Clot. Oxidative Med. Cell. Longev. 2019, 2019, 9084643. [Google Scholar] [CrossRef]
- Stupnisek, M.; Kokot, A.; Drmic, D.; Patrlj, M.H.; Sever, A.Z.; Kolenc, D.; Radic, B.; Suran, J.; Bojic, D.; Vcev, A.; et al. Pentadecapeptide BPC 157 Reduces Bleeding and Thrombocytopenia after Amputation in Rats Treated with Heparin, Warfarin, L-NAME and L-Arginine. PLoS ONE 2015, 10, e0123454. [Google Scholar] [CrossRef]
- Stupnisek, M.; Franjic, S.; Drmic, D.; Hrelec, M.; Kolenc, D.; Radic, B.; Bojic, D.; Vcev, A.; Seiwerth, S.; Sikiric, P. Pentade-capeptide BPC 157 reduces bleeding time and thrombocytopenia after amputation in rats treated with heparin, warfarin or aspirin. Thromb. Res. 2012, 129, 652–659. [Google Scholar] [CrossRef] [PubMed]
- Hrelec, M.; Klicek, R.; Brcic, L.; Brcic, I.; Cvjetko, I.; Seiwerth, S.; Sikiric, P. Abdominal aorta anastomosis in rats and stable gastric pentadecapeptide BPC 157, prophylaxis and therapy. J. Physiol. Pharmacol. 2009, 60, 161–165. [Google Scholar] [PubMed]
- Garg, M.; Khanna, D. Exploration of pharmacological interventions to prevent isoproterenol-induced myocardial infarction in experimental models. Ther. Adv. Cardiovasc. Dis. 2014, 8, 155–169. [Google Scholar] [CrossRef] [PubMed]
- Park, J.M.; Lee, H.J.; Sikiric, P.; Hahm, K.B. BPC 157 Rescued NSAID-cytotoxicity Via Stabilizing Intestinal Permeability and Enhancing Cytoprotection. Curr. Pharm. Des. 2020, 26, 2971–2981. [Google Scholar] [CrossRef] [PubMed]
- Luetic, K.; Sucic, M.; Vlainic, J.; Halle, Z.B.; Strinic, D.; Vidovic, T.; Luetic, F.; Marusic, M.; Gulic, S.; Pavelic, T.T.; et al. Cy-clophosphamide induced stomach and duodenal lesions as a NO-system disturbance in rats: L-NAME, L-arginine, stable gastric pentadecapeptide BPC 157. Inflammopharmacology 2017, 25, 255–264. [Google Scholar] [CrossRef]
- Sucic, M.; Luetic, K.; Jandric, I.; Drmic, D.; Sever, A.Z.; Vuletic, L.B.; Halle, Z.B.; Strinic, D.; Kokot, A.; Seiwerth, R.S.; et al. Therapy of the rat hemorrhagic cystitis induced by cyclophosphamide. Stable gastric pentadecapeptide BPC 157, L.-arginine, L-NAME. Eur. J. Pharmacol. 2019, 861, 172593. [Google Scholar] [CrossRef]
- Belosic Halle, Z.; Vlainic, J.; Drmic, D.; Strinic, D.; Luetic, K.; Sucic, M.; Medvidovic-Grubisic, M.; Pavelic Turudic, T.; Petrovic, I.; Seiwerth, S.; et al. Class side effects: Decreased pressure in the lower oesophageal and the pyloric sphincters after the ad-ministration of dopamine antagonists, neuroleptics, anti-emetics, L-NAME, pentadecapeptide BPC 157 and L-arginine. Inflammopharmacology 2017, 25, 511–522. [Google Scholar] [CrossRef] [PubMed]
- Duzel, A.; Vlainic, J.; Antunovic, M.; Malekinusic, D.; Vrdoljak, B.; Samara, M.; Gojkovic, S.; Krezic, I.; Vidovic, T.; Bilic, Z.; et al. Stable gastric pentadecapeptide BPC 157 in the treatment of colitis and ischemia and reperfusion in rats: New insights. World J. Gastroenterol. 2017, 23, 8465–8488. [Google Scholar] [CrossRef]
- Amic, F.; Drmic, D.; Bilic, Z.; Krezic, I.; Zizek, H.; Peklic, M.; Klicek, R.; Pajtak, A.; Amic, E.; Vidovic, T.; et al. Bypassing major venous occlusion and duodenal lesions in rats, and therapy with the stable gastric pentadecapeptide BPC 157, L-NAME and L-arginine. World J. Gastroenterol. 2018, 24, 5366–5378. [Google Scholar] [CrossRef] [PubMed]
- Drmic, D.; Samara, M.; Vidovic, T.; Malekinusic, D.; Antunovic, M.; Vrdoljak, B.; Ruzman, J.; Perisa, M.M.; Pavlov, K.H.; Jeyakumar, J.; et al. Counteraction of perforated cecum lesions in rats: Effects of pentadecapeptide BPC 157, L-NAME and L-arginine. World J. Gastroenterol. 2018, 24, 5462–5476. [Google Scholar] [CrossRef] [PubMed]
- Sever, A.Z.; Sever, M.; Vidovic, T.; Lojo, N.; Kolenc, D.; Vuletic, L.B.; Drmic, D.; Kokot, A.; Zoricic, I.; Coric, M.; et al. Stable gastric pentadecapeptide BPC 157 in the therapy of the rats with bile duct ligation. Eur. J. Pharmacol. 2019, 847, 130–142. [Google Scholar] [CrossRef] [PubMed]
- Gaballa, M.A.; Raya, T.E.; Hoover, C.A.; Goldman, S. Effects of endothelial and inducible nitric oxide synthases inhibition on circulatory function in rats after myocardial infarction. Cardiovasc. Res. 1999, 42, 627–635. [Google Scholar] [CrossRef] [Green Version]
- Ribeiro, D.A.; Buttros, J.B.; Oshima, C.T.F.; Bergamaschi, C.; Campos, R.R. Ascorbic acid prevents acute myocardial infarction induced by isoproterenol in rats: Role of inducible nitric oxide synthase production. Histochem. J. 2009, 40, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, M.A.; Geddawy, A.; Abdel-Wahab, S. Sitagliptin prevents isoproterenol-induced myocardial infarction in rats by modulating nitric oxide synthase enzymes. Eur. J. Pharmacol. 2018, 829, 63–69. [Google Scholar] [CrossRef]
- Ilic, A.; Todorovic, D.; Mutavdzin, S.; Boricic, N.; Bozic Nedeljkovic, B.; Stankovic, S.; Simic, T.; Stevanovic, P.; Celic, V.; Djuric, D. Translocator protein modulation by 4’-chlorodiazepam and NO synthase Inhibition affect cardiac oxidative stress, cardi-ometabolic and inflammatory markers in isoprenaline-Induced rat myocardial infarction. Int. J. Mol. Sci. 2021, 22, 2867. [Google Scholar] [CrossRef]
- Feng, L.; Ren, J.; Li, Y.; Yang, G.; Kang, L.; Zhang, S.; Ma, C.; Li, J.; Liu, J.; Yang, L.; et al. Resveratrol protects against iso-proterenol induced myocardial infarction in rats through VEGF-B/AMPK/eNOS/NO signalling pathway. Free Radic. Res. 2019, 53, 82–93. [Google Scholar] [CrossRef]
- Khatua, T.N.; Padiya, R.; Karnewar, S.; Kuncha, M.; Agawane, S.B.; Kotamraju, S.; Banerjee, S.K. Garlic provides protection to mice heart against isoproterenol-induced oxidative damage: Role of nitric oxide. Nitric Oxide 2012, 27, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Kang, E.A.; Han, Y.-M.; An, J.M.; Park, Y.J.; Sikiric, P.; Kim, D.H.; Kwon, K.A.; Kim, Y.J.; Yang, D.; Tchah, H.; et al. BPC157 as Potential Agent Rescuing from Cancer Cachexia. Curr. Pharm. Des. 2018, 24, 1947–1956. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, M.-J.; Lee, C.-H.; Chueh, H.-Y.; Chang, G.-J.; Huang, H.-Y.; Lin, Y.; Pang, J.-H.S. Modulatory effects of BPC 157 on vasomotor tone and the activation of Src-Caveolin-1-endothelial nitric oxide synthase pathway. Sci. Rep. 2020, 10, 17078. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.-H.; Tsai, W.-C.; Lin, M.-S.; Hsu, Y.-H.; Pang, J.-H.S. The promoting effect of pentadecapeptide BPC 157 on tendon healing involves tendon outgrowth, cell survival, and cell migration. J. Appl. Physiol. 2011, 110, 774–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, C.-H.; Tsai, W.-C.; Hsu, Y.-H.; Pang, J.-H.S. Pentadecapeptide BPC 157 Enhances the Growth Hormone Receptor Expression in Tendon Fibroblasts. Molecules 2014, 19, 19066–19077. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, T.; Zhang, K.; Sun, L.; Xue, X.; Zhang, C.; Shu, Z.; Mu, N.; Gu, J.; Zhang, W.; Wang, Y.; et al. Body protective com-pound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro. Drug Des. Devel. Ther. 2015, 9, 2485–2499. [Google Scholar] [CrossRef] [Green Version]
- Hsieh, M.-J.; Liu, H.-T.; Wang, C.-N.; Huang, H.-Y.; Lin, Y.; Ko, Y.-S.; Wang, J.-S.; Chang, V.H.-S.; Pang, J.-H.S. Therapeutic potential of pro-angiogenic BPC157 is associated with VEGFR2 activation and up-regulation. Klin. Wochenschr. 2017, 95, 323–333. [Google Scholar] [CrossRef]
- Tkalčević, V.I.; Čužić, S.; Brajša, K.; Mildner, B.; Bokulić, A.; Šitum, K.; Perović, D.; Glojnarić, I.; Parnham, M.J. Enhancement by PL 14736 of granulation and collagen organization in healing wounds and the potential role of egr-1 expression. Eur. J. Pharmacol. 2007, 570, 212–221. [Google Scholar] [CrossRef]
- Wang, X.-Y.; Qu, M.; Duan, R.; Shi, D.; Jin, L.; Gao, J.; Wood, J.D.; Li, J.; Wang, G.-D. Cytoprotective Mechanism of the Novel Gastric Peptide BPC157 in Gastrointestinal Tract and Cultured Enteric Neurons and Glial Cells. Neurosci. Bull. 2018, 35, 167–170. [Google Scholar] [CrossRef]
- Vukojević, J.; Vrdoljak, B.; Malekinušić, D.; Siroglavić, M.; Milavić, M.; Kolenc, D.; Blagaić, A.B.; Batelja, L.; Drmić, D.; Seiverth, S.; et al. The effect of pentadecapeptide BPC 157 on hippocampal ischemia/reperfusion injuries in rats. Brain Behav. 2020, 10, e01726. [Google Scholar] [CrossRef]
- Sikiric, P.; Seiwerth, S.; Rucman, R.; Turkovic, B.; Rokotov, D.; Brcic, L.; Sever, M.; Klicek, R.; Radic, B.; Drmic, D.; et al. Stable Gastric Pentadecapeptide BPC 157-NO-system Relation. Curr. Pharm. Des. 2014, 20, 1126–1135. [Google Scholar] [CrossRef] [PubMed]
- Sikiric, P.; Seiwerth, S.; Rucman, R.; Turkovic, B.; Rokotov, D.S.; Brcic, L.; Sever, M.; Klicek, R.; Radic, B.; Drmic, D.; et al. Toxicity by NSAIDs. Counteraction by stable gastric pentadecapeptide BPC 157. Curr. Pharm. Des. 2013, 19, 76–83. [Google Scholar] [PubMed]
- Sikiric, P.; Seiwerth, S.; Grabarevic, Z.; Rucman, R.; Petek, M.; Jagic, V.; Turkovic, B.; Rotkvic, I.; Mise, S.; Zoricic, I.; et al. The influence of a novel pentadecapeptide, BPC 157, on N(G)-nitro-L-arginine methylester and L-arginine effects on stomach mucosa integrity and blood pressure. Eur. J. Pharmacol. 1997, 332, 23–33. [Google Scholar] [CrossRef]
- Turkovic, B.; Sikiric, P.; Seiwerth, S.; Mise, S.; Anic, T.; Petek, M. Stable gastric pentadecapeptide BPC 157 studied for in-flammatory bowel disease (PLD-116, PL14736, Pliva) induces nitric oxide synthesis. Gastroenterology 2004, 126, 287. [Google Scholar]
- Lewandrowski, K.B. Cardiac markers. Preface. Clin. Lab. Med. 2014, 34, 31–41. [Google Scholar] [CrossRef]
- Bona, E.; Hagberg, H.; Løberg, E.M.; Bågenholm, R.; Thoresen, M. Protective Effects of Moderate Hypothermia after Neonatal Hypoxia-Ischemia: Short- and Long-Term Outcome. Pediatr. Res. 1998, 43, 738–745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murao, Y.; Loomis, W.; Wolf, P.; Hoyt, D.B.; Junger, W.G. Effect of Dose of Hypertonic Saline on Its Potential to Prevent Lung Tissue Damage in a Mouse Model of Hemorrhagic Shock. Shock 2003, 20, 29–34. [Google Scholar] [CrossRef]
- Ibrahim, M.Y.; Abdul, A.B.H.; Ibrahim, T.A.T.; Abdelwahab, S.I.; Elhassan, M.M.; Syam, M.M. Evaluation of acute toxicity and the effect of single injected doses of zerumbone on the kidney and liver functions in Sprague Dawley rats. Afr. J. Biotechnol. 2010, 9, 442–445. [Google Scholar]
- Hiraoka, Y.; Kishimoto, C.; Kurokawa, M.; Ochiai, H.; Sasayama, S. Effects of polyethylene glycol conjugated superoxide dismutase on coxsackievirus B3 myocarditis in mice. Cardiovasc. Res. 1992, 26, 956–961. [Google Scholar] [CrossRef]
- Chiu, C.-J.; McArdle, A.H.; Brown, R.; Scott, H.J.; Gurd, F.N. Intestinal Mucosal Lesion in Low-Flow States. Arch. Surg. 1970, 101, 478–483. [Google Scholar] [CrossRef]
- Lane, J.S.; Todd, K.E.; Lewis, M.P.; Gloor, B.; Ashley, S.W.; Reber, H.A.; McFadden, D.W.; Chandler, C.F. Interleukin-10 reduces the systemic inflammatory response in a murine model of intestinal ischemia/reperfusion. Surgery 1997, 122, 288–294. [Google Scholar] [CrossRef]
- Wolfroum, S.; Grimm, M.; Heidberder, M.; Dendorfer, A.; Kauts, H.; Liao, K.G.R. Acute reduction of myocardial infarct size by a hydroxymethyl glutaryl coenzyme A ruductase inhibitor is mediated by endothelial nitric oxide synthetase. J. Cardiovasc. Pharmacol. 2003, 41, 474–480. [Google Scholar] [CrossRef]
- Lang, R.M.; Badano, L.P.; Mor-Avi, V.; Afilalo, J.; Armstrong, A.; Ernande, L.; Flachskampf, F.A.; Foster, E.; Goldstein, S.A.; Kuznetsova, T.; et al. Recommendations for Cardiac Chamber Quantification by Echocardiography in Adults: An Update from the American Society of Echocardiography and the European Association of Cardiovascular Imaging. J. Am. Soc. Echocardiogr. 2015, 28, 1–39. [Google Scholar] [CrossRef] [Green Version]
- Ivanova, A.D.; Kuzmin, V.S. Electrophysiological characteristics of the rat azygos vein under electrical pacing and adrenergic stimulation. J. Physiol. Sci. 2017, 68, 617–628. [Google Scholar] [CrossRef]
- Kubo, S.H.; Rector, T.S.; Bank, A.J. Endothelial nitric oxide pathway function in the peripheral vasculature of patients with heart failure. J. Card. Fail. 1996, 2, S217–S223. [Google Scholar] [CrossRef]
- Ontkean, M.; Gay, R.; Greenberg, B. Diminished endothelium-derived relaxing factor activity in an experimental model of chronic heart failure. Circ. Res. 1991, 69, 1088–1096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takeshita, A.; Hirooka, Y.; Imaizumi, T. Role of the endothelium in control of forearm blood flow in patients with heart failure. J. Card Fail 1996, 2, S209–S215. [Google Scholar] [CrossRef]
- Gryglewski, R.J.; Ramwell, P.W. Prostaglandins, Platelets, And Atherosclerosi. CRC Crit. Rev. Biochem. 1980, 7, 291–338. [Google Scholar] [CrossRef]
- Veljaca, M.; Pavic-Sladoljev, D.; Mildner, B.; Brajsa, K.; Krnic, Z.; Bubenik, M.; Stipanicic, S.; Tabak-Slosic, M.; Brnic, L.; Khan, Z.; et al. Safety, tolerability and pharmacokinetics of PL 14736, a novel agent for treatment of ulcerative colitis, in healthy male volunteers. Gut 2003, 51 (Suppl. III), A309. [Google Scholar]
- Ruenzi, M.; Stolte, M.; Veljaca, M.; Oreskovic, K.; Peterson, J.; Ulcerative Colitis Study Group. A multicenter, randomized, double blind, placebo controlled phase II study of PL 14736 enema in the treatment of mild-to-moderate ulcerative colitis. Gastroenterology 2005, 128, 584. [Google Scholar]
- Veljaca, M.; Lesch, C.A.; Pllana, R.; Sanchez, B.; Chan, K.; Guglietta, A. BPC-15 reduces trinitrobenzene sulfonic acid-induced colonic damage in rats. J. Pharmacol. Exp. Ther. 1995, 272, 417–422. [Google Scholar] [PubMed]
- Klicek, R.; Kolenc, D.; Suran, J.; Drmic, D.; Brcic, L.; Aralica, G.; Sever, M.; Holjevac, J.; Radic, B.; Turudic, T.; et al. Stable gastric pentadecapeptide BPC 157 heals cysteamine-colitis and colon-colon-anastomosis and counteracts cuprizone brain injuries and motor disability. J. Physiol. Pharmacol. 2013, 64, 597–612. [Google Scholar] [PubMed]
- Lojo, N.; Rasic, Z.; Sever, A.Z.; Kolenc, D.; Vukusic, D.; Drmic, D.; Zoricic, I.; Sever, M.; Seiwerth, S.; Sikiric, P. Effects of diclofenac, L-NAME, L-arginine, and pentadecapeptide BPC157 on gastrointestinal, liver, and brain lesions, failed anastomosis, and intestinal adaptation deterioration in 24 h-short-bowel rats. PLoS ONE 2016, 11, e0162590. [Google Scholar] [CrossRef] [Green Version]
- Drmic, D.; Kolenc, D.; Ilic, S.; Bauk, L.; Sever, M.; Sever, A.Z.; Luetic, K.; Suran, J.; Seiwerth, S.; Sikiric, P. Celecoxib-induced gastrointestinal, liver and brain lesions in rats, counteraction by BPC 157 or L-arginine, aggravation by L-NAME. World J. Gastroenterol. 2017, 23, 5304–5312. [Google Scholar] [CrossRef]
- Ilic, S.; Brcic, I.; Mester, M.; Filipovic, M.; Sever, M.; Klicek, R.; Barisic, I.; Radic, B.; Zoricic, Z.; Bilic, V.; et al. Over-dose insulin and stable gastric pentadecapeptide BPC Attenuated gastric ulcers, seizures, brain lesions, hepatomegaly, fatty liver, breakdown of liver glycogen, profound hypoglycemia and calcification in rats. J. Physiol. Pharmacol. 2009, 60, 107–114. [Google Scholar]
- Ilic, S.; Drmic, D.; Zarkovic, K.; Kolenc, D.; Coric, M.; Brcic, L.; Klicek, R.; Radic, B.; Sever, M.; Djuzel, V.; et al. High hepatotoxic dose of paracetamol produces generalized convulsions and brain damage in rats. A counteraction with the stable gastric pentadecapeptide BPC 157 (PL 14736). J. Physiol. Pharmacol. 2010, 61, 241–250. [Google Scholar]
- Ilic, S.; Drmic, D.; Franjic, S.; Kolenc, D.; Coric, M.; Brcic, L.; Klicek, R.; Radic, B.; Sever, M.; Djuzel, V.; et al. Pentadecapeptide BPC 157 and its effects on a NSAID toxicity model: Diclofenac-induced gastrointestinal, liver, and encephalopathy lesions. Life Sci. 2011, 88, 535–542. [Google Scholar] [CrossRef]
- Ilic, S.; Drmic, D.; Zarkovic, K.; Kolenc, D.; Brcic, L.; Radic, B.; Djuzel, V.; Blagaic, A.B.; Romic, Z.; Dzidic, S.; et al. Ibuprofen hepatic encephalopathy, hepatomegaly, gastric lesion and gastric pentadecapeptide BPC 157 in rats. Eur. J. Pharmacol. 2011, 667, 322–329. [Google Scholar] [CrossRef]
- Gajger, I.T.; Ribaric, J.; Skerl, M.S.; Vlainic, J.; Sikiric, P. Stable gastric pentadecapeptide BPC 157 in honeybee (Apis mellifera) therapy, to control Nosema ceranae invasions in apiary conditions. J. Vet. Pharmacol. Ther. 2018, 41, 614–621. [Google Scholar] [CrossRef] [PubMed]
- Tlak Gajger, I.; Smodis Skerl, M.I.; Sostaric, P.; Suran, J.; Sikiric, P.; Vlainic, J. Physiological and immunological status of adult honeybees (Apis mellifera) fed sugar syrup supplemented with pentadecapeptide BPC 157. Biology 2021, 10, 891. [Google Scholar] [CrossRef] [PubMed]
- Sikiric, P.; Drmic, D.; Sever, M.; Klicek, R.; Blagaic, A.B.; Tvrdeic, A.; Kralj, T.; Kovac, K.K.; Vukojevic, J.; Siroglavic, M.; et al. Fistulas Healing. Stable Gastric Pentadecapeptide BPC 157 Therapy. Curr. Pharm. Des. 2020, 26, 2991–3000. [Google Scholar] [CrossRef] [PubMed]
- Seiwerth, S.; Rucman, R.; Turkovic, B.; Sever, M.; Klicek, R.; Radic, B.; Drmic, D.; Stupnisek, M.; Misic, M.; Vuletic, L.B.; et al. BPC 157 and Standard Angiogenic Growth Factors. Gastrointestinal Tract Healing, Lessons from Tendon, Ligament, Muscle and Bone Healing. Curr. Pharm. Des. 2018, 24, 1972–1989. [Google Scholar] [CrossRef]
- Xu, C.; Sun, L.; Ren, F.; Huang, P.; Tian, Z.; Cui, J.; Zhang, W.; Wang, S.; Zhang, K.; He, L.; et al. Preclinical safety evaluation of body protective compound-157, a potential drug for treating various wounds. Regul. Toxicol. Pharmacol. 2020, 114, 104665. [Google Scholar] [CrossRef]
Gene | Nucleotide Sequence | Product Size | GenBank Accession No. |
---|---|---|---|
GAPDH Glyceraldehyde-3-phosphate dehydrogenase | Sense: TGGCAAGTTCAACGGCACAGT Antisense: TTTGGCCTCACCCTTCAGGT | 193 bp | XM_221353 |
iNOS (NOS-2) Inducible nitric oxide synthase | Sense: TTGGAGCGAGTTGTGGATTGTTGTTC Antisense: GGTGAGGGCTTGCCTGAGTGAGC | 126 bp | NM_012611 |
eNOS (NOS-3) Endothelial nitric oxide synthase | Sense: CTGGCAAGACCGATTACACGA Antisense: TCAGGAGGTCTTGCACATAGG | 206 bp | NM_021838 |
COX-2 Cyclooxygenase-2 | Sense: CTGTATCCCGCCCTGCTGGTG Antisense: CCACTTCTCCTCCGAAGGTGC | 157 bp | AF233596 |
Prophylactic Regimen | |||||
---|---|---|---|---|---|
Medication /kg i.p. | Noxious procedure mg/kg s.c. | Clinical status in time after initial isoprenaline application | |||
Prophylactic regimen | Isoprenaline at “0” time and “24 h” time | Respiratory frequency/min, means ± SD | Peripheral edema, scored 0–3, min/med/max | ||
Medication at 30 min before isoprenaline | 24 h (one isoprenaline challenge) infarction | 48 h (two isoprenaline challenges) reinfarction | 24 h (one isoprenaline challenge) infarction | 48 h (two isoprenaline challenges) reinfarction | |
Saline 5 mL | Isoprenaline 75 | 138 ± 41 | 158 ± 47 | 1/2/3 | 2/3/3 |
BPC 157 10 µg | 77 ± 23 * | 81 ± 24 * | 0/0/0 * | 0/1/2 * | |
BPC 157 10 ng | 80 ± 24 * | 90 ± 27 * | 0/0/1 * | 1/1/2 * | |
Saline 5 mL | Isoprenaline 150 | 144 ± 43 | 133 ± 49 | 1/2/3 | 2/3/3 |
BPC 157 10 µg | 83 ± 25 * | 93 ± 28 * | 0/0/0 * | 0/1/2 * | |
BPC 157 10 ng | 95 ± 28 * | 99 ± 29 * | 0/0/1 * | 1/1/2 * | |
L-NAME 5 mg | 161 ± 48 * | 177 ± 53 * | 2/3/3 * | 2/3/3 * | |
L-arginine 200 mg | 92 ± 27 * | 95 ± 28 * | 0/1/2 * | 1/1/2 * | |
L-NAME 5 mg + L-arginine 200 mg | 142 ± 42 | 159 ± 47 | 1/2/3 | 2/3/3 | |
BPC 157 10 µg + L-NAME 5 mg | 89 ± 26 * | 94 ± 28 * | 0/0/0 * | 0/1/1 * | |
BPC 157 10 µg + L-arginine 200 mg | 81 ± 24 * | 92 ± 27 * | 0/0/0 * | 0/1/2 * | |
BPC 157 10 µg + L-NAME 5 mg + L-arginine 200 mg | 85 ± 25 * | 97 ± 29 * | 0/0/1 * | 1/1/2 * | |
Therapeutic regimen | |||||
Noxious procedure mg/kg s.c. | Medication /kg i.p. | Clinical status in time after initial isoprenaline application | |||
Isoprenaline at “0” time and “24 h” time | Therapeutic regimen | Respiratory frequency/min, means ± SD | Peripheral edema, scored 0–3, min/med/max | ||
Medication at 5 min after isoprenaline | 24 h (one isoprenaline challenge) infarction | 48 h (two isoprenaline challenges) reinfarction | 24 h (one isoprenaline challenge) infarction | 48 h (two isoprenaline challenges) reinfarction | |
Isoprenaline 75 | Saline 5 mL | 144 ± 43 | 168 ± 50 | 1/2/3 | 2/3/3 |
BPC 157 10 µg | 81 ± 24 * | 90 ± 27 * | 0/0/1 * | 0/1/1 * | |
BPC 157 10 ng | 85 ± 25 * | 96 ± 28 * | 0/0/1 * | 0/1/2 * | |
Isoprenaline 150 | Saline 5 mL | 155 ± 46 | 170 ± 51 | 2/2/3 | 2/3/3 |
BPC 157 10 µg | 92 ± 27 * | 100 ± 30 * | 0/0/1 * | 0/1/1 * | |
BPC 157 10 ng | 100 ± 30 * | 105 ± 28 * | 0/0/1 * | 1/1/2 * | |
L-NAME 5 mg | 176 ± 52 * | 192 ± 57 * | 2/3/3 * | 2/3/3 * | |
L-arginine 200 mg | 90 ± 27 * | 100 ± 30 * | 0/1/2 * | 1/1/2 * | |
L-NAME 5 mg + L-arginine 200 mg | 152 ± 45 | 168 ± 51 | 1/2/2 | 2/3/3 | |
BPC 157 10 µg + L-NAME 5 mg | 96 ± 28 * | 105 ± 31 * | 0/0/1 * | 1/1/2 * | |
BPC 157 10 µg + L-arginine 200 mg | 98 ± 29 * | 103 ± 32 * | 0/0/1 * | 1/1/2 * | |
BPC 157 10 µg + L-NAME 5 mg + L-arginine 200 mg | 90 ± 27 * | 101 ± 35 * | 0/0/1 * | 1/1/2 * |
Medication and Noxious Procedure | Mortality Rate Expressed as Percentage of Total Number that Survived Given Regimens (20 Rats per Initial group) Prophylactic Regimen | Medication /kg i.p. at 5 min after Isoprenaline | Mortality Rate Expressed as Percentage of Total Number that Survived Given Regimens (20 Rats per Initial Group) Therapeutic Regimen | |||
---|---|---|---|---|---|---|
Medication /kg i.p. at 30 min before Isoprenaline | Isoprenaline Challenge /kg s.c. (time “0”) (time “24 h”) | Time after initiation of the isoprenaline noxious procedure | Time after Initiation of the Isoprenaline Noxious Procedure | |||
24 h (One Isoprenaline Challenge) Infarction | 48 h (two Isoprenaline Challenges) Reinfarction | 24 h (One Isoprenaline Challenge) Infarction | 48 h (Two Isoprenaline Challenges) Reinfarction | |||
Saline 5 mL | Isoprenaline 75 mg | 40 | 50 | Saline 5 mL | 45 | 55 |
BPC 157 10 µg | 0 * | 0 * | BPC 157 10 µg | 0 * | 0 * | |
BPC 157 10 ng | 0 * | 0 * | BPC 157 10 ng | 0 * | 0 * | |
Saline 5 mL | Isoprenaline 150 mg | 45 | 63 | Saline 5 mL | 50 | 60 |
BPC 157 10 µg | 0 * | 0 * | BPC 157 10 µg | 0 * | 0 * | |
BPC 157 10 ng | 0 * | 0 * | BPC 157 10 ng | 0 * | 0 * | |
L-NAME 5 mg | 75 * | 80 * | L-NAME 5 mg | 75 * | 80 * | |
L-arginine 200 mg | 5 * | 5.3 * | L-arginine 200 mg | 10 * | 11.1 * | |
L-NAME 5 mg + L-arginine 200 mg | 50 | 60 | L-NAME 5 mg + L-arginine 200 mg | 50 | 60 | |
BPC 157 10 µg + L-NAME 5 mg | 0 * | 0 * | BPC 157 10 µg + L-NAME 5 mg | 0 * | 0 * | |
BPC 157 10 µg + L-arginine 200 mg | 0 * | 0 * | BPC 157 10 µg + L-arginine 200 mg | 0 * | 0 * | |
BPC 157 10 µg/kg + L-NAME 5 mg+ L-arginine 200 mg | 0 * | 0 * | BPC 157 10 µg/kg + L-NAME 5 mg + L-arginine 200 mg | 0 * | 0 * |
Experimental Group | eNOS/GAPDH | iNOS/GAPDH | COX-2/GAPDH | |||
---|---|---|---|---|---|---|
24 h after First Isoprenaline Challenge | 48 h after First Isoprenaline Challenge | 24 h after First Isoprenaline Challenge | 48 h after First Isoprenaline Challenge | 24 h after First Isoprenaline Challenge | 48 h after First Isoprenaline Challenge | |
Saline 5 mL/kg i.p. + isoprenaline 150 mg/kg s.c. | 1.23 ± 0.3 | 1.15 ± 0.1 | 1.05 ± 0.1 | 1.02 ± 0.1 | 1.05 ± 0.08 | 0.83 ± 0.1 |
BPC 157 10 µg/kg i.p. + isoprenaline 150 mg/kg s.c. | 0.97 ± 0.2 * | 1.06 ± 0.1 | 1.10 ± 0.2 | 1.06 ± 0.2 | 0.53 ± 0.08 * | 0.93 ± 0.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barisic, I.; Balenovic, D.; Udovicic, M.; Bardak, D.; Strinic, D.; Vlainić, J.; Vranes, H.; Smoday, I.M.; Krezic, I.; Milavic, M.; et al. Stable Gastric Pentadecapeptide BPC 157 May Counteract Myocardial Infarction Induced by Isoprenaline in Rats. Biomedicines 2022, 10, 265. https://doi.org/10.3390/biomedicines10020265
Barisic I, Balenovic D, Udovicic M, Bardak D, Strinic D, Vlainić J, Vranes H, Smoday IM, Krezic I, Milavic M, et al. Stable Gastric Pentadecapeptide BPC 157 May Counteract Myocardial Infarction Induced by Isoprenaline in Rats. Biomedicines. 2022; 10(2):265. https://doi.org/10.3390/biomedicines10020265
Chicago/Turabian StyleBarisic, Ivan, Diana Balenovic, Mario Udovicic, Darija Bardak, Dean Strinic, Josipa Vlainić, Hrvoje Vranes, Ivan Maria Smoday, Ivan Krezic, Marija Milavic, and et al. 2022. "Stable Gastric Pentadecapeptide BPC 157 May Counteract Myocardial Infarction Induced by Isoprenaline in Rats" Biomedicines 10, no. 2: 265. https://doi.org/10.3390/biomedicines10020265