Detection of Antibiotic Resistant Staphylococcus aureus from Milk: A Public Health Implication
Abstract
:1. Introduction
2. Experimental Section
2.1. Study Design
2.2. Study Site
2.3. Sample Collection
2.4. Enrichments and Isolation of S. aureus
2.5. Bacterial Identification
2.5.1. Biochemical Identification of Staphylococci
2.6. Determination of the Identities of Isolates using the Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-TOF MS)
2.7. Molecular Identification by PCR
2.7.1. DNA Extraction
2.7.2. 16S rRNA Specific PCR for the Detection of Staphylococci
2.7.3. Specific PCR for the Identification of Staphylococcus aureus
2.8. Multiplex Polymerase Chain Reaction (PCR) Detection of Gene Sequences that Encode Virulence Determinants in S. aureus
2.9. Agarose Gel Electrophoresis of DNA Extracted and PCR Products
Primer | Sequence | Target Gene | Amplicon Size (bp) |
---|---|---|---|
16S rRNA F | GTAGGTGGCAAGCGTTACC | 16S rRNA | 228 |
16S rRNA R | CGCACATCAGCGTCAG | ||
Nuc F | GCGATTGATGGTGGATACGGT | Nuc | 279 |
Nuc R | AGCCAAGCCTTGACGAACTAAAGC | ||
Sea F | GGTTATCAATGTGCGGGTGG | Sea | 102 |
Sea R | CGGCACTTTTTTCTCTTCGG | ||
Seb F | GTATGGTGGTGTAACTGAGC | Seb | 164 |
Seb R | CCAAATAGTGACGAGTTAGG | ||
Sec F | AGATGAAGTAGTTGATGTGTATGG | Sec | 451 |
Sec R | CACACTTTTAGAATCAACCG | ||
Sed F | CCAATAATAGGAGAAAATAAAAG | Sed | 278 |
Sed R | ATTGGTATTTTTTTTCGTTC | ||
See F | AGGTTTTTTCACAGGTCATCC | See | 209 |
See R | CTTTTTTTTCTTCGGTCAATC | ||
Eta F | ATATCAACGTGAGGGCTCTAGTAC | Sta | 1155 |
Eta R | ATGCAGTCAGCTTCTTACTGCTA | ||
Etb F | CACACATTACGGATAATGCAAG | Etb | 604 |
Etb R | TCAACCGAATAGAGTGAACTTATCT | ||
Cna F | AAAGCGTTGCCTAGTGGAGA | Can | 192 |
Cna R | AGTGCCTTCCCAAACCTTTT |
2.10. Determination of the Antibiotic Resistance Profiles of S. aureus Isolates
Antibiotic Disc Susceptibility Test, Detection of Multiple Antibiotic Resistant (MAR) Phenotypes and Penicillin Binding Protein (PBP2a)
3. Results
3.1. Presumptive Detection of Staphylococcus Species in Milk Samples Based on Cultural Characteristics
3.2. Molecular Characterisation of S. aureus Isolates from Milk
3.2.1. Specific PCR for the Identification of Staphylococcus aureus
3.2.2. Detection of Virulence Genes in Staphylococcus aureus Isolates
Sample Source | Number of Isolates Tested | Number of Isolates Positive for the Targeted Genes | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
16S rRNA gene | nuc gene | sea gene | seb gene | sec gene | see gene | sed gene | cna gene | eta gene | etb gene | |||
Coligny | 10 | |||||||||||
Carletonville | 10 | 16 | 16 | 12 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 |
Potchefstroom | 10 | 8 | 8 | 6 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
Wolmaranstad | 10 | |||||||||||
Zeerust | 10 | 12 | 12 | 10 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 |
Swartruggens | 10 | 11 | 11 | 5 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
Rustenburg | 10 | 18 | 18 | 15 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Rooigrond | 15(15)* | 34 | 34 | 30 | 0 | 0 | 24 | 0 | 0 | 0 | 0 | 0 |
Mabule | 10 | 10 | 10 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Mafikeng | 15(15)* | 15 | 15 | 12 | 0 | 0 | 4 | 0 | 0 | 0 | 0 | 0 |
Disaneng | 20(15)* | 30 | 30 | 24 | 0 | 0 | 12 | 0 | 0 | 0 | 0 | 0 |
Taung | 10 | 6 | 6 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Vryburg | 10 | 20 | 20 | 14 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 |
Setlagole | 10 | 12 | 12 | 8 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
Stella | 10 | 12 | 12 | 8 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
Madibogo | 10 | |||||||||||
Lehurutshe | 10 | 5 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Tshidilamolomo | 10 | 2 | 2 | 2 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
Total | 211 | 211 | 156 | 51 |
3.3. Identification of S. aureus Isolates Using the MALDI-TOF Mass Spectrometry
Isolate Number | Score Value | Identity Based on MALDI-TOF MS Analysis |
---|---|---|
Best Match | ||
1RO3 | 2.234 | Staphylococcus aureus |
1RO4 | 2.097 | Staphylococcus aureus |
1RO5 | 2.223 | Staphylococcus aureus |
1RO6 | 2.068 | Staphylococcus aureus |
1RO9 | 2.076 | Staphylococcus aureus |
2RO1 | 2.234 | Staphylococcus aureus |
2RO2 | 2.259 | Staphylococcus aureus |
2RO4 | 2.124 | Staphylococcus aureus |
2RO5 | 2.232 | Staphylococcus aureus |
3RO1 | 2.177 | Staphylococcus aureus |
3RO2 | 2.31 | Staphylococcus aureus |
3RO3 | 2.255 | Staphylococcus aureus |
3RO6 | 2.048 | Staphylococcus aureus |
3RO9 | 1.921 | Staphylococcus aureus |
4R1 | 2.288 | Staphylococcus aureus |
4R2 | 2.338 | Staphylococcus aureus |
4R3 | 2.224 | Staphylococcus aureus |
4R4 | 2.249 | Staphylococcus aureus |
4R5 | 2.296 | Staphylococcus aureus |
14Z1 | 2.228 | Staphylococcus aureus |
15Z1 | 2.188 | Staphylococcus aureus |
16Z1 | 2.086 | Staphylococcus aureus |
16Z2 | 2.254 | Staphylococcus aureus |
20Z1 | 2.129 | Staphylococcus aureus |
20Z2 | 2.127 | Staphylococcus aureus |
20Z3 | 2.179 | Staphylococcus aureus |
20Z4 | 2.109 | Staphylococcus aureus |
21Z1 | 2.215 | Staphylococcus aureus |
21Z2 | 2.291 | Staphylococcus aureus |
22Z1 | 2.165 | Staphylococcus aureus |
22Z2 | 2.113 | Staphylococcus aureus |
22Z3 | 2.163 | Staphylococcus aureus |
22Z4 | 2.069 | Staphylococcus aureus |
6S3 | 2.027 | Staphylococcus aureus |
6S1 | 2.129 | Staphylococcus aureus |
7S1 | 2.194 | Staphylococcus aureus |
3.4. Antibiotic Resistance of S. aureus Isolates from Milk Samples
3.5. Latex Agglutination Assay for the Detection of Penicillin Binding Protein 2a (PBP2a) in S. aureus Isolates from Milk Samples
Sampling Area | PG | AMP | OX | S | K | GM | VA | TEC | TE | E | SMX | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Carletonville NT = 12 | NR | 12 | 12 | 12 | 7 | 6 | 1 | 10 | 3 | 8 | 12 | 0 |
% | 100 | 100 | 100 | 58 | 50 | 8.3 | 83 | 25 | 66.7 | 100 | 0 | |
Potchefstroom NT = 6 | NR | 6 | 6 | 6 | 4 | 3 | 1 | 6 | 6 | 0 | 6 | 1 |
% | 100 | 100 | 100 | 67 | 50 | 17 | 100 | 100 | 0 | 100 | 17 | |
Zeerust NT = 10 | NR | 10 | 10 | 9 | 7 | 4 | 3 | 9 | 10 | 2 | 10 | 1 |
% | 100 | 100 | 90 | 70 | 40 | 30 | 90 | 100 | 20 | 10 | 10 | |
Swartruggens NT =5 | NR | 5 | 4 | 3 | 5 | 1 | 0 | 4 | 4 | 3 | 5 | 1 |
% | 100 | 80 | 60 | 100 | 20 | 0 | 80 | 80 | 60 | 100 | 20 | |
Rustenburg NT = 15 | NR | 15 | 15 | 11 | 8 | 3 | 5 | 15 | 15 | 9 | 9 | 3 |
% | 100 | 100 | 73 | 53 | 20 | 33 | 100 | 100 | 60 | 60 | 20 | |
Stella NT = 8 | NR | 8 | 3 | 4 | 4 | 0 | 2 | 5 | 7 | 7 | 3 | 3 |
% | 100 | 38 | 50 | 50 | 0 | 25 | 63 | 88 | 88 | 38 | 38 | |
Setlagole NT = 8 | NR | 8 | 4 | 7 | 3 | 2 | 5 | 5 | 5 | 8 | 6 | 6 |
% | 100 | 50 | 88 | 38 | 25 | 63 | 63 | 63 | 100 | 75 | 75 | |
Vryburg NT = 14 | NR | 14 | 6 | 10 | 8 | 6 | 10 | 9 | 9 | 13 | 7 | 8 |
% | 100 | 43 | 71 | 57 | 43 | 71 | 64 | 64 | 93 | 50 | 57 | |
Taung NT = 5 | NR | 5 | 0 | 1 | 0 | 0 | 2 | 2 | 5 | 5 | 0 | 0 |
% | 100 | 0 | 20 | 0 | 0 | 40 | 40 | 40 | 40 | 0 | 0 | |
Disaneng NT = 24 | NR | 17 | 18 | 23 | 19 | 17 | 14 | 11 | 12 | 11 | 13 | 4 |
% | 71 | 75 | 96 | 79 | 71 | 58 | 46 | 50 | 46 | 54 | 17 | |
Mafikeng NT = 11 | NR | 9 | 9 | 1 | 8 | 5 | 1 | 7 | 11 | 8 | 11 | 4 |
% | 82 | 82 | 9 | 73 | 45 | 9 | 64 | 100 | 73 | 100 | 36 | |
Mabule NT = 5 | NR | 4 | 3 | 1 | 4 | 0 | 0 | 2 | 4 | 4 | 5 | 1 |
% | 80 | 60 | 20 | 80 | 0 | 0 | 40 | 80 | 80 | 100 | 20 | |
Rooigroond NT = 30 | NR | 9 | 9 | 5 | 9 | 8 | 3 | 24 | 25 | 19 | 19 | 3 |
% | 30 | 30 | 17 | 30 | 27 | 10 | 80 | 83 | 63 | 63 | 10 | |
Tshidilamolomo NT = 2 | NR | 2 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 |
% | 100 | 50 | 0 | 50 | 0 | 0 | 50 | 0 | 0 | 50 | 0 |
3.6. Multiple Antibiotic Resistance Phenotypes of S. aureus Isolates from Milk Samples
Sample Source | Number of Isolates Tested | Number of Isolates Positive for the PBP2’ Test |
---|---|---|
Carletonville | 12 | 3 |
Potchefstroom | 5 | 2 |
Zeerust | 9 | 2 |
Swartruggens | 3 | 1 |
Rustenburg | 12 | 2 |
Rooigrond | 5 | 0 |
Mafikeng | 4 | 0 |
Vryburg | 7 | 1 |
Setlagole | 5 | 0 |
Stella | 5 | 3 |
Mabule | 3 | 0 |
Disaneng | 22 | 5 |
Total | 92 | 19 |
Sampling Area | Phenotypes | Number Observed | Percentage (%) Observed |
---|---|---|---|
Carletonville (N = 7) | PG-AMP-OX-S-K-VA-TEC-E | 3 | 43 |
PG-AMP-OX-S-VA-TEC-E | 2 | 29 | |
PG-AMP-OX-VA-TEC-E | 2 | 29 | |
Potchefstroom (N = 4) | PG-AMP-OX-S-VA-TEC-E | 2 | 50 |
Zeerust (N = 10) | PG-AMP-OX-S-VA-TEC-E | 3 | 30 |
Rustenburg (N = 10) | PG-AMP-OX-S-VA-TEC-TE-E-SMX | 2 | 20 |
PG-AMP-S-GM-VA-TEC-TE-E | 3 | 30 | |
Stella (N = 5) | PG-AMP-OX-S-K-VA-TEC-TE-E-SMX | 1 | 20 |
Setlagole (N = 4) | PG-AMP-OX-S-K-GM-TEC-TE-E-SMX | 1 | 25 |
Vryburg (N = 10) | PG-AMP-OX-S-K-GM-TE-E-SMX | 2 | 20 |
PG-AMP-S-K-VA-TEC-TE-E-SMX | 3 | 30 | |
PG-AP-OX-K-GM-VA-TEC-TE | 2 | 20 | |
Taung (N = 5) | PG-AMP-VA-TEC-TE-E | 3 | 60 |
Disaneng (N = 20) | PG-AMP-OX-S-K-GM-VA-TEC-TE-E | 2 | 10 |
PG-AMP-OX-S-K-GM-TE-E | 3 | 15 | |
PG-AMP-OX-S-K-GM-VA-TEC-E | 4 | 20 | |
PG-AMP-OX-S-K-GM-TEC-E-SMX | 3 | 15 | |
AMP-OX-S-K-GM | 2 | 10 | |
Mafikeng (N = 8) | PG-AMP-VA-TEC-TE-E | 2 | 25 |
Mabule (N = 4) | PG-AMP-S-VA-TEC-TE-E-SMX | 1 | 25 |
Rooigrond (N = 30) | OX-VA-TEC-E | 2 | 7 |
VA-TEC-E | 3 | 10 | |
VA-TEC-TE | 2 | 7 | |
OX-VA-TEC-TE | 2 | 7 | |
VA-TEC-TE-E | 2 | 7 | |
Tshidilamolomo (N = 2) | PG-AMP-S-VA-TEC | 1 | 50 |
4. Discussion
5. Conclusions
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- Swaisgood, H.E. Protein and amino acid composition of bovine milk. In Handbook of Milk Composition; Jensen, R.C., Ed.; Academic Press: London, UK, 1995; pp. 464–467. [Google Scholar]
- Haug, A.; Hostmark, A.T.; Harstad, O.M. Bovine milk in human nutrition—A review. Lipids Health Dis. 2007, 6, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Ebringer, L.; Ferenčík, M.; Krajčovič, J. Beneficial health effects of milk and fermented dairy products—Review. Folia Microbiol. 2008, 53, 378–394. [Google Scholar] [CrossRef] [PubMed]
- Michaelidou, A.M. Factors influencing nutritional and health profile of milk and milk products. Small Rumin. Res. 2008, 79, 42–50. [Google Scholar] [CrossRef]
- Jørgensen, H.J.; Mørk, T.; Høgasen, H.R.; Rørvik, L.M. Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. J. Microb. Biotechnol. 2005, 99, 158–166. [Google Scholar]
- Havelaar, A.H.; Brul, S.; de Jong, A.; de Jonge, R.; Zwietering, M.H.; Ter Kuile, B.H. Future challenges to microbial food safety. Int. J. Food Microbiol. 2010, 139, S79–S94. [Google Scholar] [CrossRef] [PubMed]
- Newell, D.G.; Koopmans, M.; Verhoef, L.; Duizer, E.; Aidara-Kane, A.; Sprong, H.; Opsteegh, M.; Langelaar, M.; Threfall, J.; Scheutz, F.; et al. Food-borne diseases—The challenges of 20 years ago still persist while new ones continue to emerge. Int. J. Food Microbiol. 2010, 139, S3–S15. [Google Scholar] [CrossRef] [PubMed]
- Normanno, G.; La Salandra, G.; Dambrosio, A.; Quaglia, N.; Corrente, M.; Parisi, A.; Santagada, G.; Firinu, A.; Crisetti, E.; Celano, G. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int. J. Food Microbiol. 2007, 115, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Huong, B.T.M.; Mahmud, Z.H.; Neogi, S.B.; Kassu, A.; Nhien, N.V.; Mohammad, A.; Yamato, M.; Ota, F.; Lam, N.T.; Dao, H.T.A. Toxigenicity and genetic diversity of Staphylococcus aureus isolated from Vietnamese ready-to-eat foods. Food Control 2010, 21, 166–171. [Google Scholar] [CrossRef]
- Evans, C.A.; Smith, W.M.; Johnston, E.A.; Giblett, E.R. Bacterial Flora of the Normal Human Skin. J. Invest. Dermatol. 1950, 15, 305–324. [Google Scholar] [CrossRef] [PubMed]
- Neely, A.N.; Maley, M.P. Survival of enterococci and staphylococci on hospital fabrics and plastic. J. Cli. Microbiol. 2000, 38, 724–726. [Google Scholar]
- Rasmussen, T.; Kirkeby, L.; Poulsen, K.; Reinholdt, J.; Kilian, M. Resident aerobic microbiota of the adult human nasal cavity. APMIS 2000, 108, 663–675. [Google Scholar] [CrossRef] [PubMed]
- Guardabassi, L.; Schwarz, S.; Lloyd, D.H. Pet animals as reservoirs of antimicrobial-resistant bacteria Review. J. Antimicrob. Chemother. 2004, 54, 321–332. [Google Scholar] [CrossRef] [PubMed]
- Westh, H.; Zinn, C.S.; Rosdahl, V.T. An international multicenter study of antimicrobial consumption and resistance in Staphylococcus aureus isolates from 15 hospitals in 14 countries. Microb. Drug Resist. 2004, 10, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Nagase, N.; Sasaki, A.; Yamashita, K.; Shimizu, A.; Wakita, Y.; Kitai, S.; Kawano, J. Isolation and species distribution of staphylococci from animal and human skin. J. Vet. Med. Sci. 2002, 64, 245–250. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H. Methicillin (oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Appl. Environ. Microbiol. 2003, 69, 6489–6494. [Google Scholar] [CrossRef] [PubMed]
- van Duijkeren, E.; Box, A.; Heck, M.; Wannet, W.; Fluit, A. Methicillin-resistant staphylococci isolated from animals. Vet. Microbiol. 2004, 103, 91–97. [Google Scholar] [CrossRef] [PubMed]
- Le Loir, Y.; Baron, F.; Gautier, M. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 2003, 2, 63–76. [Google Scholar] [PubMed]
- Lina, G.; Piémont, Y.; Godail-Gamot, F.; Bes, M.; Peter, M.O.; Gauduchon, V.; Vandenesch, F.; Etienne, J. Involvement of panton-valentine leukocidin—Producing Staphylococcus aureus in primary skin infections and pneumonia. Genet. Mol. Res. 1999, 29, 1128–1132. [Google Scholar] [CrossRef] [PubMed]
- Hageman, J.C.; Uyeki, T.M.; Francis, J.S.; Jernigan, D.B.; Wheeler, J.G.; Bridges, C.B.; Barenkamp, S.J.; Sievert, D.M.; Srinivasan, A.; Doherty, M.C. Severe community-acquired pneumonia due to Staphylococcus aureus, 2003–04 influenza season. Emerg. Infect. Dis. 2006, 12, 894–899. [Google Scholar] [CrossRef] [PubMed]
- Spanu, V.; Spanu, C.; Virdis, S.; Cossu, F.; Scarano, C.; de Santis, E.P.L. Virulence factors and genetic variability of Staphylococcus aureus strains isolated from raw sheep’s milk cheese. Int. J. Food Microbiol. 2012, 153, 53–57. [Google Scholar] [CrossRef] [PubMed]
- Vázquez-Sánchez, D.; López-Cabo, M.; Saá-Ibusquiza, P.; Rodríguez-Herrera, J.J. Incidence and characterization of Staphylococcus aureus in fishery products marketed in Galicia (Northwest Spain). Int. J. Food Microbiol. 2012, 157, 286–296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Angulo, F.; Nargund, V.; Chiller, T. Evidence of an Association between Use of Anti-microbial Agents in Food Animals and Anti-Microbial Resistance among Bacteria Isolated from Humans and the Human Health Consequences of Such Resistance. J. Vet. Med. 2004, 51, 374–379. [Google Scholar] [CrossRef] [PubMed]
- Phillips, I.; Casewell, M.; Cox, T.; de Groot, B.; Friis, C.; Jones, R.; Nightingale, C.; Preston, R.; Waddell, J. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J. Antimicrob. Chemother. 2004, 53, 28–52. [Google Scholar] [CrossRef] [PubMed]
- Carmeli, Y.; Troillet, N.; Karchmer, A.W.; Samore, M.H. Health and economic outcomes of antibiotic resistance in Pseudomonas aeruginosa. Arch. Intern. Med. 1999, 159, 1127–1132. [Google Scholar] [CrossRef] [PubMed]
- Cosgrove, S.E. The relationship between antimicrobial resistance and patient outcomes: Mortality, length of hospital stay, and health care costs. Genet. Mol. Res. 2006, 42, S82–S89. [Google Scholar] [CrossRef] [PubMed]
- Hsueh, P.R.; Chen, W.H.; Luh, K.T. Relationships between antimicrobial use and antimicrobial resistance in Gram-negative bacteria causing nosocomial infections from 1991–2003 at a university hospital in Taiwan. Int. J. Antimicrob. Agents 2005, 26, 463–472. [Google Scholar] [CrossRef] [PubMed]
- Rogues, A.M.; Dumartin, C.; Amadéo, B.; Venier, A.G.; Marty, N.; Parneix, P.; Gachie, J.P. Relationship between rates of antimicrobial consumption and the incidence of antimicrobial resistance in Staphylococcus aureus and Pseudomonas aeruginosa isolates from 47 French hospitals. Infect. Control. Hosp. Epidemiol. 2007, 28, 1389–1395. [Google Scholar] [CrossRef] [PubMed]
- Sapkota, A.R.; Lefferts, L.Y.; McKenzie, S.; Walker, P. What do we feed to food-production animals? A review of animal feed ingredients and their potential impacts on human health. Environ. Health Perspect. 2007, 663–670. [Google Scholar] [CrossRef] [PubMed]
- Silbergeld, E.K.; Graham, J.; Price, L.B. Industrial food animal production, antimicrobial resistance, and human health. Annu. Rev. Public Health 2008, 29, 151–169. [Google Scholar] [CrossRef] [PubMed]
- Jevsons, M.P. Celbenin-resistant staphylococci. Br. Med. J. 1961, 1, 24–25. [Google Scholar]
- Lim, D.; Strynadka, N.C. Structural basis for the β-lactam resistance of PBP2a from methicillin-resistant Staphylococcus aureus. Nat. Struct. MolBiol. 2002, 9, 870–876. [Google Scholar] [CrossRef] [PubMed]
- Fuda, C.; Suvorov, M.; Vakulenko, S.B.; Mobashery, S. The basis for resistance to β-lactam antibiotics by penicillin-binding protein 2a of methicillin-resistant Staphylococcus aureus. J. Biol. Chem. 2004, 279, 40802–40806. [Google Scholar] [CrossRef] [PubMed]
- Tenover, F.C.; Weigel, L.M.; Appelbaum, P.C.; McDougal, L.K.; Chaitram, J.; McAllister, S.; Clark, N.; Killgore, G.; O’Hara, C.M.; Jevitt, L. Vancomycin-resistant Staphylococcus aureus isolate from a patient in Pennsylvania. Antimicrob. Agents and Chemother. 2004, 48, 275–280. [Google Scholar] [CrossRef]
- Ateba, C.N.; Mbewe, M.; Moneoang, M.S.; Bezuidenhout, C.C. Antibiotic-resistant Staphylococcus aureus isolated from milk in the Mafikeng Area, North West province, South Africa. S. Afr. J. Sci. 2010, 106, 1–6. [Google Scholar] [CrossRef]
- Chakraborty, S.P.; KarMahapatra, S.; Bal, M.; Roy, S. Isolation and Identification of Vancomycin Resistant Staphylococcus aureus from Post Operative Pus Sample. Available online: http://ajms.alameenmedical.org/ArticlePDFs/AJMS.4.2.2011%20p%20152-168.pdf (assessed on 18 August 2015).
- Map of the North-West Province. Available online: http://www.places.co.za/maps/north_west_map.html (accessed on 22 August 2015).
- Bergdoll, M.S.; Wong, A.L. Staphylococcus . In Encyclopedia of Food Science, Food Technology and Nutrition; Macrae, R., Robinsons, R., Michele, S., Eds.; Academic Press Inc.: New York, NY, USA, 1993; pp. 5551–5556. [Google Scholar]
- Sperber, W.A.; Moorman, M.A.; Freier, T.A. Cultural Methods for the Enrichment and Isolation of Microorganisms. In Compendium of Methods for the Microbiological Examination of Foods; Downes, F.P., Ito, K., Eds.; American Public Health Association: Washington DC, USA, 2001. [Google Scholar]
- Pelisser, M.R.; Klein, C.S.; Ascoli, K.R.; Zotti, T.R.; Arisi, A.C.M. Ocurrence of Staphylococcus aureus and multiplex pcr detection of classic enterotoxin genes in cheese and meat products. Braz. J. Microbiol. 2009, 40, 145–148. [Google Scholar] [CrossRef] [PubMed]
- Cruickshank, R.; Duguid, J.P.; Marmion, B.R.; Swain, R.H. Medical Microbiology, 12th ed.; Churchill-Living Stone: London, UK, 1975. [Google Scholar]
- Winn, W.C.; Stephen, A.; Janda, W.; Koneman, E.; Procop, G.; Schreckenberger, P.; Woods, G. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2006. [Google Scholar]
- Thomas, M. A blue peroxide slide catalase test. Mon. Bull. Minist. Health 1963, 22, 124–125. [Google Scholar]
- Turkyilmaz, S.; Kaya, O. Determination of some virulence factors in Staphylococcus spp. isolated from various clinical samples. Turk. J. Vet. Anim. Sci. 2006, 30, 127–132. [Google Scholar]
- Løvseth, A.; Loncarevic, S.; Berdal, K. Modified multiplex PCR method for detection of pyrogenic exotoxin genes in staphylococcal isolates. J. Clin. Microbiol. 2004, 42, 3869–3872. [Google Scholar] [CrossRef] [PubMed]
- Maes, N.; Magdalena, J.; Rottiers, S.; de Gheldre, Y.; Struelens, M. Evaluation of a triplex PCR assay to discriminate Staphylococcus aureus from coagulase-negative staphylococci and determine methicillin resistance from blood cultures. J. Clin. Microbiol. 2002, 40, 1514–1517. [Google Scholar] [CrossRef] [PubMed]
- Peles, F.; Wagner, M.; Varga, L.; Hein, I.; Rieck, P.; Gutser, K.; Keresztúri, P.; Kardos, G.; Turcsányi, I.; Béri, B. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. Int. J. Food Microbiol. 2007, 118, 186–193. [Google Scholar] [CrossRef] [PubMed]
- Mehrotra, M.; Wang, G.; Johnson, W.M. Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. J. Clin. Microbiol. 2000, 38, 1032–1035. [Google Scholar] [PubMed]
- Montanaro, L.; Renata Arciola, C.; Baldassarri, L.; Borsetti, E. Presence and expression of collagen adhesin gene (cna) and slime production in Staphylococcus aureus strains from orthopaedic prosthesis infections. Biomaterials 1999, 20, 1945–1949. [Google Scholar] [CrossRef]
- Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 1996, 45, 493–496. [Google Scholar]
- Performance Standards for Antimicrobial Susceptibility Testing; 17th Supplement, Approved Standard (M100-S17). 2007. Available online: http//www.microbiolab-bg.com/wp-content/uploads/2015/05/CLSI.pdf (accessed on 22 August 2015).
- Rota, C.; Yanguela, J.; Blanco, D.; Carramilana, J.J.; Arino, A.; Herrera, A. High prevalence of multiple resistance to antibiotics in 144 listeria isolates from Spanish dairy and meat products. J. Food Prot. 1996, 59, 938–943. [Google Scholar]
- Løvseth, A.; Loncarevic, S.; Berdal, K. Modified multiplex PCR method for detection of pyrogenic exotoxin genes in staphylococcal isolates. J. Clin. Microbiol. 2004, 42, 3869–3872. [Google Scholar] [CrossRef] [PubMed]
- Jones, T.F.; Kellum, M.E.; Porter, S.S.; Bell, M.; Schaffner, W. An outbreak of community-acquired foodborne illness caused by methicillin-resistant Staphylococcus aureus. Emerg. Infect. Dis. 2002, 8, 82–84. [Google Scholar] [CrossRef] [PubMed]
- O’Ferrall-Berndt, M. A comparison of selected public health criteria in milk from milk-shops and from a national distributor. J. S. Afr. Vet. Assoc. 2003, 74, 35–40. [Google Scholar] [CrossRef] [PubMed]
- Akineden, Ö.; Hassan, A.A.; Schneider, E.; Usleber, E. Enterotoxigenic properties of Staphylococcus aureus isolated from goats’ milk cheese. Int. J. Food Microbiol. 2008, 124, 211–216. [Google Scholar]
- Argudin, M.; Tenhagen, B.A.; Fetsch, A.; Sachsenröder, J.; Käsbohrer, A.; Schroeter, A.; Hammerl, J.A.; Hertwig, S.; Helmuth, R.; Bräunig, J. Virulence and resistance determinants of German Staphylococcus aureus ST398 isolates from nonhuman sources. Appl. Environ. Microbiol. 2011, 77, 3052–3060. [Google Scholar] [CrossRef] [PubMed]
- Intrakamhaeng, M.; Komutarin, T.; Pimpukdee, K.; Aengwanich, W. Incidence of enterotoxin-producing MRSA in bovine mastitis cases, bulk milk tanks and processing plants in Thailand. J. Anim. Vet. Adv. 2012, 11, 655–661. [Google Scholar]
- Kamal, R.M.; Bayoumi, M.A.; Abd El Aal, S.F.A. MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini-survey. Food Control 2013, 33, 49–53. [Google Scholar] [CrossRef]
- Zouharova, M.; Rysanek, D. Multiplex PCR and RPLA Identification of Staphylococcus aureus enterotoxigenic strains from bulk tank milk. Zoonoses Public Health 2008, 55, 313–319. [Google Scholar] [CrossRef] [PubMed]
- Mirzaei, H.; Tofighi, A.; Sarabi, H.K.; Farajli, M. Prevalence of Methicillin-Resistant Staphylococcus aureus in Raw Milk and Dairy Products in Sarab by Culture and PCR Techniques. J. Anim. Vet. Adv. 2011, 10, 3107–3111. [Google Scholar]
- Pereira, V.; Lopes, C.; Castro, A.; Silva, J.; Gibbs, P.; Teixeira, P. Characterization for enterotoxin production, virulence factors, and antibiotic susceptibility of Staphylococcus aureus isolates from various foods in Portugal. Food Microbiol. 2009, 26, 278–282. [Google Scholar] [CrossRef] [PubMed]
- Gücükoğlu, A.; Onur Kevenk, T.; Uyanik, T.; Çadirci, Ö.; Terzi, G.; Alişarli, M. Detection of enterotoxigenic Staphylococcus aureus in raw milk and dairy products by multiplex PCR. J. Food Sci. 2012, 77, M620–M623. [Google Scholar] [CrossRef] [PubMed]
- Andrighetto, C.; Knijff, E.; Lombardi, A.; Torriani, S.; Vancanneyt, M.; Kersters, K.; Swings, J.; Dellaglio, F. Phenotypic and genetic diversity of enterococci isolated from italian cheeses. J. Dairy Res. 2001, 68, 303–316. [Google Scholar] [CrossRef] [PubMed]
- Pesavento, G.; Ducci, B.; Comodo, N. Antimicrobial resistance profile of Staphylococcus aureus isolated from raw meat: A research for methicillin resistant Staphylococcus aureus (MRSA). Food Control 2007, 18, 196–200. [Google Scholar] [CrossRef]
- Ito, T.; Okuma, K.; Ma, X.X.; Yuzawa, H.; Hiramatsu, K. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: Genomic island SCC. Drug Resist. Updat. 2003, 6, 41–52. [Google Scholar] [CrossRef]
- Yamamoto, T.; Hung, W.C.; Takano, T.; Nishiyama, A. Genetic nature and virulence of community-associated methicillin-resistant Staphylococcus aureus. BioMedicine 2013, 3, 2–18. [Google Scholar] [CrossRef]
- Kérouanton, A.; Hennekinne, J.; Letertre, C.; Petit, L.; Chesneau, O.; Brisabois, A.; de Buyser, M. Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int. J. Food Microbiol. 2007, 115, 369–375. [Google Scholar] [CrossRef] [PubMed]
- Boerlin, P.; Burnens, A.P.; Frey, J.; Kuhnert, P.; Nicolet, J. Molecular epidemiology and genetic linkage of macrolide and aminoglycoside resistance in Staphylococcus intermedius of canine origin. Vet. Microbiol. 2001, 79, 155–169. [Google Scholar] [CrossRef]
- Aydin, A.; Sudagidan, M.; Muratoglu, K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int. J. Food Microbiol. 2011, 148, 99–106. [Google Scholar]
- Oliveira, D.C.; de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2002, 46, 2155–2161. [Google Scholar] [CrossRef] [PubMed]
- Swenson, J.M.; Lonsway, D.; McAllister, S.; Thompson, A.; Jevitt, L.; Zhu, W.; Patel, J.B. Detection of mecA-mediated resistance using reference and commercial testing methods in a collection of Staphylococcus aureus expressing borderline oxacillin MICs. Diagn. Microbiol. Infect. Dis. 2007, 58, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Peacock, S.J.; Moore, C.E.; Justice, A.; Kantzanou, M.; Story, L.; Mackie, K.; O’Neill, G.; Day, N.P. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect. Immun. 2002, 70, 4987–4996. [Google Scholar] [CrossRef] [PubMed]
- Fueyo, J.; Martın, M.; Gonzalez-Hevia, M.; Mendoza, M. Enterotoxin production and DNA fingerprinting in Staphylococcus aureus isolated from human and food samples. Relations between genetic types and enterotoxins. Int. J. Food Microbiol. 2001, 67, 139–145. [Google Scholar] [CrossRef]
- Mašlanková, J.; Pilipčincová, I.; Tkáčiková, L. Pheno and genotyping of Staphylococcus aureus isolates of sheep origin. Acta Vet. Brno. 2009, 78, 345–352. [Google Scholar] [CrossRef]
- Scherrer, D.; Corti, S.; Muehlherr, J.; Zweifel, C.; Stephan, R. Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet. Microbiol. 2004, 101, 101–107. [Google Scholar] [CrossRef] [PubMed]
- Karahan, M.; Açık, M.N.; Cetinkaya, B. Investigation of toxin genes by polymerase chain reaction in Staphylococcus aureus strains isolated from bovine mastitis in Turkey. Foodborne Pathog. Dis. 2009, 6, 1029–1035. [Google Scholar] [CrossRef] [PubMed]
- Rogolsky, M. Non-enteric toxins of Staphylococcus aureus. Microbiol. Rev. 1979, 43, 320–336. [Google Scholar] [PubMed]
- Zecconi, A.; Scali, F. Staphylococcus aureus virulence factors in evasion from innate immune defenses in human and animal diseases. Immunol. Lett. 2013, 150, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Pavlov, D.; de Wet, C.M.E.; Grabow, W.O.K.; Ehlers, M.M. Potentially pathogenic features of heterotrophic plate count bacteria isolated from treated and untreated drinking water. Int. J. Food Microbiol. 2004, 92, 275–287. [Google Scholar] [CrossRef] [PubMed]
- Gillapsy, A.F.; Landolo, J.J. Staphylococcus . In The Desk Encyclopedia of Microbiology, 2nd ed.; Schaechter, M., Ed.; Elsevier Academic Press: San Diego, CA, USA, 2009. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akindolire, M.A.; Babalola, O.O.; Ateba, C.N. Detection of Antibiotic Resistant Staphylococcus aureus from Milk: A Public Health Implication. Int. J. Environ. Res. Public Health 2015, 12, 10254-10275. https://doi.org/10.3390/ijerph120910254
Akindolire MA, Babalola OO, Ateba CN. Detection of Antibiotic Resistant Staphylococcus aureus from Milk: A Public Health Implication. International Journal of Environmental Research and Public Health. 2015; 12(9):10254-10275. https://doi.org/10.3390/ijerph120910254
Chicago/Turabian StyleAkindolire, Muyiwa Ajoke, Olubukola Oluranti Babalola, and Collins Njie Ateba. 2015. "Detection of Antibiotic Resistant Staphylococcus aureus from Milk: A Public Health Implication" International Journal of Environmental Research and Public Health 12, no. 9: 10254-10275. https://doi.org/10.3390/ijerph120910254