<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xml:lang="en" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">viruses</journal-id>
      <journal-title>Viruses</journal-title>
      <abbrev-journal-title abbrev-type="publisher">Viruses</abbrev-journal-title>
      <abbrev-journal-title abbrev-type="pubmed">Viruses</abbrev-journal-title>
      <issn pub-type="epub">1999-4915</issn>
      <publisher>
        <publisher-name>MDPI</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.3390/v4091792</article-id>
      <article-id pub-id-type="publisher-id">viruses-04-01792</article-id>
      <article-categories>
        <subj-group>
          <subject>Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>PepGMV <italic>Rep</italic>-Protein Expression in Mammalian Cells</article-title>
      </title-group>
	  <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Chapa-Oliver</surname>
            <given-names>Angela María</given-names>
          </name>
          <xref rid="af1-viruses-04-01792" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Mejía-Teniente</surname>
            <given-names>Laura</given-names>
          </name>
          <xref rid="af1-viruses-04-01792" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>García-Gasca</surname>
            <given-names>Teresa</given-names>
          </name>
          <xref rid="af2-viruses-04-01792" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Guevara-Gonzalez</surname>
            <given-names>Ramon Gerardo</given-names>
          </name>
          <xref rid="af1-viruses-04-01792" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Torres-Pacheco</surname>
            <given-names>Irineo</given-names>
          </name>
          <xref rid="af1-viruses-04-01792" ref-type="aff">1</xref>
          <xref rid="c1-viruses-04-01792" ref-type="corresp">*</xref>
        </contrib>
      </contrib-group>
      
      <aff id="af1-viruses-04-01792"><label>1 </label>CA Ingeniería de Biosistemas, División de Investigación y Posgrado, Facultad de Ingeniería, Universidad Autónoma de Querétaro, Cerro de las Campanas s/n, Santiago de Querétaro, Qro., 76010, México; Email: <email>angellox02@gmail.com</email> (A.M.C.-O.); <email>laurayo@yahoo.com.mx</email> (L.M.-T.); <email>ramon.guevara@uaq.mx</email> (R.G.G.-G.)</aff>
      <aff id="af2-viruses-04-01792"><label>2 </label>División de Investigación y Posgrado, Facultad de Ciencias Naturales, Universidad Autónoma de Querétaro, Avenida de las Ciencias s/n, Juriquilla, Qro., 76230, México; Email: <email>tggasca@gmail.com</email></aff>
      <author-notes>
        <corresp id="c1-viruses-04-01792"><label>*</label> Author to whom correspondence should be addressed; Email: <email>irineo.torres@uaq.mx</email>; <email>torresirineo@gmail.com</email>; Tel.: +52-442-192-12-52; Fax: +52-442-192-13-12.</corresp>
      </author-notes>
      <pub-date pub-type="epub">
        <day>24</day>
        <month>09</month>
        <year>2012</year>
      </pub-date>
      <pub-date pub-type="collection">
	  <month>09</month>
        <year>2012</year>
      </pub-date>
      <volume>4</volume>
      <issue>9</issue>
      <fpage>1792</fpage>
      <lpage>1801</lpage>
      <history>
        <date date-type="received">
          <day>27</day>
          <month>07</month>
          <year>2012</year>
        </date>
        <date date-type="rev-recd">
          <day>06</day>
          <month>09</month>
          <year>2012</year>
        </date>
        <date date-type="accepted">
          <day>06</day>
          <month>09</month>
          <year>2012</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>©  2012 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
        <copyright-year>2012</copyright-year>
        <license xmlns:xlink="http://www.w3.org/1999/xlink" license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0/">
          <p>This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (<uri>http://creativecommons.org/licenses/by/3.0/</uri>).</p>
        </license>
      </permissions>
      <abstract>
        <p>The <italic>Geminiviruses</italic> genome is a small, single strand DNA that replicates in the plant cell nucleus. Analogous to animal DNA viruses, <italic>Geminiviruses</italic> depend on the host replication machinery to amplify their genomes and only supply the factors required to initiate their replication. Consequently, <italic>Geminiviruses</italic> remove the cell-cycle arrest and induce the host replication machinery using an endocycle process. They encode proteins, such as the conserved replication-associated proteins (Rep) that interact with retinoblastoma-like proteins in plants and alter the cell division cycle in yeasts. Therefore, the aim of this work is to analyze the impact of <italic>Pepper Golden Mosaic Virus</italic> (PepGMV) Rep protein in mammalian cells. Results indicate that the pTracer-SV40:Rep construction obtained in this work can be used to analyze the Rep protein effect in mammalian cells in order to compare the cell cycle regulation mechanisms in plants and animals.</p>
      </abstract>
      <kwd-group>
        <kwd>
          <italic>Geminivirus</italic>
        </kwd>
        <kwd>cell cycle</kwd>
        <kwd>Rep protein</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="intro">
      <title>1. Introduction</title>
      <p><italic>Geminiviruses</italic> are plant pathogens which have small, single strand DNA genomes. They are characterized by their unique geminate capsids formed by two incomplete icosahedra [<xref ref-type="bibr" rid="B1-viruses-04-01792">1</xref>,<xref ref-type="bibr" rid="B2-viruses-04-01792">2</xref>]. <italic>Geminiviruses</italic> constitute a large family that is divided into the <italic>Begomovirus, Mastrevirus</italic>, <italic>Curtovirus</italic>, and <italic>Topocuvirus</italic> genera based on genome arrangement, insect vector, and host range [<xref ref-type="bibr" rid="B3-viruses-04-01792">3</xref>,<xref ref-type="bibr" rid="B4-viruses-04-01792">4</xref>]. The <italic>Begomovirus</italic> genus is the largest and includes whitefly-transmited, and bipartite (genome divided into two components) <italic>geminivirus</italic> [<xref ref-type="bibr" rid="B5-viruses-04-01792">5</xref>]. <italic>Pepper Golden Mosaic Virus </italic>(<italic>PepGMV</italic>) belongs to <italic>Begomovirus</italic> genus and naturally infects pepper, tomato, tobacco, and other solanaceous crops. The typical symptoms induced by <italic>PepGMV</italic> in pepper plants, are yellow mosaic and wrinkled leaf and stunting of the plant [<xref ref-type="bibr" rid="B6-viruses-04-01792">6</xref>]. </p>
      <p><italic>Geminiviruses</italic> replicate in the cell nucleus via a rolling circle mechanism. They only supply the factors required to initiate their replication, and depend on the host replication machinery to amplify their genomes. Mammalian DNA-tumor viruses also employ this mechanism [<xref ref-type="bibr" rid="B1-viruses-04-01792">1</xref>]. Many <italic>Geminiviruses</italic> replicate in differentiated cells that no longer contain detectable levels of DNA polymerases and associated factors [<xref ref-type="bibr" rid="B1-viruses-04-01792">1</xref>,<xref ref-type="bibr" rid="B3-viruses-04-01792">3</xref>]. Therefore, <italic>geminiviruses</italic> removed the cell-cycle arrest and thereby induce the host replication machinery in order to replicate their genomes [<xref ref-type="bibr" rid="B3-viruses-04-01792">3</xref>,<xref ref-type="bibr" rid="B7-viruses-04-01792">7</xref>,<xref ref-type="bibr" rid="B8-viruses-04-01792">8</xref>].</p>
      <p>Mammalian DNA-tumor viruses such as <italic>polyoma</italic>, <italic>papilloma</italic> and <italic>adeno</italic> viruses encode proteins that modify animal cell-cycle controls by binding to the retinoblastoma protein (pRB) or the related‑family members, p107 and p130 [<xref ref-type="bibr" rid="B9-viruses-04-01792">9</xref>]. pRB-family members negatively regulate cell cycle progression and promote differentiation, in part, through their interactions with E2F transcription factors [<xref ref-type="bibr" rid="B10-viruses-04-01792">10</xref>,<xref ref-type="bibr" rid="B11-viruses-04-01792">11</xref>,<xref ref-type="bibr" rid="B12-viruses-04-01792">12</xref>].</p>
      <p>Analogous to animal DNA viruses, <italic>Geminiviruses</italic> encode proteins that interact with pRB proteins in plants. They encode for a conserved replication-associated protein (Rep) which is a multifunctional protein involved in viral replication, auto-regulation of its own gene transcription, and inactivation and recruitment of host-encoded proteins related to host DNA synthesis [<xref ref-type="bibr" rid="B4-viruses-04-01792">4</xref>,<xref ref-type="bibr" rid="B13-viruses-04-01792">13</xref>,<xref ref-type="bibr" rid="B14-viruses-04-01792">14</xref>,<xref ref-type="bibr" rid="B15-viruses-04-01792">15</xref>,<xref ref-type="bibr" rid="B16-viruses-04-01792">16</xref>,<xref ref-type="bibr" rid="B17-viruses-04-01792">17</xref>]. Rep is the only viral protein that is essential for viral replication. It initiates and terminates viral DNA synthesis and induces the accumulation of host-replication factors in infected cells [<xref ref-type="bibr" rid="B4-viruses-04-01792">4</xref>,<xref ref-type="bibr" rid="B12-viruses-04-01792">12</xref>]. Moreover, Rep protein interacts with host regulatory factors, including the proliferating cell nuclear antigen (PCNA), and the pRB, which modulates the plant cell cycle and differentiation [<xref ref-type="bibr" rid="B18-viruses-04-01792">18</xref>,<xref ref-type="bibr" rid="B19-viruses-04-01792">19</xref>]. Kittelmann <italic>et al</italic>. [<xref ref-type="bibr" rid="B2-viruses-04-01792">2</xref>] found that <italic>African Cassava Mosaic Virus</italic> (ACMV) Rep protein expression in fission yeast (<italic>Schizosaccharomyces pombe</italic>) caused cell elongation that resembles <italic>cdc</italic> (cell division cycle) phenotypes. Cells expressing Rep protein increased DNA contents, suggesting that ACMV Rep protein promotes reinitiation of nuclear DNA replication during the fission yeast cell cycle [<xref ref-type="bibr" rid="B2-viruses-04-01792">2</xref>]. </p>
      <p>Therefore, the objective of this work is to analyze the impact of <italic>Pepper Golden Mosaic Virus</italic> (PepGMV) Rep-protein expression in mammalian cell cycle regulation. To do this, the Rep open reading frame (ORF) was cloned into the expression vector pTracer-SV40 and 3T3L1 mouse fibroblast cells were transfected with the pTracer-SV40:Rep. Rep expression was analyzed by RT-PCR.</p>
    </sec>
    <sec sec-type="results">
      <title>2. Results and Discussion</title>
      <sec>
        <title>2.1. Expression Vector pTracer-SV40 and Ligation with PepGMV Rep-Protein Gene</title>
        <p>The <italic>Rep</italic> gene open reading frame (ORF) (GenBank: U57457.1) was amplified by PCR as shown in <xref ref-type="fig" rid="viruses-04-01792-f001">Figure 1</xref>a. Lines 2–4 (<xref ref-type="fig" rid="viruses-04-01792-f002">Figure 2</xref>a) show a band of approximately 1,047 bp corresponding to <italic>PepGMV</italic> Rep protein gene. After PCR amplification, Rep was cloned into the expression vector pTracer-SV40. Ligation was confirmed by double digestion with <italic>SpeI</italic> and <italic>KpnI</italic> enzymes. <xref ref-type="fig" rid="viruses-04-01792-f001">Figure 1</xref>b shows the gel electrophoresis of the double digestion product. As expected, two bands were observed in each of the samples. One corresponds to the linearized pTracerSV40 vector (<xref ref-type="fig" rid="viruses-04-01792-f001">Figure 1</xref>b, lines 2–4) which has a size of 4.2 kb and a second band corresponding to Rep (<xref ref-type="fig" rid="viruses-04-01792-f001">Figure 1</xref>b, lines 2–4).</p>
        <p>These results confirmed the ligation of <italic>PepGMV-</italic>Rep gene into the pTracer-SV40 expression vector, obtaining the following constructions: pTracer-SV40:Rep and pTracer-SV40:RepATG<sup>-</sup>.</p>
		<fig id="viruses-04-01792-f001" position="anchor">
          <label>Figure 1</label>
          <caption>
            <p>Agarose gel electrophoresis of Rep gene PCR amplification and construction double digestion.(<bold>a</bold>) PCR amplification of Rep gene. Lanes: 1, size molecular marker; 2, Rep; 3, RepATG<sup>−</sup>; 4, negative control. (<bold>b</bold>) Construction digestion with <italic>SpeI</italic> and <italic>KpnI</italic>. Lanes: 1, size molecular marker; 2, pTracerSV40:Rep; 3, pTracerSV40:RepATG<sup>−</sup>. The samples were loaded in a 1.2% agarose gel stained with EtBr.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="viruses-04-01792-g001.tif"/>
        </fig>
        
      </sec>
      <sec>
        <title>2.2. PepGMV Cell Transfection</title>
        <p>In order to indicate if <italic>Geminivirus PepGMV</italic> is able to replicate in mammalian cells, the <italic>PepGMV</italic> A component was transfected into 3T3L1 fibroblast cells (as described in the Experimental section). <italic>PepGMV</italic> A DNA presence was confirmed by PCR amplification using the primers for the Rep gene and the JM23 and JM24 primers (<xref ref-type="table" rid="viruses-04-01792-t001">Table 1</xref>). <xref ref-type="fig" rid="viruses-04-01792-f002">Figure 2</xref> shows the PCR amplification of <italic>PepGMV</italic> A DNA-transfected cells. Again, a band of 1,047 bp corresponding to Rep is observed in samples taken at 24 and 144 h post transfection. Additionally, a band of 280 bp corresponding to the common region of <italic>PepGMV</italic> is observed, which confirms the presence of <italic>Geminivirus</italic> DNA inside the cells. In addition, RT-PCR was performed in order to verify Rep gene transcription in transfected cells (<xref ref-type="fig" rid="viruses-04-01792-f003">Figure 3</xref>a). The level of Rep transcription was too low to be clearly seen. Thus a re-amplification was made to corroborate the presence of the Rep transcript (<xref ref-type="fig" rid="viruses-04-01792-f003">Figure 3</xref>b). A band corresponding to Rep gene was observed after re-amplification, indicating that Rep transcription was taking place in transfected cells but with a low efficiency. Therefore geminivirus <italic>PepGMV</italic> was recognized by mammalian cell machinery and Rep transcription occurred.</p>
        <table-wrap id="viruses-04-01792-t001" position="float">
          <object-id pub-id-type="pii">viruses-04-01792-t001_Table 1</object-id>
          <label>Table 1</label>
          <caption>
            <p>Oligonucleotides used for Rep gene PCR amplification, <italic>PepGMV</italic> A component detection and RT-PCR. Translation initiation codon is shown in bold letters. The underlined sequence corresponds to the Kozak sequence that was added in order to improve translation of Rep in mammalian cells.</p>
          </caption>
          <table rules="all" style="border:solid thin">
            <thead>
              <tr>
                <th align="center" valign="middle">Oligonuceotide name</th>
                <th align="center" valign="middle">Forward</th>
                <th align="center" valign="middle">Reverse</th>
                <th align="center" valign="middle">Fragment size</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td align="center" valign="middle">RepPK</td>
                <td align="center" valign="middle">GGTACC<underline>ACC</underline>ATGCCACTACCACCAAAATC</td>
                <td align="center" valign="middle">ACTAGTTTAGCTATCCTGTGCTGTGCT</td>
                <td align="center" valign="middle">1,047 bp</td>
              </tr>
              <tr>
                <td align="center" valign="middle">RepPA</td>
                <td align="center" valign="middle">GGTACCACCActGCACTACCACCAAAATC</td>
                <td align="center" valign="middle">ACTAGTTTAGCTATCCTGTGCTGTGCT</td>
                <td align="center" valign="middle">1,047 bp</td>
              </tr>
              <tr>
                <td align="center" valign="middle">JM23</td>
                <td align="center" valign="middle">TGGTGTAGGACTCCAGCAGAGTC</td>
                <td align="center" valign="middle"> </td>
                <td rowspan="2" align="center" valign="middle">288 bp</td>
              </tr>
              <tr>
                <td align="center" valign="middle">JM24</td>
                <td align="center" valign="middle">TAGGCCCACACCTTGGTGACCAA</td>
                <td align="center" valign="middle"> </td>
              </tr>
              <tr>
                <td align="center" valign="middle">β actin</td>
                <td align="center" valign="middle">AGGTATCCTGACCCTGAAGTACCCC</td>
                <td align="center" valign="middle">GGCCACACGCAGCTCATTGTA</td>
                <td align="center" valign="middle">106 bp</td>
              </tr>
              <tr>
                <td align="center" valign="middle">GAPDH</td>
                <td align="center" valign="middle">ATTGTTGCCATCAACGACCCC</td>
                <td align="center" valign="middle">CAAGCTTCCCATTCTCGGCC</td>
                <td align="center" valign="middle">116 bp</td>
              </tr>
              <tr>
                <td align="center" valign="middle">RepPepGMV</td>
                <td align="center" valign="middle">CAAAGCTGGTGATCCGAAAACG</td>
                <td align="center" valign="middle">GTTAAACGAGGATAATGGATAAGG</td>
                <td align="center" valign="middle">120 bp</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
		<fig id="viruses-04-01792-f002" position="anchor">
          <label>Figure 2</label>
          <caption>
            <p>PCR amplification of <italic>PepGMV</italic> A component in transfected cells. (<bold>a</bold>) 48 h post-transfection. Lines: 1, size molecular marker; 2, Rep primers; 3, Rep primers positive control; 4, JM23 and JM24 primers; 5, JM23 and JM24 primers positive control; 6, negative control. (<bold>b</bold>) 6 days after transfection. Lines: 1, size molecular marker; 2, Rep primers; 3, Rep primers positive control; 4, JM23 and JM24 primers; 5, JM23 and JM24 primers positive control; 6, negative control. <italic>PepGMV</italic> A plasmid DNA was used as positive control. The samples were loaded in a 1.2% agarose gel stained with EtBr.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="viruses-04-01792-g002.tif"/>
        </fig>
        
        <fig id="viruses-04-01792-f003" position="anchor">
          <label>Figure 3</label>
          <caption>
            <p>RT-PCR of <italic>PepGMV</italic> A transfected cells. (<bold>a</bold>) RT-PCR. Lines: 1, positive control; 2, GAPDH; 3, Rep. (<bold>b</bold>) RT-PCR re-amplification. Lines: 1, negative control; 2, GAPDH; 3, Rep; 4, positive control. The expected fragment size was 120 bp. Samples were loaded in a 2% agarose gel stained with EtBr.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="viruses-04-01792-g003.tif"/>
        </fig>
        <p>To determine if the Geminivirus affects the cell growth, transfected cells with <italic>PepGMV</italic> A component were counted. <xref ref-type="fig" rid="viruses-04-01792-f004">Figure 4</xref> shows the number of cells at 0, 48 and 144 h after transfection. A difference in the cell number was observed in cells transfected with the <italic>PepGMV</italic> in contrast with control cells, indicating that the presence of <italic>PepGMV</italic> is affecting cell growth.</p>
        <fig id="viruses-04-01792-f004" position="anchor">
          <label>Figure 4</label>
          <caption>
            <p>Transfected cells growth. Cells were counted using a hematocytometer after 48 and 144 h post transfection with <italic>PepGMV</italic> A component. The counting was performed in duplicate.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="viruses-04-01792-g004.tif"/>
        </fig>
      </sec>
      <sec>
        <title>2.3. Rep-Gene Expression</title>
        <p>Expression of green fluorescent protein (GFP) was detected in order to verify the construction transfection into cells (<xref ref-type="fig" rid="viruses-04-01792-f005">Figure 5</xref>). Cells transfected with the pTracer-SV40:Rep (<xref ref-type="fig" rid="viruses-04-01792-f005">Figure 5</xref>a) reacted and fluoresced in contrast with control cells in which no fluorescence was observed (<xref ref-type="fig" rid="viruses-04-01792-f005">Figure 5</xref>b). This indicates the insertion of the construction and the expression of the GFP correlates with Rep expression.</p>
        <fig id="viruses-04-01792-f005" position="anchor">
          <label>Figure 5</label>
          <caption>
            <p>Transfected cells image under fluorescent microscopy. (<bold>a</bold>) Control cells. (<bold>b</bold>) Cells transfected with pTracer-SV40:Rep. Left: white light. Right: fluorescence. Arrows indicates cell position. </p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="viruses-04-01792-g005.tif"/>
        </fig>
        <p>Additionally, Rep expression was confirmed by RT-PCR. <xref ref-type="fig" rid="viruses-04-01792-f006">Figure 6</xref> shows the RT-PCR analysis of transfected cells at 72 h post transfection. A band corresponding to Rep gene was observed in cells transfected with both pTracer-SV40:Rep and pTracer-SV40:RepATG<sup>−</sup> constructs. In contrast, with control and vector-transfected cells (<xref ref-type="fig" rid="viruses-04-01792-f006">Figure 6</xref>). This result indicates that Rep gene is being transcribed in transfected cells (<xref ref-type="fig" rid="viruses-04-01792-f006">Figure 6</xref>). </p>
        <fig id="viruses-04-01792-f006" position="anchor">
          <label>Figure 6</label>
          <caption>
            <p>RT-PCR of transfected cells. Lines: 1, control cells; 2, cells transfected with the empty vector; 3, pTracer-SV40:Rep transfected cells; 4, pTracer-SV40:RepATG<sup>−</sup> transfected cells. Samples were loaded in a 2% agarose gel stained with EtBr.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="viruses-04-01792-g006.tif"/>
        </fig>
      </sec>
    </sec>
    <sec>
      <title>3. Experimental Section</title>
      <sec>
        <title>3.1. Viral Clone and Rep-Gene PCR Amplification</title>
        <p>The dimeric clone of <italic>Pepper Golden Mosaic Virus</italic> (<italic>PepGMV</italic>) (Tamaulipas isolate) was used in this work. <italic>PepGMV</italic> genome has been previously described [<xref ref-type="bibr" rid="B6-viruses-04-01792">6</xref>]. </p>
        <p>The Rep gene open reading frame (ORF) was amplified by PCR using the oligonucleotides shown in <xref ref-type="table" rid="viruses-04-01792-t001">Table 1</xref>. The <italic>PepGMV</italic> Rep sequence used was obtained from the National Center for Biotechnology Information (NCBI) database (GenBank: U57457.1). To clone the Rep gene in the expression vector pTracer™-SV40, the sites for <italic>SpeI</italic> (extreme 3') and <italic>KpnI</italic> (extreme 5') restriction enzymes were used. PCR amplification conditions were as follows: 95 °C for 1 min, 30 cycles of 95 °C for 30 s and 68 °C for 2 min, and a final extension of 68 °C for 2 min. In addition, a negative translation control was generated by changing the Rep-gene initiation codon sequence (ATG) for the sequence ACT. </p>
      </sec>
      <sec>
        <title>3.2. Construction of pTracer™-SV40:Rep Expression Vector</title>
        <p>After PCR amplification, the 1,047 bp gene was cleaned with the Wizard® PCR Preps DNA Purification System (Promega) and cloned in the intermediate pGem®-T Easy vector (Promega) using the manufacturer’s procedures. The pTracer™-SV40 vector (Invitrogen) was double digested with <italic>SpeI</italic> and <italic>KpnI</italic> enzymes (Fermentas) in order to linearize it and clone the Rep gene. Insert and vector purification was performed using the Silica Bead DNA Gel Extraction kit (Fermentas) and ligation reaction was done using the ligase T4 (Invitrogen) and a 4:1 insert/vector molar ratio. The insert presence was confirmed by double digestion with <italic>SpeI</italic> and <italic>KpnI</italic> enzymes (Fermentas).Gene correct orientation was confirmed by sequencing (Genetic Analyzer 3130, Applied Biosystems).</p>
      </sec>
      <sec>
        <title>3.3. Cell Culture and Transfection</title>
        <p>3T3L1 mice fibroblast cells (ATCC No. CL-173) were grown in Dubelco’s Modified Eagle Medium (DMEM, Gibco) supplemented with penicillin (62.1 mg/L; Sigma), streptomycin (100 mg/L; Sigma), anphotericin (250 µg/L; Gibco), and 5% of calf serum (Biowest). The cells grew in an incubator at 37 °C and a 5% CO<sub>2</sub> atmosphere.</p>
        <p>Cell transfection was performed by calcium-phosphate precipitation method [<xref ref-type="bibr" rid="B20-viruses-04-01792">20</xref>]. Twenty four hours before transfection, cells were seeded into 60 mm plates at a concentration of 1 × 10<sup>5</sup> cells/mL [<xref ref-type="bibr" rid="B20-viruses-04-01792">20</xref>]. The culture medium was replaced with fresh medium one hour before transfection. The phosphate-DNA precipitation was performed as follows: 25 µg of plasmid DNA were mix with 100 µL of 2.5 M CaCl<sub>2</sub>. This solution was diluted with 1/10 TE buffer (1 mM Tris-HCl, 0.1 mM EDTA, pH 7.6) to a final volume of 1 mL. One volume of this 2× Ca/DNA solution was added drop by drop to an equal volume of 2× HEPES buffered saline solution. The resulting solution was incubated at room temperature for one minute prior to adding to the cells medium. One hundred microliters of precipitate per milliliter of culture medium were added to the cells Cells were exposed to the precipitate for 6 h at 37 °C and 5% CO<sub>2</sub> atmosphere. After this time, the culture medium was replaced with fresh medium and the cells were incubated for 6 days at 37 °C and 5% CO<sub>2</sub> atmosphere. Cells were transfected with pTracerSV40:Rep and pTracerSV40:RepATG<sup>-</sup>constructions. Additionally, the <italic>PepGMV</italic> A component was transfected in order to probe if <italic>PepGMV</italic> is able to replicate in mammalian cells. </p>
      </sec>
      <sec>
        <title>3.4. Rep Expression</title>
        <p>3T3L1 cells transfection with pTracerSV40:Rep and pTracerSV40:RepATG<sup>−</sup> was verified by detection of green fluorescent protein (GFP) by fluorescent microscopy. Additionally, Rep gene expression was verified by RT-PCR for treatments72 h after transfection. Total RNA was extracted from transfected cells using the SV total RNA isolation system (Promega).DNA first strand was generated by the First strand cDNA synthesis kit (Fermentas). The same treatment was applied to cells transfected with <italic>PepGMV</italic> A component. cDNA PCR amplification was performed with the oligonucleotides shown in <xref ref-type="table" rid="viruses-04-01792-t001">Table 1</xref> and the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GADPH) and β actin were used as expression controls [<xref ref-type="bibr" rid="B21-viruses-04-01792">21</xref>,<xref ref-type="bibr" rid="B22-viruses-04-01792">22</xref>].</p>
      </sec>
    </sec>
    <sec sec-type="conclusions">
      <title>4. Conclusions</title>
      <p>The <italic>Pepper Golden Mosaic Virus</italic> Rep gene was expressed in mammalian cells. This gene was cloned and transfected into mammalian cells. The expression level was at the same level as the housekeeping genes. Results indicated that the pTracer-SV40:Rep construction developed in this work can be used to analyze the Rep-protein expression in mammalian cells. Moreover, <italic>PepGMV</italic>, as <italic>Geminivirus</italic>, was recognized by mammalian-cell machinery and Rep transcription occurred. This trend indicates that this model can be used to study mammalian cell cycle transcriptome regulation using a <italic>Geminivirus</italic> member. The next step is to determine the effect of the Rep-expressed protein in the expression of mammalian cell cycle regulation genes.</p>
    </sec>
    
  </body>
  <back>
  <ack>
      <title>Acknowledgments</title>
      <p>We thank Rafael Rivera Bustamante for kindly providing the <italic>PepGMV</italic> clone and CONACYT México for supporting this work.</p>
    </ack>
    <notes>
      <title>Conflict of Interest</title>
      <p>The authors declare no conflict of interest.</p>
    </notes>
    <ref-list>
      <title>References and Notes</title>
      <ref id="B1-viruses-04-01792">
        <label>1.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gutierrez</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Ramirez-Parra</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Castellano</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>Sanz-Burgos</surname>
              <given-names>A.P.</given-names>
            </name>
            <name>
              <surname>Luque</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Missich</surname>
              <given-names>R.</given-names>
            </name>
          </person-group>
          <article-title>Geminivirus DNA replication and cell cycle interactions</article-title>
          <source>Vet. Microbiol.</source>
          <year>2004</year>
          <volume>98</volume>
          <fpage>111</fpage>
          <lpage>119</lpage>
          <pub-id pub-id-type="doi">10.1016/j.vetmic.2003.10.012</pub-id>
        </citation>
      </ref>
      <ref id="B2-viruses-04-01792">
        <label>2.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kittelmann</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Rau</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Gronenborn</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Jeske</surname>
              <given-names>H.</given-names>
            </name>
          </person-group>
          <article-title>Plant geminivirus Rep protein induces rereplication in fission yeast</article-title>
          <source>J. Virol.</source>
          <year>2009</year>
          <volume>83</volume>
          <fpage>6769</fpage>
          <lpage>6778</lpage>
          <pub-id pub-id-type="doi">10.1128/JVI.02491-08</pub-id>
        </citation>
      </ref>
      <ref id="B3-viruses-04-01792">
        <label>3.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hanley-Bowdoin</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Settlage</surname>
              <given-names>S.B.</given-names>
            </name>
            <name>
              <surname>Robertson</surname>
              <given-names>D.</given-names>
            </name>
          </person-group>
          <article-title>Reprogramming plant gene expression: A prerequisite to geminivirus DNA replication</article-title>
          <source>Mol. Plant Pathol.</source>
          <year>2004</year>
          <volume>5</volume>
          <fpage>149</fpage>
          <lpage>156</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1364-3703.2004.00214.x</pub-id>
        </citation>
      </ref>
      <ref id="B4-viruses-04-01792">
        <label>4.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nash</surname>
              <given-names>T.E.</given-names>
            </name>
            <name>
              <surname>Dallas</surname>
              <given-names>M.B.</given-names>
            </name>
            <name>
              <surname>Reyes</surname>
              <given-names>M.I.</given-names>
            </name>
            <name>
              <surname>Buhrman</surname>
              <given-names>G.K.</given-names>
            </name>
            <name>
              <surname>Ascencio-Ibañez</surname>
              <given-names>J.T.</given-names>
            </name>
            <name>
              <surname>Hanley-Bowdoin</surname>
              <given-names>L.</given-names>
            </name>
          </person-group>
          <article-title>Functional analysis of a novel motif conserved across geminivirus Rep proteins</article-title>
          <source>J. Virol.</source>
          <year>2011</year>
          <volume>85</volume>
          <fpage>1182</fpage>
          <lpage>1192</lpage>
        <pub-id pub-id-type="doi">10.1128/JVI.02143-10</pub-id><pub-id pub-id-type="pmid">21084480</pub-id></citation>
      </ref>
      <ref id="B5-viruses-04-01792">
        <label>5.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yadava</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Suyal</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Mukherjee</surname>
              <given-names>S.K.</given-names>
            </name>
          </person-group>
          <article-title>Begomovirus DNA replication and pathogenicity</article-title>
          <source>Curr. Sci.</source>
          <year>2010</year>
          <volume>98</volume>
          <fpage>360</fpage>
          <lpage>368</lpage>
        </citation>
      </ref>
      <ref id="B6-viruses-04-01792">
        <label>6.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Carrillo-Tripp</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Lozoya-Gloria</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Rivera-Bustamante</surname>
              <given-names>R.F.</given-names>
            </name>
          </person-group>
          <article-title>Symptom remission and specific resistance of pepper plants after infection by <italic>Pepper golden mosaic virus</italic></article-title>
          <source>Virology</source>
          <year>2007</year>
          <volume>97</volume>
          <fpage>51</fpage>
          <lpage>59</lpage>
        </citation>
      </ref>
      <ref id="B7-viruses-04-01792">
        <label>7.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ascencio-Ibáñez</surname>
              <given-names>J.T.</given-names>
            </name>
            <name>
              <surname>Sozzani</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>T.J.</given-names>
            </name>
            <name>
              <surname>Chu</surname>
              <given-names>T.M.</given-names>
            </name>
            <name>
              <surname>Wolfinger</surname>
              <given-names>R.D.</given-names>
            </name>
            <name>
              <surname>Cella</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Hanley Bowdoin</surname>
              <given-names>L.</given-names>
            </name>
          </person-group>
          <article-title>Global analysis of <italic>Arabidopsis</italic> gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection</article-title>
          <source>Plant Physiol.</source>
          <year>2008</year>
          <volume>148</volume>
          <fpage>436</fpage>
          <lpage>454</lpage>
          <pub-id pub-id-type="doi">10.1104/pp.108.121038</pub-id>
        </citation>
      </ref>
      <ref id="B8-viruses-04-01792">
        <label>8.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Torres-Pacheco</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Guevara-González</surname>
              <given-names>R.G.</given-names>
            </name>
            <name>
              <surname>Ruíz-Medrano</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Rivera-Bustamante</surname>
              <given-names>R.F.</given-names>
            </name>
          </person-group>
          <article-title>Los geminivirus como modelos de estudio de ciclo celular y de la apoptosis en plantas (in Spanish)</article-title>
          <source>Revista Mexicana de Fitolpatología</source>
          <year>1996</year>
          <volume>14</volume>
          <fpage>88</fpage>
          <lpage>96</lpage>
        </citation>
      </ref>
      <ref id="B9-viruses-04-01792">
        <label>9.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Herwing</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Strauss</surname>
              <given-names>M.</given-names>
            </name>
          </person-group>
          <article-title>The retinoblastoma protein: A master regulator of cell cycle, differentiation and apoptosis</article-title>
          <source>Eur. J. Biochem.</source>
          <year>1997</year>
          <volume>246</volume>
          <fpage>581</fpage>
          <lpage>601</lpage>
        <pub-id pub-id-type="doi">10.1111/j.1432-1033.1997.t01-2-00581.x</pub-id><pub-id pub-id-type="pmid">9219514</pub-id></citation>
      </ref>
      <ref id="B10-viruses-04-01792">
        <label>10.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sidle</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Palaty</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Dirks</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Wiggan</surname>
              <given-names>O.</given-names>
            </name>
            <name>
              <surname>Kiess</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Gill</surname>
              <given-names>R.M.</given-names>
            </name>
            <name>
              <surname>Wong</surname>
              <given-names>A.K.</given-names>
            </name>
            <name>
              <surname>Hamel</surname>
              <given-names>P.A.</given-names>
            </name>
          </person-group>
          <article-title>Activity of the retinoblastoma family proteins, pRB, p107, and p130, during cellular proliferation and differentiation</article-title>
          <source>Crit. Rev. Biochem. Molec. Biol.</source>
          <year>1996</year>
          <volume>31</volume>
          <fpage>237</fpage>
          <lpage>271</lpage>
          <pub-id pub-id-type="doi">10.3109/10409239609106585</pub-id>
        </citation>
      </ref>
      <ref id="B11-viruses-04-01792">
        <label>11.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Burkhart</surname>
              <given-names>D.L.</given-names>
            </name>
            <name>
              <surname>Sage</surname>
              <given-names>J.</given-names>
            </name>
          </person-group>
          <article-title>Cellular mechanisms of tumour suppression by the retinoblastoma gene</article-title>
          <source>Nature Rev. Cancer</source>
          <year>2008</year>
          <volume>8</volume>
          <fpage>671</fpage>
          <lpage>682</lpage>
          <pub-id pub-id-type="doi">10.1038/nrc2399</pub-id>
        </citation>
      </ref>
      <ref id="B12-viruses-04-01792">
        <label>12.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Desvoyes</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Ramirez-Parra</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Xie</surname>
              <given-names>Q.</given-names>
            </name>
            <name>
              <surname>Chua</surname>
              <given-names>N.H.</given-names>
            </name>
            <name>
              <surname>Gutierrez</surname>
              <given-names>C.</given-names>
            </name>
          </person-group>
          <article-title>Cell type-specific role of the retinoblastoma/E2F pathway during Arabidopsis leaf development</article-title>
          <source>Plant Physiol.</source>
          <year>2006</year>
          <volume>140</volume>
          <fpage>67</fpage>
          <lpage>80</lpage>
        <pub-id pub-id-type="pmid">16361519</pub-id></citation>
      </ref>
      <ref id="B13-viruses-04-01792">
        <label>13.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nagar</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Pedersen</surname>
              <given-names>T.J.</given-names>
            </name>
            <name>
              <surname>Carrick</surname>
              <given-names>K.M.</given-names>
            </name>
            <name>
              <surname>Hanley-Bowdoin</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Robertson</surname>
              <given-names>D.</given-names>
            </name>
          </person-group>
          <article-title>A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells</article-title>
          <source>Plant Cell</source>
          <year>1995</year>
          <volume>7</volume>
          <fpage>705</fpage>
          <lpage>719</lpage>
        <pub-id pub-id-type="pmid">7647562</pub-id></citation>
      </ref>
      <ref id="B14-viruses-04-01792">
        <label>14.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Martin</surname>
              <given-names>D.P.</given-names>
            </name>
            <name>
              <surname>Biagini</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Lefeuvre</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Golden</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Roumagnac</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Varsani</surname>
              <given-names>A.</given-names>
            </name>
          </person-group>
          <article-title>Recombination in eukaryotic single stranded DNA viruses</article-title>
          <source>Viruses</source>
          <year>2011</year>
          <volume>3</volume>
          <fpage>1699</fpage>
          <lpage>1738</lpage>
          <pub-id pub-id-type="doi">10.3390/v3091699</pub-id>
        </citation>
      </ref>
      <ref id="B15-viruses-04-01792">
        <label>15.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Laufs</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Jupin</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>David</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Schumacher</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Heyraud-Nitschke</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Gronenbom</surname>
              <given-names>B.</given-names>
            </name>
          </person-group>
          <article-title>Geminivirus replication: Genetic and biochemical characterization of Rep protein function, a review</article-title>
          <source>Biochimie</source>
          <year>1995</year>
          <volume>77</volume>
          <fpage>765</fpage>
          <lpage>773</lpage>
          <pub-id pub-id-type="doi">10.1016/0300-9084(96)88194-6</pub-id>
        </citation>
      </ref>
      <ref id="B16-viruses-04-01792">
        <label>16.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chapa-Oliver</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Guevara-Gonzalez</surname>
              <given-names>R.G.</given-names>
            </name>
            <name>
              <surname>González-Chavira</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>Ocampo-Velazquez</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Feregrino-Pérez</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Mejía-Teniente</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Herrera-Ruíz</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Torres-Pacheco</surname>
              <given-names>I.</given-names>
            </name>
          </person-group>
          <article-title>Analogies between geminivirus and oncovirus: Cell cycle regulation</article-title>
          <source>Afr. J. Biotechnol.</source>
          <year>2011</year>
          <volume>10</volume>
          <fpage>11327</fpage>
          <lpage>11332</lpage>
        </citation>
      </ref>
      <ref id="B17-viruses-04-01792">
        <label>17.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Doonan</surname>
              <given-names>J.H.</given-names>
            </name>
            <name>
              <surname>Sablowski</surname>
              <given-names>R.</given-names>
            </name>
          </person-group>
          <article-title>Walls around tumors—Why do plants do not develop cancer</article-title>
          <source>Nat. Rev. Canc.</source>
          <year>2010</year>
          <volume>10</volume>
          <fpage>794</fpage>
          <lpage>802</lpage>
          <pub-id pub-id-type="doi">10.1038/nrc2942</pub-id>
        </citation>
      </ref>
      <ref id="B18-viruses-04-01792">
        <label>18.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kong</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Orozco</surname>
              <given-names>B.M.</given-names>
            </name>
            <name>
              <surname>Roe</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>Nagar</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ou</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Feiler</surname>
              <given-names>H.S.</given-names>
            </name>
            <name>
              <surname>Durfee</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Miller</surname>
              <given-names>A.B.</given-names>
            </name>
            <name>
              <surname>Gruissem</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Robertson</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Hanley-Bowdoin</surname>
              <given-names>L.</given-names>
            </name>
          </person-group>
          <article-title>A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants</article-title>
          <source>EMBO J.</source>
          <year>2000</year>
          <volume>19</volume>
          <fpage>3485</fpage>
          <lpage>3495</lpage>
          <pub-id pub-id-type="doi">10.1093/emboj/19.13.3485</pub-id>
        </citation>
      </ref>
      <ref id="B19-viruses-04-01792">
        <label>19.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Castillo</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Collinet</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Deret</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Kashoggi</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Bejarano</surname>
              <given-names>E.R.</given-names>
            </name>
          </person-group>
          <article-title>Dual interaction of plant PCNA with geminivirus replication accessory protein (Ren) and viral replication protein (Rep)</article-title>
          <source>Virology</source>
          <year>2003</year>
          <volume>312</volume>
          <fpage>381</fpage>
          <lpage>394</lpage>
          <pub-id pub-id-type="doi">10.1016/S0042-6822(03)00234-4</pub-id>
        </citation>
      </ref>
      <ref id="B20-viruses-04-01792">
        <label>20.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jordan</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Schallhorn</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Wurm</surname>
              <given-names>F.M.</given-names>
            </name>
          </person-group>
          <article-title>Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation</article-title>
          <source>Nucleic Acids Res.</source>
          <year>1996</year>
          <volume>24</volume>
          <fpage>596</fpage>
          <lpage>601</lpage>
          <pub-id pub-id-type="doi">10.1093/nar/24.4.596</pub-id>
        </citation>
      </ref>
      <ref id="B21-viruses-04-01792">
        <label>21.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sugden</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Pariante</surname>
              <given-names>C.M.</given-names>
            </name>
            <name>
              <surname>McGuffin</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Aitchison</surname>
              <given-names>K.J.</given-names>
            </name>
            <name>
              <surname>D’Souza</surname>
              <given-names>U.M.</given-names>
            </name>
          </person-group>
          <article-title>Housekeeping gene expression is affected by antidepressant treatment in a mouse fibroblast cell line</article-title>
          <source>J. Psychopharmacol.</source>
          <year>2010</year>
          <volume>24</volume>
          <fpage>1253</fpage>
          <lpage>1259</lpage>
          <pub-id pub-id-type="doi">10.1177/0269881108099690</pub-id>
        </citation>
      </ref>
      <ref id="B22-viruses-04-01792">
        <label>22.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bocchetta</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Eliasz</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>de Marco</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>Rudzinski</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Carbone</surname>
              <given-names>M.</given-names>
            </name>
          </person-group>
          <article-title>The SV40 large T antigen-p53 complexes bind and actívate the insulin-like growth factor-I promoter stimulating cell growth</article-title>
          <source>Cancer Res.</source>
          <year>2008</year>
          <volume>68</volume>
          <fpage>1022</fpage>
          <lpage>1028</lpage>
          <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-07-5203</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>
