For several years our laboratory has focused on characterizing NEIL1’s interactions with downstream repair proteins, and identified its pairwise binding to XRCC1, Polβ, LigIIIα [12], FEN-1 [26], PCNA [21], RPA [22], WRN [20] and hnRNP-U [18]. We mapped all of these interactions to approximately 100 residues at the C-terminus of NEIL1, encompassing a minimally required 38 residue CID segment (Table 1). The DNA glycosylase/AP lyase activity of purified, recombinant wild-type (WT) vs. the C-terminally truncated mutant (N311, lacking the CID) were comparable with a 5'-³²P-labeled 51-nt duplex oligo substrate containing 5-hydroxyuracil (5-OHU; Figure 2). Thus the deletion of the C-terminus has no major impact on NEIL1’s lesion excision and strand incision activities.

Far-Western analysis showed that the CID is required for its pairwise interaction with the SN-BER proteins Polβ, LigIIIα and XRCC1 (Figure 3A). Their co-immunoprecipitation (co-IP) from FLAG- tagged WT but not truncated NEIL1-expressing HEK293 cell extracts using FLAG antibody (Ab)-beads further confirmed that in-cell association of NEIL1 with SN-BER proteins requires the CID (Figure 3B), consistent with our previous data [12]. The levels of ectopic NEIL1 in these cells were comparable to that of the endogenous enzyme (data not shown). We then performed in situ proximity ligation assay (PLA; Olink Biosciences) which is specific for detecting physically interacting proteins in a complex [18,28,29,30]. The association of FLAG Ab (mouse; SIGMA) vs. Abs (rabbit) for SN-BER proteins Polβ, LigIIIα or XRCC1 was tested in FLAG-NEIL1- or FLAG-N311 mutant-expressing cells. A significant number of nuclear foci were observed for FLAG-NEIL1 but not for the FLAG-N311 mutant, confirming NEIL1’s in-cell association with these proteins in HEK293 cell nuclei (Figure 3C). The PLA data thus provide independent evidence for the role of NEIL1’s CID for interactions with partner proteins, consistent with the results from co-IP and in vitro interaction analysis.

As already mentioned, NEIL1’s stable interaction with other repair and accessory proteins also utilizes its CID [18,20,21,22,26]. Thus this nonconserved segment, absent in Nei, might have been acquired as a terminal addition during evolution of the mammals [8,27]. It is interesting to note an analogous situation in the case of mammalian APE1, another critical component of BER, where its nonconserved N-terminal segment (65 residues), absent in the E. coli prototype Xth, is involved in all known interactions with partner proteins [31,32,33]. Although it is intriguing how NEIL1 or any other protein could simultaneously bind to so many proteins with high specificity via a small common peptide segment, recent studies have indicated that it is not uncommon for the mammalian hub proteins with multiple partners to have such an interaction surface, which invariably has a disordered structure [34,35]. The flexibility of the disordered domain may be critical to facilitate specific initial interactions with diverse partners [27]. These multiple interactions involving both the repair-initiating and the terminal enzyme in the pathway, along with many proteins participating in the intermediate steps, may also be important for the selection of repair sub-pathway and its efficient co-ordination [36,37]. We have previously identified specific amino acid (aa) residues in NEIL1’s CID that are involved in direct interaction with FEN-1, disruption of which significantly affects NEIL1-initiated LP-BER [26]. Furthermore, the lack of the interacting domain in NEIL1’s bacterial prototype, Nei, underscores the importance of protein-protein interactions and complexity in mammalian BER.

We next examined the effect of deleting NEIL1’s CID on the complete repair of 5-OHU, using either purified proteins or a FLAG IP from HEK293 cells. The repair reaction was reconstituted with a 5-OHU-containing plasmid substrate (Figure 3A), generated as described in the Experimental Section. Repair via SN-BER initiated by the N311 mutant in the presence of PNKP, Polβ, LigIIIα and XRCC1 was ~3-fold less efficient relative to WT NEIL1 (Figure 3B), as indicated by incorporation α-³²P-TMP at the damaged base site. We then analyzed the SN-BER reaction with FLAG IPs isolated from HEK293 cell extracts stably expressing FLAG-WT NEIL1 or FLAG-N311 mutant. After confirming the comparable FLAG level in the cell extracts by Western analysis (Figure 4C), the repair protein complexes were isolated using anti-FLAG Ab-bound beads as before. The DNA glycosylase activity of FLAG-N311 IP that lacks the interacting proteins (Figure 2E; Table 1) is ~2.5-fold less than that of FLAG IP of WT NEIL1, with a 5-OHU-containing duplex oligo substrate (Figure 4D).

We have previously shown that NEIL1’s interacting partners (e.g., FEN-1, PCNA, WRN and hnRNP-U) stimulate its glycosylase activity, which requires their binding via NEIL1’s CID [18,20,21,26]. Thus the reduced activity of the FLAG-N311 IP likely reflected the lack of its stimulation by other proteins, although the role of posttranslational modifications cannot be ruled out. Furthermore, unlike the IP of FLAG-WT NEIL1, the FLAG-N311 mutant IP was significantly deficient in complete repair of the 5-OHU-containing plasmid substrate, confirming the lack of downstream repair proteins (Figure 4E). Taken together, these results show that NEIL1’s CID, which is dispensable for its glycosylase activity, is required for its interactions with partner proteins resulting in efficient repair of oxidized bases.

The requirement of NEIL1’s interaction with other repair proteins for optimal repair predicts that the CID-lacking mutant would not be able to reverse the ROS sensitivity of NEIL1-deficient cells. We tested this with clonogenic survival assays for NEIL1-depleted HEK293 cells after glucose oxidase (GO) treatment (which generates H₂O₂), and examined the effect of ectopic expression of WT NEIL1 vs. the N311 mutant. Endogenous NEIL1 was depleted (>80%;) after transfection with 3'-UTR-specific siRNA (Experimental Section) that allowed ectopic expression of NEIL1’s coding sequence (Figure 5A). NEIL1 deficiency significantly increased cells’ sensitivity to GO, consistent with our previous observation [18]. However, ectopic expression of WT NEIL1, but not of its N311 mutant, protected endogenous NEIL1-depleted cells from ROS sensitivity. These results support our conclusion that NEIL1’s interactions with downstream repair and accessory proteins via its CID are required for protection of cells after oxidative stress.

Recombinant WT NEIL1, PNKP, Polβ, LigIIIα and XRCC1 were purified to homogeneity from E. coli-bearing their expression plasmids, as described previously [10,12,38]. Truncated NEIL1 (N311) clone, an endoproteinase Asp-N limited-digestion product of NEIL1 [20], was generated by introducing stop codons after the 311^th aa position in a NEIL1-expression plasmid (pET22b; [10]) using Quick Change site-directed mutagenesis (Stratagene). After confirming the sequence, the untagged N311 was expressed in E. coli BL21-RIPL cells in LB media in a 16˚C shaker overnight and purified to homogeneity as before [10]. The purity of the NEIL1 and N311 preparations was confirmed by SDS-PAGE analysis (Figure 2B).

A mammalian expression plasmid (modified pcDNA-FLAG) for FLAG-tagged WT NEIL1 was described previously [18,21]. To generate the FLAG-N311 mutant expression plasmid, cDNA corresponding to this sequence was PCR-amplified from a NEIL1 expression plasmid using EcoR1/BamH1 site-containing primers and cloned in a pcDNA-FLAG plasmid. Stable transfectants of FLAG-NEIL1 and FLAG-N311 in HEK293 cells were generated by transfecting the cells with the respective plasmids and selecting clones with resistance to zeocin (100 µg/mL). The surviving clones were expanded, and after analysis of FLAG expression the clones with low FLAG level (comparable to the endogenous NEIL1) were used in this study.

The oligonucleotide and plasmid substrates containing the base lesion 5-OHU used in NEIL1’s glycosylase and complete repair assays, respectively, were described earlier [7,18,38]. To produce radio-labeled substrates, the single-stranded 5-OHU-containing oligo was labeled at the 5′-termini with [γ-³²P]-ATP using T₄-PNK (New England Biolabs) before annealing. The labeled substrates were separated from unincorporated radioactivity by chromatography on Sephadex G25.

HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 100 units/mL of penicillin, 100 μg/mL streptomycin and 2 mM glutamine, at 37 °C and 5% CO₂. For co-IP analysis, log-phase cells stably expressing empty FLAG, NEIL1-FLAG, or N311-FLAG plasmids were lysed, digested with 500 units/ml benzonase (Novagen) at 37 °C for 30 min, and cleared by centrifugation. The supernatants were then immunoprecipitated for 3 h at 4⁰C with anti-FLAG Ab cross-linked to agarose beads (SIGMA). After collecting the beads by centrifugation and washing three times with cold Tris-buffered saline, the FLAG immunocomplex was eluted from the beads by adding SDS loading buffer for Western analysis. For repair assays with IPs, the beads were incubated with substrate with constant shaking [18].

Recombinant WT NEIL1 and N311 mutant (40 pmol) were transferred to a nitrocellulose membrane after SDS-PAGE (12%), denatured in situ with 6M guanidine-HCl and then renatured by sequential incubation with serially diluted guanidine-HCl in PBS + 1 mM DTT [22], before incubating the membrane with Polβ, LigIIIα or XRCC1 (10 pmol/mL) in PBS supplemented with 0.5% nonfat dried milk, 0.05% Tween 20, 10 mM trimethylamine N-oxide (TMAO) and 1mM DTT for 3h, followed by immunoblotting with appropriate Abs.

HEK293 cells stably expressing FLAG-WT NEIL1 or FLAG-N311 mutant were cultured overnight in an 8-well chamber slide, fixed with 4% paraformaldehyde, then permeabilized with 0.2% Tween 20, followed by incubation with a primary Ab for FLAG [mouse; SIGMA] and rabbit Abs for Polβ (a gift from Dr. S.H. Wilson, NIEHS, NC), LigIIIα (Bethyl Laboratories) or XRCC1 (Santa Cruz). PLA assays were performed using the Duolink PLA kit from OLink Bioscience (Cat# LNK-92101-KI01; Uppsala, Sweden) per the manufacturer’s instructions. The nuclei were counterstained with DAPI, and the PLA signals were visualized in a fluorescence microscope (NIKON Ti system) at 193x magnification. In this analysis, two proteins are immunostained with distinct species-specific secondary Abs that are linked to complementary oligonucleotides. When two different Ab molecules bind in close proximity (<40 nm), the linked DNA can be linearly amplified via a rolling circle mechanism and visualized as distinct foci with a fluorescent probe.

The base lesion excision and strand incision activity of WT NEIL1 or N311 mutant was analyzed after incubation of 5' ³²P-labeled, 5-OHU-containing duplex oligo substrate at 37˚C for 15 min in a 10 μl reaction mixture containing 40 mM HEPES-KOH, pH 7.5, 50 mM KCl, 1 mM MgCl₂, 100 μg/ml bovine serum albumin and 5% glycerol. The reaction was stopped with the formamide dye mix (80% formamide, 20 mM NaOH, 20 mM EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol) and the products were analyzed in a PhosphorImager using Image Quant software after separation by denaturing gel electrophoresis [18,26].

Repair of 5-OHU-containing plasmid substrate initiated with WT-NEIL1 or the N311 mutant was analyzed using reconstituted in vitro system containing recombinant proteins or FLAG IP as described previously [7,18]. Briefly, the repair reaction (20μL) containing 50 fmol each of PNKP, Polβ, LigIIIα and XRCC1 along with 10 and 50 fmol WT NEIL1 or N311mutant together with 1 mmol ATP, 10 μmol of [α-³²P]-dTTP, and unlabeled dNTPs (25 mmol) was incubated for 30 min at 37 °C. For repair using the FLAG IP, recombinant proteins were replaced with FLAG-Ab bead eluates after co-IP of HEK293 cell extracts with comparable FLAG levels The products were analyzed in a PhosphorImager after separation in a denaturing gel as before [26].

Log-phase HEK293 cultures were transfected with NEIL1 siRNA (80 nM; targeting the 3'UTR region of the NEIL1 gene; sense sequence, 5'CCGUGAUGAUGUUUGUUUAUU3'; antisense sequence, 5'UAAACAAACAUCAUCACGGUU3', SIGMA; [18]) or scrambled control siRNA. NEIL1’s depletion was confirmed by immunoblotting the cell extracts at 48 h after transfection. Separately, cells were co-transfected with NEIL1 siRNA plus FLAG-WT NEIL1 or FLAG-N311 mutant expression plasmid. After 48 h, the cells were treated with GO (0 to 100 ng/mL; in triplicate) for 15 min, then trypsinized and transferred to 60-mm dishes (400 cells/dish). Cells were allowed to grow in fresh medium for 8 days; the colonies were counted after staining with crystal violet to calculate the surviving fraction [18,39].